Review



formulatrix tempest  (Formulatrix)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Formulatrix formulatrix tempest
    Formulatrix Tempest, supplied by Formulatrix, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tv3/us12172975-276-1-1
    Average 94 stars, based on 1 article reviews
    formulatrix tempest - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Lysis:

    Article Title: An ependymal cell census identifies heterogeneous and ongoing cell maturation in the adult mouse spinal cord that changes dynamically on injury.
    Article Snippet: .. Lysis plates were created by dispensing 0.4 ml lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton X-100 (Sigma, 93443-100ML), 3.125 mM dNTP mix (Thermo Fisher Scientific, R0193), 3.125 mMOligo-dT 30 VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher Scientific, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901) using a Tempest liquid handler (Formulatrix). ..

    Recombinant:

    Article Title: An ependymal cell census identifies heterogeneous and ongoing cell maturation in the adult mouse spinal cord that changes dynamically on injury.
    Article Snippet: .. Lysis plates were created by dispensing 0.4 ml lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton X-100 (Sigma, 93443-100ML), 3.125 mM dNTP mix (Thermo Fisher Scientific, R0193), 3.125 mMOligo-dT 30 VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher Scientific, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901) using a Tempest liquid handler (Formulatrix). ..

    Polymerase Chain Reaction:

    Article Title: An ependymal cell census identifies heterogeneous and ongoing cell maturation in the adult mouse spinal cord that changes dynamically on injury.
    Article Snippet: .. Lysis plates were created by dispensing 0.4 ml lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton X-100 (Sigma, 93443-100ML), 3.125 mM dNTP mix (Thermo Fisher Scientific, R0193), 3.125 mMOligo-dT 30 VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher Scientific, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901) using a Tempest liquid handler (Formulatrix). ..

    Binding Assay:

    Article Title: 1H-indazole carboxamides as receptor-interacting protein kinase 1 inhibitors (RIPK1)
    Article Snippet: RIPK1 HTRF Binding Assay A solution was prepared containing 0.2 nM Anti GST-Tb (Cisbio, 61GSTTLB), 90.6 nM probe and 1 nM His-GST-TVMV-hRIPK1 (1-324) in FRET Buffer (20 mM HEPES, 10 mM MgCl2, 0.015% Brij-35, 4 mM DTT, 0.05 mg/mL BSA). .. Using Formulatrix Tempest, the detection antibody/enzyme/probe solution (2 mL) was dispensed into wells of a 1536 plate (Black Low Binding Polystyrene 1536 Plate (Corning, 3724)) containing 10 nL of compounds of interest at appropriate concentration in DMSO. ..

    Article Title: Triazolopyridinyl compounds as kinase inhibitors
    Article Snippet: RIPK1 HTRF Binding Assay A solution was prepared containing 0.2 nM Anti GST-Tb (Cisbio, 61GSTTLB), 90.6 nM probe and 1 nM His-GST-TVMV-hRIPK1(1-324) in FRET Buffer (20 mM HEPES, 10 mM MgCl2, 0.015% Brij-35, 4 mM DTT, 0.05 mg/mL BSA). .. Using Formulatrix Tempest, the detection antibody/enzyme/probe solution (2 mL) was dispensed into wells of a 1536 plate (Black Low Binding Polystyrene 1536 Plate (Corning, 3724)) containing 10 nL of compounds of interest at appropriate concentration in DMSO. ..

    Concentration Assay:

    Article Title: 1H-indazole carboxamides as receptor-interacting protein kinase 1 inhibitors (RIPK1)
    Article Snippet: RIPK1 HTRF Binding Assay A solution was prepared containing 0.2 nM Anti GST-Tb (Cisbio, 61GSTTLB), 90.6 nM probe and 1 nM His-GST-TVMV-hRIPK1 (1-324) in FRET Buffer (20 mM HEPES, 10 mM MgCl2, 0.015% Brij-35, 4 mM DTT, 0.05 mg/mL BSA). .. Using Formulatrix Tempest, the detection antibody/enzyme/probe solution (2 mL) was dispensed into wells of a 1536 plate (Black Low Binding Polystyrene 1536 Plate (Corning, 3724)) containing 10 nL of compounds of interest at appropriate concentration in DMSO. ..

    Article Title: Triazolopyridinyl compounds as kinase inhibitors
    Article Snippet: RIPK1 HTRF Binding Assay A solution was prepared containing 0.2 nM Anti GST-Tb (Cisbio, 61GSTTLB), 90.6 nM probe and 1 nM His-GST-TVMV-hRIPK1(1-324) in FRET Buffer (20 mM HEPES, 10 mM MgCl2, 0.015% Brij-35, 4 mM DTT, 0.05 mg/mL BSA). .. Using Formulatrix Tempest, the detection antibody/enzyme/probe solution (2 mL) was dispensed into wells of a 1536 plate (Black Low Binding Polystyrene 1536 Plate (Corning, 3724)) containing 10 nL of compounds of interest at appropriate concentration in DMSO. ..

    Bacteria:

    Article Title: Discovery of an anti-virulence compound that targets the Staphylococcus aureus SaeRS two-component system to inhibit toxic shock syndrome toxin 1 (TSST-1) production
    Article Snippet: .. Briefly, bacteria were grown and the OD 600 was adjusted to 0.01 in fresh media and distributed in 384-wells microplates using the Tempest dispenser (Formulatrix). ..



    Similar Products

    formulatrix tempest  (Formulatrix)
    94
    Formulatrix formulatrix tempest
    Formulatrix Tempest, supplied by Formulatrix, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tv3/us12172975-276-1-1
    Average 94 stars, based on 1 article reviews
    formulatrix tempest - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    tempest dispenser  (Formulatrix)
    94
    Formulatrix tempest dispenser
    Tempest Dispenser, supplied by Formulatrix, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tv3/pmc11566907-141-60-62
    Average 94 stars, based on 1 article reviews
    tempest dispenser - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    tempest liquid dispenser system  (Formulatrix)
    94
    Formulatrix tempest liquid dispenser system
    Tempest Liquid Dispenser System, supplied by Formulatrix, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tv3/TEMPEST/pmc11575580-248-1-5
    Average 94 stars, based on 1 article reviews
    tempest liquid dispenser system - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    gfp single band exciters et filter set  (Addgene inc)
    92
    Addgene inc gfp single band exciters et filter set
    Axonal Rtn-1 KD increases outgrowth by promoting Spastin’s microtubule severing. A. Representative fluorescent STED images of distal axons from microfluidic chambers containing control cortical axons or forty-four hours post-axotomy, which were stained for Rtn-1C (green), Spastin (red), and F-actin (phalloidin, blue). Insets show colocalization of Rtn-1C and Spastin. Right: Line scan analysis of Rtn-1C and Spastin highlighted in the white rectangle and their distribution along the axon. Bar graphs show the quantification of colocalization in control and axotomy conditions. Scale bar= 5 µm. Data are displayed as mean ± standard error of 6-7 axons. Unpaired t test; ∗∗p < 0.01 B. Representative images of axonal fields from microfluidic chambers 48 hours post-axotomy under different treatments: control sequence (Scrambled, Scr), Rtn-1 knockdown (Rtn-1 siRNA), and Spastin pharmacological inhibition (SPZT), and labeled with β3-tubulin (β3-tub). Scale bar represents 200 µm. C. Quantification of axon outgrowth under the treatments shown in A. The Area under the curve (AUC) was measured as the sum of the relative number of intersections at different distance ranges from the groove in the microfluidic chambers (0-500 µm; 500-1000 µm and 1000-1500 µm). Scale bar represents 10 µm. Data are displayed as mean ± standard error of 22-24 axonal fields for condition from N=3 biological replicates. One-way ANOVA followed by Tukey’s posthoc test; ∗p < 0.05; ∗∗p < 0.01. D. Fluorescence intensity profiles of β3-tubulin, Rtn-1C, and Spastin in axons and quantifications of intensity changes of indicated proteins as the fluorescence AUC fold change of the last 50 µm compared to Scr. Data are displayed as mean ± standard error of 24-40 axons for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗∗∗p < 0.001 E. Axonal kymographs showing dynamic microtubule behavior in neurons with indicated treatments after axotomy, dashes represent the traces <t>of</t> <t>EB3-GFP</t> (end-binding protein 3). Scale bars represent 10 µm and 30 seconds, respectively. F. Analysis of microtubule dynamics parameters in non-injured and injured axons with different treatments: growth rate, track length, and lifetime of microtubule plus-end tracks. Data are displayed as mean ± standard error of 146-377 comets for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗∗p < 0.001.
    Gfp Single Band Exciters Et Filter Set, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tv3/TV3-mCHY-mASUN+(Plasmid+%2347040)/bio_rxiv__2024__08__11__607514-317-4-26
    Average 92 stars, based on 1 article reviews
    gfp single band exciters et filter set - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier
    tempest liquid handler  (Formulatrix)
    94
    Formulatrix tempest liquid handler
    Axonal Rtn-1 KD increases outgrowth by promoting Spastin’s microtubule severing. A. Representative fluorescent STED images of distal axons from microfluidic chambers containing control cortical axons or forty-four hours post-axotomy, which were stained for Rtn-1C (green), Spastin (red), and F-actin (phalloidin, blue). Insets show colocalization of Rtn-1C and Spastin. Right: Line scan analysis of Rtn-1C and Spastin highlighted in the white rectangle and their distribution along the axon. Bar graphs show the quantification of colocalization in control and axotomy conditions. Scale bar= 5 µm. Data are displayed as mean ± standard error of 6-7 axons. Unpaired t test; ∗∗p < 0.01 B. Representative images of axonal fields from microfluidic chambers 48 hours post-axotomy under different treatments: control sequence (Scrambled, Scr), Rtn-1 knockdown (Rtn-1 siRNA), and Spastin pharmacological inhibition (SPZT), and labeled with β3-tubulin (β3-tub). Scale bar represents 200 µm. C. Quantification of axon outgrowth under the treatments shown in A. The Area under the curve (AUC) was measured as the sum of the relative number of intersections at different distance ranges from the groove in the microfluidic chambers (0-500 µm; 500-1000 µm and 1000-1500 µm). Scale bar represents 10 µm. Data are displayed as mean ± standard error of 22-24 axonal fields for condition from N=3 biological replicates. One-way ANOVA followed by Tukey’s posthoc test; ∗p < 0.05; ∗∗p < 0.01. D. Fluorescence intensity profiles of β3-tubulin, Rtn-1C, and Spastin in axons and quantifications of intensity changes of indicated proteins as the fluorescence AUC fold change of the last 50 µm compared to Scr. Data are displayed as mean ± standard error of 24-40 axons for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗∗∗p < 0.001 E. Axonal kymographs showing dynamic microtubule behavior in neurons with indicated treatments after axotomy, dashes represent the traces <t>of</t> <t>EB3-GFP</t> (end-binding protein 3). Scale bars represent 10 µm and 30 seconds, respectively. F. Analysis of microtubule dynamics parameters in non-injured and injured axons with different treatments: growth rate, track length, and lifetime of microtubule plus-end tracks. Data are displayed as mean ± standard error of 146-377 comets for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗∗p < 0.001.
    Tempest Liquid Handler, supplied by Formulatrix, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tv3/TEMPEST/pm36706756-823-58-61
    Average 94 stars, based on 1 article reviews
    tempest liquid handler - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    tempest liquid dispenser  (Formulatrix)
    94
    Formulatrix tempest liquid dispenser
    Axonal Rtn-1 KD increases outgrowth by promoting Spastin’s microtubule severing. A. Representative fluorescent STED images of distal axons from microfluidic chambers containing control cortical axons or forty-four hours post-axotomy, which were stained for Rtn-1C (green), Spastin (red), and F-actin (phalloidin, blue). Insets show colocalization of Rtn-1C and Spastin. Right: Line scan analysis of Rtn-1C and Spastin highlighted in the white rectangle and their distribution along the axon. Bar graphs show the quantification of colocalization in control and axotomy conditions. Scale bar= 5 µm. Data are displayed as mean ± standard error of 6-7 axons. Unpaired t test; ∗∗p < 0.01 B. Representative images of axonal fields from microfluidic chambers 48 hours post-axotomy under different treatments: control sequence (Scrambled, Scr), Rtn-1 knockdown (Rtn-1 siRNA), and Spastin pharmacological inhibition (SPZT), and labeled with β3-tubulin (β3-tub). Scale bar represents 200 µm. C. Quantification of axon outgrowth under the treatments shown in A. The Area under the curve (AUC) was measured as the sum of the relative number of intersections at different distance ranges from the groove in the microfluidic chambers (0-500 µm; 500-1000 µm and 1000-1500 µm). Scale bar represents 10 µm. Data are displayed as mean ± standard error of 22-24 axonal fields for condition from N=3 biological replicates. One-way ANOVA followed by Tukey’s posthoc test; ∗p < 0.05; ∗∗p < 0.01. D. Fluorescence intensity profiles of β3-tubulin, Rtn-1C, and Spastin in axons and quantifications of intensity changes of indicated proteins as the fluorescence AUC fold change of the last 50 µm compared to Scr. Data are displayed as mean ± standard error of 24-40 axons for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗∗∗p < 0.001 E. Axonal kymographs showing dynamic microtubule behavior in neurons with indicated treatments after axotomy, dashes represent the traces <t>of</t> <t>EB3-GFP</t> (end-binding protein 3). Scale bars represent 10 µm and 30 seconds, respectively. F. Analysis of microtubule dynamics parameters in non-injured and injured axons with different treatments: growth rate, track length, and lifetime of microtubule plus-end tracks. Data are displayed as mean ± standard error of 146-377 comets for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗∗p < 0.001.
    Tempest Liquid Dispenser, supplied by Formulatrix, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tv3/bio_rxiv__2023__09__15__557919-84-1-4
    Average 94 stars, based on 1 article reviews
    tempest liquid dispenser - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    Axonal Rtn-1 KD increases outgrowth by promoting Spastin’s microtubule severing. A. Representative fluorescent STED images of distal axons from microfluidic chambers containing control cortical axons or forty-four hours post-axotomy, which were stained for Rtn-1C (green), Spastin (red), and F-actin (phalloidin, blue). Insets show colocalization of Rtn-1C and Spastin. Right: Line scan analysis of Rtn-1C and Spastin highlighted in the white rectangle and their distribution along the axon. Bar graphs show the quantification of colocalization in control and axotomy conditions. Scale bar= 5 µm. Data are displayed as mean ± standard error of 6-7 axons. Unpaired t test; ∗∗p < 0.01 B. Representative images of axonal fields from microfluidic chambers 48 hours post-axotomy under different treatments: control sequence (Scrambled, Scr), Rtn-1 knockdown (Rtn-1 siRNA), and Spastin pharmacological inhibition (SPZT), and labeled with β3-tubulin (β3-tub). Scale bar represents 200 µm. C. Quantification of axon outgrowth under the treatments shown in A. The Area under the curve (AUC) was measured as the sum of the relative number of intersections at different distance ranges from the groove in the microfluidic chambers (0-500 µm; 500-1000 µm and 1000-1500 µm). Scale bar represents 10 µm. Data are displayed as mean ± standard error of 22-24 axonal fields for condition from N=3 biological replicates. One-way ANOVA followed by Tukey’s posthoc test; ∗p < 0.05; ∗∗p < 0.01. D. Fluorescence intensity profiles of β3-tubulin, Rtn-1C, and Spastin in axons and quantifications of intensity changes of indicated proteins as the fluorescence AUC fold change of the last 50 µm compared to Scr. Data are displayed as mean ± standard error of 24-40 axons for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗∗∗p < 0.001 E. Axonal kymographs showing dynamic microtubule behavior in neurons with indicated treatments after axotomy, dashes represent the traces of EB3-GFP (end-binding protein 3). Scale bars represent 10 µm and 30 seconds, respectively. F. Analysis of microtubule dynamics parameters in non-injured and injured axons with different treatments: growth rate, track length, and lifetime of microtubule plus-end tracks. Data are displayed as mean ± standard error of 146-377 comets for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗∗p < 0.001.

    Journal: bioRxiv

    Article Title: Local Synthesis of Reticulon-1C Lessens the Outgrowth of Injured Axons by Controlling Spastin Activity

    doi: 10.1101/2024.08.11.607514

    Figure Lengend Snippet: Axonal Rtn-1 KD increases outgrowth by promoting Spastin’s microtubule severing. A. Representative fluorescent STED images of distal axons from microfluidic chambers containing control cortical axons or forty-four hours post-axotomy, which were stained for Rtn-1C (green), Spastin (red), and F-actin (phalloidin, blue). Insets show colocalization of Rtn-1C and Spastin. Right: Line scan analysis of Rtn-1C and Spastin highlighted in the white rectangle and their distribution along the axon. Bar graphs show the quantification of colocalization in control and axotomy conditions. Scale bar= 5 µm. Data are displayed as mean ± standard error of 6-7 axons. Unpaired t test; ∗∗p < 0.01 B. Representative images of axonal fields from microfluidic chambers 48 hours post-axotomy under different treatments: control sequence (Scrambled, Scr), Rtn-1 knockdown (Rtn-1 siRNA), and Spastin pharmacological inhibition (SPZT), and labeled with β3-tubulin (β3-tub). Scale bar represents 200 µm. C. Quantification of axon outgrowth under the treatments shown in A. The Area under the curve (AUC) was measured as the sum of the relative number of intersections at different distance ranges from the groove in the microfluidic chambers (0-500 µm; 500-1000 µm and 1000-1500 µm). Scale bar represents 10 µm. Data are displayed as mean ± standard error of 22-24 axonal fields for condition from N=3 biological replicates. One-way ANOVA followed by Tukey’s posthoc test; ∗p < 0.05; ∗∗p < 0.01. D. Fluorescence intensity profiles of β3-tubulin, Rtn-1C, and Spastin in axons and quantifications of intensity changes of indicated proteins as the fluorescence AUC fold change of the last 50 µm compared to Scr. Data are displayed as mean ± standard error of 24-40 axons for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗∗∗p < 0.001 E. Axonal kymographs showing dynamic microtubule behavior in neurons with indicated treatments after axotomy, dashes represent the traces of EB3-GFP (end-binding protein 3). Scale bars represent 10 µm and 30 seconds, respectively. F. Analysis of microtubule dynamics parameters in non-injured and injured axons with different treatments: growth rate, track length, and lifetime of microtubule plus-end tracks. Data are displayed as mean ± standard error of 146-377 comets for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗∗p < 0.001.

    Article Snippet: A 63x objective and GFP single band exciters ET filter set (excitation 470/40, emission 59022m, dichroic 59022BS) were used. mEmerald-EB3-C-20 was a gift from Michael Davidson (Addgene plasmid # 54076; http://n2t.net/addgene:54076 ; RRID:Addgene_54076)

    Techniques: Control, Staining, Sequencing, Knockdown, Inhibition, Labeling, Fluorescence, Binding Assay