Review



tempest liquid handler  (Formulatrix)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Formulatrix tempest liquid handler
    Tempest Liquid Handler, supplied by Formulatrix, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tv3/TEMPEST/pm36706756-823-58-61
    Average 94 stars, based on 1 article reviews
    tempest liquid handler - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Concentration Assay:

    Article Title: A Degron Blocking Strategy Towards Improved CRL4 CRBN Recruiting PROTAC Selectivity.
    Article Snippet: An Echo E5XX (Beckman Coulter, USA) acoustic liquid dispenser was used to create final concentration ranges of compound from 300 μM to 0.9375 nM, with a final DMSO concentration of 3%. .. WT full length CRBN/DDB1 complex was added with a Tempest liquid handler (Formulatrix, USA) to all wells to a final concentration of 80 nM, except for low controls where WT CRBN was substituted with mutant Y384A W386 A CRBN (mutant unable to bind the probe). ..

    Mutagenesis:

    Article Title: A Degron Blocking Strategy Towards Improved CRL4 CRBN Recruiting PROTAC Selectivity.
    Article Snippet: An Echo E5XX (Beckman Coulter, USA) acoustic liquid dispenser was used to create final concentration ranges of compound from 300 μM to 0.9375 nM, with a final DMSO concentration of 3%. .. WT full length CRBN/DDB1 complex was added with a Tempest liquid handler (Formulatrix, USA) to all wells to a final concentration of 80 nM, except for low controls where WT CRBN was substituted with mutant Y384A W386 A CRBN (mutant unable to bind the probe). ..

    other:

    Article Title: iTAG an optimized IMiD-induced degron for targeted protein degradation in human and murine cells.
    Article Snippet: WT full length CRBN/ DDB1 complex was added with a Tempest liquid handler (Formulatrix, USA) to all wells to a final concentration of 80 nM, except for low controls whereWT CRBNwas substituted withmutant Y384A-W386A CRBN (mutant unable to bind the probe).

    Article Title: Lessons from assembling a microbial natural product and pre-fractionated extract library in an academic laboratory.
    Article Snippet: Next, 89 μL of concenrated E. coli OP50 (equivalent to OD600 4.5) in S-basal and 1 μL of FL/NPL extract/fraction or DMSO were added using automated iquid handlers (Formulatrix Tempest and SPT LabTech Mosquito, espectively) for a total well volume of 150 μL.

    Recombinant:

    Article Title: Protomer selectivity of type II RAF inhibitors within the RAS/RAF complex.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BRAF Millipore CAT# 14-530 .. MEK1 Millipore CAT# 14-420 ERK2 ThermoFisher CAT# PV3314 ATP Sigma CAT# A7699 Bovine Serum Albumin Sigma Aldrich CAT# A3059 Critical commercial assays Lumit p-ERK Immunoassay kit Promega CAT# CS3397A03 Advanced Phospho-ERK1/2 (Thr202/Tyr204) CisBio CAT# 64AERPET Experimental models: Cell lines HEK-293 Cells ATCC CAT# CRL-1573 MIA PaCa-2 Cells ATCC CAT# CRL-1420 DLD1 Cells ATCC CAT# CCL-221 Recombinant DNA Transfection Carrier DNA Promega CAT# E488A pFN31K Promega CAT# N131A pFC32K Promega CAT# N134A BRAF-SmBiT Fusion Vector Promega CAT# CS321827 BRAF(R509H)-SmBiT Fusion Vector This paper N/A BRAF(S729A)-SmBiT Fusion Vector This paper N/A BRAF(A481F)-SmBiT Fusion Vector Promega CAT# CS321831 BRAF(A481F)-LgBiT Fusion Vector Promega CAT# CS321833 CRAF-LgBiT Fusion Vector Promega CAT# CS321828 CRAF(A373F)-LgBiT Fusion Vector Promega CAT# CS321830 SmBiT-ARAF Fusion Vector Promega CAT# CS321832 KRAS(G12C) Expression Vector Promega CAT# CS321834 14-3-3 Expression Vector This paper N/A MAPK14-NanoLuc Fusion Vector Promega CAT# NV1661 DDR1-NanoLuc Fusion Vector Promega CAT# N2451 pF5K Promega CAT# C9411 Software and algorithms Graphpad Prism 9.1.0 Graphpad https://www.graphpad.com/ Other GloMax Discover Luminometer Promega CAT# GM3000 LV200 Bioluminescence Imaging System Olympus https://www.olympus-lifescience.com/en/microscopes/inverted/ lv200/?apd=1&adid=lv200&acid=enbgle&gclid=EAIaIQobChMIwv H2luL61gIVBqlpCh0VrgiiEAAYASAAEgJGrvD_BwE#!cms[tab]= %2Fmicroscopes%2Finverted%2Flv200%2Ffeatures ImagEM X2 EM-CCD camera Hamamatsu https://www.hamamatsu.com/us/en/C9100-23B.html Nunc Lab-Tek II 8-well chambered coverslips Thermo Fisher CAT# 155409 Nikon AX/AX R Confocal Microscope Nikon https://www.microscope.healthcare.nikon.com/products/ confocal-microscopes/ax White Tissue Culture-Treated, 96-well Plates Corning CAT# 3917 White-bottom 384-well assay plates Corning CAT# 784080 TEMPEST Liquid Handler Formulatrix https://formulatrix.com/liquid-handling-systems/tempestliquid-handler/ Echo 650 acoustic liquid handler Beckman https://www.beckman.com/liquid-handlers/echo-650-series EnVision Plate Reader PerkinElmer https://www.perkinelmer.com/Product/envision-nexus2-detector-hh36000002 LabChip 3000 Drug Discovery System Caliper Life Sciences http://www.caliperls.com/assets/008/5842.pdf Cell Chemical Biology 30, 1354–1365.e1–e6, November 16, 2023 e2 .. Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact Matthew B. Robers. matt.robers@promega.com.

    Article Title: An ependymal cell census identifies heterogeneous and ongoing cell maturation in the adult mouse spinal cord that changes dynamically on injury.
    Article Snippet: .. Lysis plates were created by dispensing 0.4 ml lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton X-100 (Sigma, 93443-100ML), 3.125 mM dNTP mix (Thermo Fisher Scientific, R0193), 3.125 mMOligo-dT 30 VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher Scientific, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901) using a Tempest liquid handler (Formulatrix). ..

    Transfection:

    Article Title: Protomer selectivity of type II RAF inhibitors within the RAS/RAF complex.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BRAF Millipore CAT# 14-530 .. MEK1 Millipore CAT# 14-420 ERK2 ThermoFisher CAT# PV3314 ATP Sigma CAT# A7699 Bovine Serum Albumin Sigma Aldrich CAT# A3059 Critical commercial assays Lumit p-ERK Immunoassay kit Promega CAT# CS3397A03 Advanced Phospho-ERK1/2 (Thr202/Tyr204) CisBio CAT# 64AERPET Experimental models: Cell lines HEK-293 Cells ATCC CAT# CRL-1573 MIA PaCa-2 Cells ATCC CAT# CRL-1420 DLD1 Cells ATCC CAT# CCL-221 Recombinant DNA Transfection Carrier DNA Promega CAT# E488A pFN31K Promega CAT# N131A pFC32K Promega CAT# N134A BRAF-SmBiT Fusion Vector Promega CAT# CS321827 BRAF(R509H)-SmBiT Fusion Vector This paper N/A BRAF(S729A)-SmBiT Fusion Vector This paper N/A BRAF(A481F)-SmBiT Fusion Vector Promega CAT# CS321831 BRAF(A481F)-LgBiT Fusion Vector Promega CAT# CS321833 CRAF-LgBiT Fusion Vector Promega CAT# CS321828 CRAF(A373F)-LgBiT Fusion Vector Promega CAT# CS321830 SmBiT-ARAF Fusion Vector Promega CAT# CS321832 KRAS(G12C) Expression Vector Promega CAT# CS321834 14-3-3 Expression Vector This paper N/A MAPK14-NanoLuc Fusion Vector Promega CAT# NV1661 DDR1-NanoLuc Fusion Vector Promega CAT# N2451 pF5K Promega CAT# C9411 Software and algorithms Graphpad Prism 9.1.0 Graphpad https://www.graphpad.com/ Other GloMax Discover Luminometer Promega CAT# GM3000 LV200 Bioluminescence Imaging System Olympus https://www.olympus-lifescience.com/en/microscopes/inverted/ lv200/?apd=1&adid=lv200&acid=enbgle&gclid=EAIaIQobChMIwv H2luL61gIVBqlpCh0VrgiiEAAYASAAEgJGrvD_BwE#!cms[tab]= %2Fmicroscopes%2Finverted%2Flv200%2Ffeatures ImagEM X2 EM-CCD camera Hamamatsu https://www.hamamatsu.com/us/en/C9100-23B.html Nunc Lab-Tek II 8-well chambered coverslips Thermo Fisher CAT# 155409 Nikon AX/AX R Confocal Microscope Nikon https://www.microscope.healthcare.nikon.com/products/ confocal-microscopes/ax White Tissue Culture-Treated, 96-well Plates Corning CAT# 3917 White-bottom 384-well assay plates Corning CAT# 784080 TEMPEST Liquid Handler Formulatrix https://formulatrix.com/liquid-handling-systems/tempestliquid-handler/ Echo 650 acoustic liquid handler Beckman https://www.beckman.com/liquid-handlers/echo-650-series EnVision Plate Reader PerkinElmer https://www.perkinelmer.com/Product/envision-nexus2-detector-hh36000002 LabChip 3000 Drug Discovery System Caliper Life Sciences http://www.caliperls.com/assets/008/5842.pdf Cell Chemical Biology 30, 1354–1365.e1–e6, November 16, 2023 e2 .. Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact Matthew B. Robers. matt.robers@promega.com.

    Expressing:

    Article Title: Protomer selectivity of type II RAF inhibitors within the RAS/RAF complex.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BRAF Millipore CAT# 14-530 .. MEK1 Millipore CAT# 14-420 ERK2 ThermoFisher CAT# PV3314 ATP Sigma CAT# A7699 Bovine Serum Albumin Sigma Aldrich CAT# A3059 Critical commercial assays Lumit p-ERK Immunoassay kit Promega CAT# CS3397A03 Advanced Phospho-ERK1/2 (Thr202/Tyr204) CisBio CAT# 64AERPET Experimental models: Cell lines HEK-293 Cells ATCC CAT# CRL-1573 MIA PaCa-2 Cells ATCC CAT# CRL-1420 DLD1 Cells ATCC CAT# CCL-221 Recombinant DNA Transfection Carrier DNA Promega CAT# E488A pFN31K Promega CAT# N131A pFC32K Promega CAT# N134A BRAF-SmBiT Fusion Vector Promega CAT# CS321827 BRAF(R509H)-SmBiT Fusion Vector This paper N/A BRAF(S729A)-SmBiT Fusion Vector This paper N/A BRAF(A481F)-SmBiT Fusion Vector Promega CAT# CS321831 BRAF(A481F)-LgBiT Fusion Vector Promega CAT# CS321833 CRAF-LgBiT Fusion Vector Promega CAT# CS321828 CRAF(A373F)-LgBiT Fusion Vector Promega CAT# CS321830 SmBiT-ARAF Fusion Vector Promega CAT# CS321832 KRAS(G12C) Expression Vector Promega CAT# CS321834 14-3-3 Expression Vector This paper N/A MAPK14-NanoLuc Fusion Vector Promega CAT# NV1661 DDR1-NanoLuc Fusion Vector Promega CAT# N2451 pF5K Promega CAT# C9411 Software and algorithms Graphpad Prism 9.1.0 Graphpad https://www.graphpad.com/ Other GloMax Discover Luminometer Promega CAT# GM3000 LV200 Bioluminescence Imaging System Olympus https://www.olympus-lifescience.com/en/microscopes/inverted/ lv200/?apd=1&adid=lv200&acid=enbgle&gclid=EAIaIQobChMIwv H2luL61gIVBqlpCh0VrgiiEAAYASAAEgJGrvD_BwE#!cms[tab]= %2Fmicroscopes%2Finverted%2Flv200%2Ffeatures ImagEM X2 EM-CCD camera Hamamatsu https://www.hamamatsu.com/us/en/C9100-23B.html Nunc Lab-Tek II 8-well chambered coverslips Thermo Fisher CAT# 155409 Nikon AX/AX R Confocal Microscope Nikon https://www.microscope.healthcare.nikon.com/products/ confocal-microscopes/ax White Tissue Culture-Treated, 96-well Plates Corning CAT# 3917 White-bottom 384-well assay plates Corning CAT# 784080 TEMPEST Liquid Handler Formulatrix https://formulatrix.com/liquid-handling-systems/tempestliquid-handler/ Echo 650 acoustic liquid handler Beckman https://www.beckman.com/liquid-handlers/echo-650-series EnVision Plate Reader PerkinElmer https://www.perkinelmer.com/Product/envision-nexus2-detector-hh36000002 LabChip 3000 Drug Discovery System Caliper Life Sciences http://www.caliperls.com/assets/008/5842.pdf Cell Chemical Biology 30, 1354–1365.e1–e6, November 16, 2023 e2 .. Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact Matthew B. Robers. matt.robers@promega.com.

    Software:

    Article Title: Protomer selectivity of type II RAF inhibitors within the RAS/RAF complex.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BRAF Millipore CAT# 14-530 .. MEK1 Millipore CAT# 14-420 ERK2 ThermoFisher CAT# PV3314 ATP Sigma CAT# A7699 Bovine Serum Albumin Sigma Aldrich CAT# A3059 Critical commercial assays Lumit p-ERK Immunoassay kit Promega CAT# CS3397A03 Advanced Phospho-ERK1/2 (Thr202/Tyr204) CisBio CAT# 64AERPET Experimental models: Cell lines HEK-293 Cells ATCC CAT# CRL-1573 MIA PaCa-2 Cells ATCC CAT# CRL-1420 DLD1 Cells ATCC CAT# CCL-221 Recombinant DNA Transfection Carrier DNA Promega CAT# E488A pFN31K Promega CAT# N131A pFC32K Promega CAT# N134A BRAF-SmBiT Fusion Vector Promega CAT# CS321827 BRAF(R509H)-SmBiT Fusion Vector This paper N/A BRAF(S729A)-SmBiT Fusion Vector This paper N/A BRAF(A481F)-SmBiT Fusion Vector Promega CAT# CS321831 BRAF(A481F)-LgBiT Fusion Vector Promega CAT# CS321833 CRAF-LgBiT Fusion Vector Promega CAT# CS321828 CRAF(A373F)-LgBiT Fusion Vector Promega CAT# CS321830 SmBiT-ARAF Fusion Vector Promega CAT# CS321832 KRAS(G12C) Expression Vector Promega CAT# CS321834 14-3-3 Expression Vector This paper N/A MAPK14-NanoLuc Fusion Vector Promega CAT# NV1661 DDR1-NanoLuc Fusion Vector Promega CAT# N2451 pF5K Promega CAT# C9411 Software and algorithms Graphpad Prism 9.1.0 Graphpad https://www.graphpad.com/ Other GloMax Discover Luminometer Promega CAT# GM3000 LV200 Bioluminescence Imaging System Olympus https://www.olympus-lifescience.com/en/microscopes/inverted/ lv200/?apd=1&adid=lv200&acid=enbgle&gclid=EAIaIQobChMIwv H2luL61gIVBqlpCh0VrgiiEAAYASAAEgJGrvD_BwE#!cms[tab]= %2Fmicroscopes%2Finverted%2Flv200%2Ffeatures ImagEM X2 EM-CCD camera Hamamatsu https://www.hamamatsu.com/us/en/C9100-23B.html Nunc Lab-Tek II 8-well chambered coverslips Thermo Fisher CAT# 155409 Nikon AX/AX R Confocal Microscope Nikon https://www.microscope.healthcare.nikon.com/products/ confocal-microscopes/ax White Tissue Culture-Treated, 96-well Plates Corning CAT# 3917 White-bottom 384-well assay plates Corning CAT# 784080 TEMPEST Liquid Handler Formulatrix https://formulatrix.com/liquid-handling-systems/tempestliquid-handler/ Echo 650 acoustic liquid handler Beckman https://www.beckman.com/liquid-handlers/echo-650-series EnVision Plate Reader PerkinElmer https://www.perkinelmer.com/Product/envision-nexus2-detector-hh36000002 LabChip 3000 Drug Discovery System Caliper Life Sciences http://www.caliperls.com/assets/008/5842.pdf Cell Chemical Biology 30, 1354–1365.e1–e6, November 16, 2023 e2 .. Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact Matthew B. Robers. matt.robers@promega.com.

    Imaging:

    Article Title: Protomer selectivity of type II RAF inhibitors within the RAS/RAF complex.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BRAF Millipore CAT# 14-530 .. MEK1 Millipore CAT# 14-420 ERK2 ThermoFisher CAT# PV3314 ATP Sigma CAT# A7699 Bovine Serum Albumin Sigma Aldrich CAT# A3059 Critical commercial assays Lumit p-ERK Immunoassay kit Promega CAT# CS3397A03 Advanced Phospho-ERK1/2 (Thr202/Tyr204) CisBio CAT# 64AERPET Experimental models: Cell lines HEK-293 Cells ATCC CAT# CRL-1573 MIA PaCa-2 Cells ATCC CAT# CRL-1420 DLD1 Cells ATCC CAT# CCL-221 Recombinant DNA Transfection Carrier DNA Promega CAT# E488A pFN31K Promega CAT# N131A pFC32K Promega CAT# N134A BRAF-SmBiT Fusion Vector Promega CAT# CS321827 BRAF(R509H)-SmBiT Fusion Vector This paper N/A BRAF(S729A)-SmBiT Fusion Vector This paper N/A BRAF(A481F)-SmBiT Fusion Vector Promega CAT# CS321831 BRAF(A481F)-LgBiT Fusion Vector Promega CAT# CS321833 CRAF-LgBiT Fusion Vector Promega CAT# CS321828 CRAF(A373F)-LgBiT Fusion Vector Promega CAT# CS321830 SmBiT-ARAF Fusion Vector Promega CAT# CS321832 KRAS(G12C) Expression Vector Promega CAT# CS321834 14-3-3 Expression Vector This paper N/A MAPK14-NanoLuc Fusion Vector Promega CAT# NV1661 DDR1-NanoLuc Fusion Vector Promega CAT# N2451 pF5K Promega CAT# C9411 Software and algorithms Graphpad Prism 9.1.0 Graphpad https://www.graphpad.com/ Other GloMax Discover Luminometer Promega CAT# GM3000 LV200 Bioluminescence Imaging System Olympus https://www.olympus-lifescience.com/en/microscopes/inverted/ lv200/?apd=1&adid=lv200&acid=enbgle&gclid=EAIaIQobChMIwv H2luL61gIVBqlpCh0VrgiiEAAYASAAEgJGrvD_BwE#!cms[tab]= %2Fmicroscopes%2Finverted%2Flv200%2Ffeatures ImagEM X2 EM-CCD camera Hamamatsu https://www.hamamatsu.com/us/en/C9100-23B.html Nunc Lab-Tek II 8-well chambered coverslips Thermo Fisher CAT# 155409 Nikon AX/AX R Confocal Microscope Nikon https://www.microscope.healthcare.nikon.com/products/ confocal-microscopes/ax White Tissue Culture-Treated, 96-well Plates Corning CAT# 3917 White-bottom 384-well assay plates Corning CAT# 784080 TEMPEST Liquid Handler Formulatrix https://formulatrix.com/liquid-handling-systems/tempestliquid-handler/ Echo 650 acoustic liquid handler Beckman https://www.beckman.com/liquid-handlers/echo-650-series EnVision Plate Reader PerkinElmer https://www.perkinelmer.com/Product/envision-nexus2-detector-hh36000002 LabChip 3000 Drug Discovery System Caliper Life Sciences http://www.caliperls.com/assets/008/5842.pdf Cell Chemical Biology 30, 1354–1365.e1–e6, November 16, 2023 e2 .. Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact Matthew B. Robers. matt.robers@promega.com.

    Microscopy:

    Article Title: Protomer selectivity of type II RAF inhibitors within the RAS/RAF complex.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BRAF Millipore CAT# 14-530 .. MEK1 Millipore CAT# 14-420 ERK2 ThermoFisher CAT# PV3314 ATP Sigma CAT# A7699 Bovine Serum Albumin Sigma Aldrich CAT# A3059 Critical commercial assays Lumit p-ERK Immunoassay kit Promega CAT# CS3397A03 Advanced Phospho-ERK1/2 (Thr202/Tyr204) CisBio CAT# 64AERPET Experimental models: Cell lines HEK-293 Cells ATCC CAT# CRL-1573 MIA PaCa-2 Cells ATCC CAT# CRL-1420 DLD1 Cells ATCC CAT# CCL-221 Recombinant DNA Transfection Carrier DNA Promega CAT# E488A pFN31K Promega CAT# N131A pFC32K Promega CAT# N134A BRAF-SmBiT Fusion Vector Promega CAT# CS321827 BRAF(R509H)-SmBiT Fusion Vector This paper N/A BRAF(S729A)-SmBiT Fusion Vector This paper N/A BRAF(A481F)-SmBiT Fusion Vector Promega CAT# CS321831 BRAF(A481F)-LgBiT Fusion Vector Promega CAT# CS321833 CRAF-LgBiT Fusion Vector Promega CAT# CS321828 CRAF(A373F)-LgBiT Fusion Vector Promega CAT# CS321830 SmBiT-ARAF Fusion Vector Promega CAT# CS321832 KRAS(G12C) Expression Vector Promega CAT# CS321834 14-3-3 Expression Vector This paper N/A MAPK14-NanoLuc Fusion Vector Promega CAT# NV1661 DDR1-NanoLuc Fusion Vector Promega CAT# N2451 pF5K Promega CAT# C9411 Software and algorithms Graphpad Prism 9.1.0 Graphpad https://www.graphpad.com/ Other GloMax Discover Luminometer Promega CAT# GM3000 LV200 Bioluminescence Imaging System Olympus https://www.olympus-lifescience.com/en/microscopes/inverted/ lv200/?apd=1&adid=lv200&acid=enbgle&gclid=EAIaIQobChMIwv H2luL61gIVBqlpCh0VrgiiEAAYASAAEgJGrvD_BwE#!cms[tab]= %2Fmicroscopes%2Finverted%2Flv200%2Ffeatures ImagEM X2 EM-CCD camera Hamamatsu https://www.hamamatsu.com/us/en/C9100-23B.html Nunc Lab-Tek II 8-well chambered coverslips Thermo Fisher CAT# 155409 Nikon AX/AX R Confocal Microscope Nikon https://www.microscope.healthcare.nikon.com/products/ confocal-microscopes/ax White Tissue Culture-Treated, 96-well Plates Corning CAT# 3917 White-bottom 384-well assay plates Corning CAT# 784080 TEMPEST Liquid Handler Formulatrix https://formulatrix.com/liquid-handling-systems/tempestliquid-handler/ Echo 650 acoustic liquid handler Beckman https://www.beckman.com/liquid-handlers/echo-650-series EnVision Plate Reader PerkinElmer https://www.perkinelmer.com/Product/envision-nexus2-detector-hh36000002 LabChip 3000 Drug Discovery System Caliper Life Sciences http://www.caliperls.com/assets/008/5842.pdf Cell Chemical Biology 30, 1354–1365.e1–e6, November 16, 2023 e2 .. Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact Matthew B. Robers. matt.robers@promega.com.

    Drug discovery:

    Article Title: Protomer selectivity of type II RAF inhibitors within the RAS/RAF complex.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BRAF Millipore CAT# 14-530 .. MEK1 Millipore CAT# 14-420 ERK2 ThermoFisher CAT# PV3314 ATP Sigma CAT# A7699 Bovine Serum Albumin Sigma Aldrich CAT# A3059 Critical commercial assays Lumit p-ERK Immunoassay kit Promega CAT# CS3397A03 Advanced Phospho-ERK1/2 (Thr202/Tyr204) CisBio CAT# 64AERPET Experimental models: Cell lines HEK-293 Cells ATCC CAT# CRL-1573 MIA PaCa-2 Cells ATCC CAT# CRL-1420 DLD1 Cells ATCC CAT# CCL-221 Recombinant DNA Transfection Carrier DNA Promega CAT# E488A pFN31K Promega CAT# N131A pFC32K Promega CAT# N134A BRAF-SmBiT Fusion Vector Promega CAT# CS321827 BRAF(R509H)-SmBiT Fusion Vector This paper N/A BRAF(S729A)-SmBiT Fusion Vector This paper N/A BRAF(A481F)-SmBiT Fusion Vector Promega CAT# CS321831 BRAF(A481F)-LgBiT Fusion Vector Promega CAT# CS321833 CRAF-LgBiT Fusion Vector Promega CAT# CS321828 CRAF(A373F)-LgBiT Fusion Vector Promega CAT# CS321830 SmBiT-ARAF Fusion Vector Promega CAT# CS321832 KRAS(G12C) Expression Vector Promega CAT# CS321834 14-3-3 Expression Vector This paper N/A MAPK14-NanoLuc Fusion Vector Promega CAT# NV1661 DDR1-NanoLuc Fusion Vector Promega CAT# N2451 pF5K Promega CAT# C9411 Software and algorithms Graphpad Prism 9.1.0 Graphpad https://www.graphpad.com/ Other GloMax Discover Luminometer Promega CAT# GM3000 LV200 Bioluminescence Imaging System Olympus https://www.olympus-lifescience.com/en/microscopes/inverted/ lv200/?apd=1&adid=lv200&acid=enbgle&gclid=EAIaIQobChMIwv H2luL61gIVBqlpCh0VrgiiEAAYASAAEgJGrvD_BwE#!cms[tab]= %2Fmicroscopes%2Finverted%2Flv200%2Ffeatures ImagEM X2 EM-CCD camera Hamamatsu https://www.hamamatsu.com/us/en/C9100-23B.html Nunc Lab-Tek II 8-well chambered coverslips Thermo Fisher CAT# 155409 Nikon AX/AX R Confocal Microscope Nikon https://www.microscope.healthcare.nikon.com/products/ confocal-microscopes/ax White Tissue Culture-Treated, 96-well Plates Corning CAT# 3917 White-bottom 384-well assay plates Corning CAT# 784080 TEMPEST Liquid Handler Formulatrix https://formulatrix.com/liquid-handling-systems/tempestliquid-handler/ Echo 650 acoustic liquid handler Beckman https://www.beckman.com/liquid-handlers/echo-650-series EnVision Plate Reader PerkinElmer https://www.perkinelmer.com/Product/envision-nexus2-detector-hh36000002 LabChip 3000 Drug Discovery System Caliper Life Sciences http://www.caliperls.com/assets/008/5842.pdf Cell Chemical Biology 30, 1354–1365.e1–e6, November 16, 2023 e2 .. Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact Matthew B. Robers. matt.robers@promega.com.

    Lysis:

    Article Title: An ependymal cell census identifies heterogeneous and ongoing cell maturation in the adult mouse spinal cord that changes dynamically on injury.
    Article Snippet: .. Lysis plates were created by dispensing 0.4 ml lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton X-100 (Sigma, 93443-100ML), 3.125 mM dNTP mix (Thermo Fisher Scientific, R0193), 3.125 mMOligo-dT 30 VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher Scientific, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901) using a Tempest liquid handler (Formulatrix). ..

    Polymerase Chain Reaction:

    Article Title: An ependymal cell census identifies heterogeneous and ongoing cell maturation in the adult mouse spinal cord that changes dynamically on injury.
    Article Snippet: .. Lysis plates were created by dispensing 0.4 ml lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton X-100 (Sigma, 93443-100ML), 3.125 mM dNTP mix (Thermo Fisher Scientific, R0193), 3.125 mMOligo-dT 30 VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher Scientific, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901) using a Tempest liquid handler (Formulatrix). ..

    Article Title: An ependymal cell census identifies heterogeneous and ongoing cell maturation in the adult mouse spinal cord that changes dynamically on injury.
    Article Snippet: Reverse transcription was carried out by incubating wells on a ProFlex 2x384 thermal-cycler (Thermo Fisher Scientific) at 42 C for 90 min and stopped by heating at 70 C for 5 min. .. Subsequently, 1.6 ml of PCR mix (1.67X KAPA HiFi HotStart ReadyMix (Kapa Biosystems, KK2602), 0.17 mM IS PCR primer (IDT, 5’-AAGCAGTGGTATCAACGCAGAGT-3’), and 0.038U/ml Lambda Exonuclease (NEB, M0262L)) was added to each well with a Tempest liquid handler (Formulatrix). .. The amplified product was diluted with a ratio of 1 part cDNA to 10 parts 10mM Tris-HCl (Thermo Fisher Scientific, 15568025), and concentrations were measured with dye-fluorescence assay (Quant-iT dsDNA High Sensitivity kit; Thermo Fisher Scientific, Q33120) on a SpectraMax i3x microplate reader (Molecular Devices).



    Similar Products

    formulatrix tempest  (Formulatrix)
    94
    Formulatrix formulatrix tempest
    Formulatrix Tempest, supplied by Formulatrix, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tv3/us12172975-276-1-1
    Average 94 stars, based on 1 article reviews
    formulatrix tempest - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    tempest dispenser  (Formulatrix)
    94
    Formulatrix tempest dispenser
    Tempest Dispenser, supplied by Formulatrix, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tv3/pmc11566907-141-60-62
    Average 94 stars, based on 1 article reviews
    tempest dispenser - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    tempest liquid dispenser system  (Formulatrix)
    94
    Formulatrix tempest liquid dispenser system
    Tempest Liquid Dispenser System, supplied by Formulatrix, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tv3/TEMPEST/pmc11575580-248-1-5
    Average 94 stars, based on 1 article reviews
    tempest liquid dispenser system - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    gfp single band exciters et filter set  (Addgene inc)
    92
    Addgene inc gfp single band exciters et filter set
    Axonal Rtn-1 KD increases outgrowth by promoting Spastin’s microtubule severing. A. Representative fluorescent STED images of distal axons from microfluidic chambers containing control cortical axons or forty-four hours post-axotomy, which were stained for Rtn-1C (green), Spastin (red), and F-actin (phalloidin, blue). Insets show colocalization of Rtn-1C and Spastin. Right: Line scan analysis of Rtn-1C and Spastin highlighted in the white rectangle and their distribution along the axon. Bar graphs show the quantification of colocalization in control and axotomy conditions. Scale bar= 5 µm. Data are displayed as mean ± standard error of 6-7 axons. Unpaired t test; ∗∗p < 0.01 B. Representative images of axonal fields from microfluidic chambers 48 hours post-axotomy under different treatments: control sequence (Scrambled, Scr), Rtn-1 knockdown (Rtn-1 siRNA), and Spastin pharmacological inhibition (SPZT), and labeled with β3-tubulin (β3-tub). Scale bar represents 200 µm. C. Quantification of axon outgrowth under the treatments shown in A. The Area under the curve (AUC) was measured as the sum of the relative number of intersections at different distance ranges from the groove in the microfluidic chambers (0-500 µm; 500-1000 µm and 1000-1500 µm). Scale bar represents 10 µm. Data are displayed as mean ± standard error of 22-24 axonal fields for condition from N=3 biological replicates. One-way ANOVA followed by Tukey’s posthoc test; ∗p < 0.05; ∗∗p < 0.01. D. Fluorescence intensity profiles of β3-tubulin, Rtn-1C, and Spastin in axons and quantifications of intensity changes of indicated proteins as the fluorescence AUC fold change of the last 50 µm compared to Scr. Data are displayed as mean ± standard error of 24-40 axons for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗∗∗p < 0.001 E. Axonal kymographs showing dynamic microtubule behavior in neurons with indicated treatments after axotomy, dashes represent the traces <t>of</t> <t>EB3-GFP</t> (end-binding protein 3). Scale bars represent 10 µm and 30 seconds, respectively. F. Analysis of microtubule dynamics parameters in non-injured and injured axons with different treatments: growth rate, track length, and lifetime of microtubule plus-end tracks. Data are displayed as mean ± standard error of 146-377 comets for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗∗p < 0.001.
    Gfp Single Band Exciters Et Filter Set, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tv3/TV3-mCHY-mASUN+(Plasmid+%2347040)/bio_rxiv__2024__08__11__607514-317-4-26
    Average 92 stars, based on 1 article reviews
    gfp single band exciters et filter set - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier
    tempest liquid handler  (Formulatrix)
    94
    Formulatrix tempest liquid handler
    Axonal Rtn-1 KD increases outgrowth by promoting Spastin’s microtubule severing. A. Representative fluorescent STED images of distal axons from microfluidic chambers containing control cortical axons or forty-four hours post-axotomy, which were stained for Rtn-1C (green), Spastin (red), and F-actin (phalloidin, blue). Insets show colocalization of Rtn-1C and Spastin. Right: Line scan analysis of Rtn-1C and Spastin highlighted in the white rectangle and their distribution along the axon. Bar graphs show the quantification of colocalization in control and axotomy conditions. Scale bar= 5 µm. Data are displayed as mean ± standard error of 6-7 axons. Unpaired t test; ∗∗p < 0.01 B. Representative images of axonal fields from microfluidic chambers 48 hours post-axotomy under different treatments: control sequence (Scrambled, Scr), Rtn-1 knockdown (Rtn-1 siRNA), and Spastin pharmacological inhibition (SPZT), and labeled with β3-tubulin (β3-tub). Scale bar represents 200 µm. C. Quantification of axon outgrowth under the treatments shown in A. The Area under the curve (AUC) was measured as the sum of the relative number of intersections at different distance ranges from the groove in the microfluidic chambers (0-500 µm; 500-1000 µm and 1000-1500 µm). Scale bar represents 10 µm. Data are displayed as mean ± standard error of 22-24 axonal fields for condition from N=3 biological replicates. One-way ANOVA followed by Tukey’s posthoc test; ∗p < 0.05; ∗∗p < 0.01. D. Fluorescence intensity profiles of β3-tubulin, Rtn-1C, and Spastin in axons and quantifications of intensity changes of indicated proteins as the fluorescence AUC fold change of the last 50 µm compared to Scr. Data are displayed as mean ± standard error of 24-40 axons for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗∗∗p < 0.001 E. Axonal kymographs showing dynamic microtubule behavior in neurons with indicated treatments after axotomy, dashes represent the traces <t>of</t> <t>EB3-GFP</t> (end-binding protein 3). Scale bars represent 10 µm and 30 seconds, respectively. F. Analysis of microtubule dynamics parameters in non-injured and injured axons with different treatments: growth rate, track length, and lifetime of microtubule plus-end tracks. Data are displayed as mean ± standard error of 146-377 comets for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗∗p < 0.001.
    Tempest Liquid Handler, supplied by Formulatrix, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tv3/TEMPEST/pm36706756-823-58-61
    Average 94 stars, based on 1 article reviews
    tempest liquid handler - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    tempest liquid dispenser  (Formulatrix)
    94
    Formulatrix tempest liquid dispenser
    Axonal Rtn-1 KD increases outgrowth by promoting Spastin’s microtubule severing. A. Representative fluorescent STED images of distal axons from microfluidic chambers containing control cortical axons or forty-four hours post-axotomy, which were stained for Rtn-1C (green), Spastin (red), and F-actin (phalloidin, blue). Insets show colocalization of Rtn-1C and Spastin. Right: Line scan analysis of Rtn-1C and Spastin highlighted in the white rectangle and their distribution along the axon. Bar graphs show the quantification of colocalization in control and axotomy conditions. Scale bar= 5 µm. Data are displayed as mean ± standard error of 6-7 axons. Unpaired t test; ∗∗p < 0.01 B. Representative images of axonal fields from microfluidic chambers 48 hours post-axotomy under different treatments: control sequence (Scrambled, Scr), Rtn-1 knockdown (Rtn-1 siRNA), and Spastin pharmacological inhibition (SPZT), and labeled with β3-tubulin (β3-tub). Scale bar represents 200 µm. C. Quantification of axon outgrowth under the treatments shown in A. The Area under the curve (AUC) was measured as the sum of the relative number of intersections at different distance ranges from the groove in the microfluidic chambers (0-500 µm; 500-1000 µm and 1000-1500 µm). Scale bar represents 10 µm. Data are displayed as mean ± standard error of 22-24 axonal fields for condition from N=3 biological replicates. One-way ANOVA followed by Tukey’s posthoc test; ∗p < 0.05; ∗∗p < 0.01. D. Fluorescence intensity profiles of β3-tubulin, Rtn-1C, and Spastin in axons and quantifications of intensity changes of indicated proteins as the fluorescence AUC fold change of the last 50 µm compared to Scr. Data are displayed as mean ± standard error of 24-40 axons for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗∗∗p < 0.001 E. Axonal kymographs showing dynamic microtubule behavior in neurons with indicated treatments after axotomy, dashes represent the traces <t>of</t> <t>EB3-GFP</t> (end-binding protein 3). Scale bars represent 10 µm and 30 seconds, respectively. F. Analysis of microtubule dynamics parameters in non-injured and injured axons with different treatments: growth rate, track length, and lifetime of microtubule plus-end tracks. Data are displayed as mean ± standard error of 146-377 comets for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗∗p < 0.001.
    Tempest Liquid Dispenser, supplied by Formulatrix, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tv3/bio_rxiv__2023__09__15__557919-84-1-4
    Average 94 stars, based on 1 article reviews
    tempest liquid dispenser - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    Axonal Rtn-1 KD increases outgrowth by promoting Spastin’s microtubule severing. A. Representative fluorescent STED images of distal axons from microfluidic chambers containing control cortical axons or forty-four hours post-axotomy, which were stained for Rtn-1C (green), Spastin (red), and F-actin (phalloidin, blue). Insets show colocalization of Rtn-1C and Spastin. Right: Line scan analysis of Rtn-1C and Spastin highlighted in the white rectangle and their distribution along the axon. Bar graphs show the quantification of colocalization in control and axotomy conditions. Scale bar= 5 µm. Data are displayed as mean ± standard error of 6-7 axons. Unpaired t test; ∗∗p < 0.01 B. Representative images of axonal fields from microfluidic chambers 48 hours post-axotomy under different treatments: control sequence (Scrambled, Scr), Rtn-1 knockdown (Rtn-1 siRNA), and Spastin pharmacological inhibition (SPZT), and labeled with β3-tubulin (β3-tub). Scale bar represents 200 µm. C. Quantification of axon outgrowth under the treatments shown in A. The Area under the curve (AUC) was measured as the sum of the relative number of intersections at different distance ranges from the groove in the microfluidic chambers (0-500 µm; 500-1000 µm and 1000-1500 µm). Scale bar represents 10 µm. Data are displayed as mean ± standard error of 22-24 axonal fields for condition from N=3 biological replicates. One-way ANOVA followed by Tukey’s posthoc test; ∗p < 0.05; ∗∗p < 0.01. D. Fluorescence intensity profiles of β3-tubulin, Rtn-1C, and Spastin in axons and quantifications of intensity changes of indicated proteins as the fluorescence AUC fold change of the last 50 µm compared to Scr. Data are displayed as mean ± standard error of 24-40 axons for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗∗∗p < 0.001 E. Axonal kymographs showing dynamic microtubule behavior in neurons with indicated treatments after axotomy, dashes represent the traces of EB3-GFP (end-binding protein 3). Scale bars represent 10 µm and 30 seconds, respectively. F. Analysis of microtubule dynamics parameters in non-injured and injured axons with different treatments: growth rate, track length, and lifetime of microtubule plus-end tracks. Data are displayed as mean ± standard error of 146-377 comets for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗∗p < 0.001.

    Journal: bioRxiv

    Article Title: Local Synthesis of Reticulon-1C Lessens the Outgrowth of Injured Axons by Controlling Spastin Activity

    doi: 10.1101/2024.08.11.607514

    Figure Lengend Snippet: Axonal Rtn-1 KD increases outgrowth by promoting Spastin’s microtubule severing. A. Representative fluorescent STED images of distal axons from microfluidic chambers containing control cortical axons or forty-four hours post-axotomy, which were stained for Rtn-1C (green), Spastin (red), and F-actin (phalloidin, blue). Insets show colocalization of Rtn-1C and Spastin. Right: Line scan analysis of Rtn-1C and Spastin highlighted in the white rectangle and their distribution along the axon. Bar graphs show the quantification of colocalization in control and axotomy conditions. Scale bar= 5 µm. Data are displayed as mean ± standard error of 6-7 axons. Unpaired t test; ∗∗p < 0.01 B. Representative images of axonal fields from microfluidic chambers 48 hours post-axotomy under different treatments: control sequence (Scrambled, Scr), Rtn-1 knockdown (Rtn-1 siRNA), and Spastin pharmacological inhibition (SPZT), and labeled with β3-tubulin (β3-tub). Scale bar represents 200 µm. C. Quantification of axon outgrowth under the treatments shown in A. The Area under the curve (AUC) was measured as the sum of the relative number of intersections at different distance ranges from the groove in the microfluidic chambers (0-500 µm; 500-1000 µm and 1000-1500 µm). Scale bar represents 10 µm. Data are displayed as mean ± standard error of 22-24 axonal fields for condition from N=3 biological replicates. One-way ANOVA followed by Tukey’s posthoc test; ∗p < 0.05; ∗∗p < 0.01. D. Fluorescence intensity profiles of β3-tubulin, Rtn-1C, and Spastin in axons and quantifications of intensity changes of indicated proteins as the fluorescence AUC fold change of the last 50 µm compared to Scr. Data are displayed as mean ± standard error of 24-40 axons for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗∗∗p < 0.001 E. Axonal kymographs showing dynamic microtubule behavior in neurons with indicated treatments after axotomy, dashes represent the traces of EB3-GFP (end-binding protein 3). Scale bars represent 10 µm and 30 seconds, respectively. F. Analysis of microtubule dynamics parameters in non-injured and injured axons with different treatments: growth rate, track length, and lifetime of microtubule plus-end tracks. Data are displayed as mean ± standard error of 146-377 comets for condition from N=3 biological replicates. Kruskal-Wallis followed by Dunn’s posthoc test; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗∗p < 0.001.

    Article Snippet: A 63x objective and GFP single band exciters ET filter set (excitation 470/40, emission 59022m, dichroic 59022BS) were used. mEmerald-EB3-C-20 was a gift from Michael Davidson (Addgene plasmid # 54076; http://n2t.net/addgene:54076 ; RRID:Addgene_54076)

    Techniques: Control, Staining, Sequencing, Knockdown, Inhibition, Labeling, Fluorescence, Binding Assay