Review



atg cct ttc cca gct tat cttc r  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    ATCC atg cct ttc cca gct tat cttc r
    Atg Cct Ttc Cca Gct Tat Cttc R, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 279 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cttc/10__1007_slash_s10592___025___01689___z-113-407-442?v=ATCC
    Average 96 stars, based on 279 article reviews
    atg cct ttc cca gct tat cttc r - by Bioz Stars, 2026-08
    96/100 stars

    Images



    Similar Products

    atg cct ttc cca gct tat cttc r  (ATCC)
    96
    ATCC atg cct ttc cca gct tat cttc r
    Atg Cct Ttc Cca Gct Tat Cttc R, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cttc/10__1007_slash_s10592___025___01689___z-113-407-442?v=ATCC
    Average 96 stars, based on 1 article reviews
    atg cct ttc cca gct tat cttc r - by Bioz Stars, 2026-08
    96/100 stars
    		  Buy from Supplier
    paper pcr primers ctga cttc atca gagg tggc atc sequence based reagent notch1ko f  (MedChemExpress)
    94
    MedChemExpress paper pcr primers ctga cttc atca gagg tggc atc sequence based reagent notch1ko f
    Paper Pcr Primers Ctga Cttc Atca Gagg Tggc Atc Sequence Based Reagent Notch1ko F, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cttc/10__7554_slash_elife__97268-319-201-242?v=MedChemExpress
    Average 94 stars, based on 1 article reviews
    paper pcr primers ctga cttc atca gagg tggc atc sequence based reagent notch1ko f - by Bioz Stars, 2026-08
    94/100 stars
    		  Buy from Supplier
    cttc g ttcgcttcgcttttgcaggc  (Addgene inc)
    94
    Addgene inc cttc g ttcgcttcgcttttgcaggc
    Cttc G Ttcgcttcgcttttgcaggc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cttc/bio_rxiv__2025__01__15__633270-288-2-15?v=Addgene+inc
    Average 94 stars, based on 1 article reviews
    cttc g ttcgcttcgcttttgcaggc - by Bioz Stars, 2026-08
    94/100 stars
    		  Buy from Supplier
    cttc g acttgttgagatagtccatg  (Addgene inc)
    94
    Addgene inc cttc g acttgttgagatagtccatg
    Cttc G Acttgttgagatagtccatg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cttc/bio_rxiv__2025__01__15__633270-288-6-15?v=Addgene+inc
    Average 94 stars, based on 1 article reviews
    cttc g acttgttgagatagtccatg - by Bioz Stars, 2026-08
    94/100 stars
    		  Buy from Supplier
    cttc registry  (Cancer Care Inc)
    90
    Cancer Care Inc cttc registry
    Cttc Registry, supplied by Cancer Care Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cttc/pm37999143-46-16-19?v=Cancer+Care+Inc
    Average 90 stars, based on 1 article reviews
    cttc registry - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    2014 pcr primers tgca ttca actc acag agtt gaac cttc c sequence based reagent gapdh f quénet  (ATCC)
    96
    ATCC 2014 pcr primers tgca ttca actc acag agtt gaac cttc c sequence based reagent gapdh f quénet
    2014 Pcr Primers Tgca Ttca Actc Acag Agtt Gaac Cttc C Sequence Based Reagent Gapdh F Quénet, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cttc/10__7554_slash_elife__86709-342-200-224?v=ATCC
    Average 96 stars, based on 1 article reviews
    2014 pcr primers tgca ttca actc acag agtt gaac cttc c sequence based reagent gapdh f quénet - by Bioz Stars, 2026-08
    96/100 stars
    		  Buy from Supplier
    planetary mixer cttc clatronic km 3632 1200 w  (Clatronic International GmbH)
    90
    Clatronic International GmbH planetary mixer cttc clatronic km 3632 1200 w
    Planetary Mixer Cttc Clatronic Km 3632 1200 W, supplied by Clatronic International GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cttc/10__1007_slash_s00107___022___01856___w-77-12-14?v=Clatronic+International+GmbH
    Average 90 stars, based on 1 article reviews
    planetary mixer cttc clatronic km 3632 1200 w - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    2019 oca2 t306 caca atcc aggc cttc ctgc  (ATCC)
    96
    ATCC 2019 oca2 t306 caca atcc aggc cttc ctgc
    2019 Oca2 T306 Caca Atcc Aggc Cttc Ctgc, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cttc/10__7554_slash_elife__72124-419-44-48?v=ATCC
    Average 96 stars, based on 1 article reviews
    2019 oca2 t306 caca atcc aggc cttc ctgc - by Bioz Stars, 2026-08
    96/100 stars
    		  Buy from Supplier
    probe p2 5’-lc640- ctagtgatgggctcttcccttgagcc cttc-3’-phosphate  (TIB MOLBIOL)
    90
    TIB MOLBIOL probe p2 5’-lc640- ctagtgatgggctcttcccttgagcc cttc-3’-phosphate
    Probe P2 5’ Lc640 Ctagtgatgggctcttcccttgagcc Cttc 3’ Phosphate, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cttc/pmc08531570__mmc1-77-215-218?v=TIB+MOLBIOL
    Average 90 stars, based on 1 article reviews
    probe p2 5’-lc640- ctagtgatgggctcttcccttgagcc cttc-3’-phosphate - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier

    Image Search Results