94
|
Addgene inc
cttc g ttcgcttcgcttttgcaggc Cttc G Ttcgcttcgcttttgcaggc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cttc/bio_rxiv__2025__01__15__633270-288-2-15?v=Addgene+inc Average 94 stars, based on 1 article reviews
cttc g ttcgcttcgcttttgcaggc - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
90
|
United Biosystems Inc
cttc peptide Cttc Peptide, supplied by United Biosystems Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cttc/pmc04959661-207-1-15?v=United+Biosystems+Inc Average 90 stars, based on 1 article reviews
cttc peptide - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
N/A
|
Standard format: Plasmid sent in bacteria as agar stab
|
Buy from Supplier |
N/A
|
Standard format: Plasmid sent in bacteria as agar stab
|
Buy from Supplier |