cttc Search Results


94
Addgene inc cttc g ttcgcttcgcttttgcaggc
Cttc G Ttcgcttcgcttttgcaggc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cttc/bio_rxiv__2025__01__15__633270-288-2-15?v=Addgene+inc
Average 94 stars, based on 1 article reviews
cttc g ttcgcttcgcttttgcaggc - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

90
United Biosystems Inc cttc peptide
Cttc Peptide, supplied by United Biosystems Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cttc/pmc04959661-207-1-15?v=United+Biosystems+Inc
Average 90 stars, based on 1 article reviews
cttc peptide - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

N/A
Standard format: Plasmid sent in bacteria as agar stab
  Buy from Supplier

N/A
Standard format: Plasmid sent in bacteria as agar stab
  Buy from Supplier

Image Search Results