|
ATCC
atg cct ttc cca gct tat cttc r Atg Cct Ttc Cca Gct Tat Cttc R, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cttc/GCT/10__1007_slash_s10592___025___01689___z-113-407-442 Average 96 stars, based on 1 article reviews
atg cct ttc cca gct tat cttc r - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
MedChemExpress
paper pcr primers ctga cttc atca gagg tggc atc sequence based reagent notch1ko f Paper Pcr Primers Ctga Cttc Atca Gagg Tggc Atc Sequence Based Reagent Notch1ko F, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cttc/Notch+1/10__7554_slash_elife__97268-319-201-242 Average 94 stars, based on 1 article reviews
paper pcr primers ctga cttc atca gagg tggc atc sequence based reagent notch1ko f - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Addgene inc
cttc g ttcgcttcgcttttgcaggc Cttc G Ttcgcttcgcttttgcaggc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cttc/III-CTTC+(Plasmid+%2343600)/bio_rxiv__2025__01__15__633270-288-2-15 Average 94 stars, based on 1 article reviews
cttc g ttcgcttcgcttttgcaggc - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Addgene inc
cttc g acttgttgagatagtccatg Cttc G Acttgttgagatagtccatg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cttc/III-CTTC+(Plasmid+%2343600)/bio_rxiv__2025__01__15__633270-288-6-15 Average 94 stars, based on 1 article reviews
cttc g acttgttgagatagtccatg - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Cancer Care Inc
cttc registry Cttc Registry, supplied by Cancer Care Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cttc/cttc+registry/pm37999143-46-16-19 Average 90 stars, based on 1 article reviews
cttc registry - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
ATCC
2014 pcr primers tgca ttca actc acag agtt gaac cttc c sequence based reagent gapdh f quénet 2014 Pcr Primers Tgca Ttca Actc Acag Agtt Gaac Cttc C Sequence Based Reagent Gapdh F Quénet, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cttc/HGF-1/10__7554_slash_elife__86709-342-200-224 Average 96 stars, based on 1 article reviews
2014 pcr primers tgca ttca actc acag agtt gaac cttc c sequence based reagent gapdh f quénet - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Clatronic International GmbH
planetary mixer cttc clatronic km 3632 1200 w Planetary Mixer Cttc Clatronic Km 3632 1200 W, supplied by Clatronic International GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cttc/mincing+machine+clatronic+fw+2684/10__1007_slash_s00107___022___01856___w-77-12-14 Average 90 stars, based on 1 article reviews
planetary mixer cttc clatronic km 3632 1200 w - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
ATCC
2019 oca2 t306 caca atcc aggc cttc ctgc 2019 Oca2 T306 Caca Atcc Aggc Cttc Ctgc, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cttc/MH-S/10__7554_slash_elife__72124-419-44-48 Average 96 stars, based on 1 article reviews
2019 oca2 t306 caca atcc aggc cttc ctgc - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
TIB MOLBIOL
probe p2 5’-lc640- ctagtgatgggctcttcccttgagcc cttc-3’-phosphate Probe P2 5’ Lc640 Ctagtgatgggctcttcccttgagcc Cttc 3’ Phosphate, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cttc/hybridization+probes+t++cruzi+lc640/pmc08531570__mmc1-77-215-218 Average 90 stars, based on 1 article reviews
probe p2 5’-lc640- ctagtgatgggctcttcccttgagcc cttc-3’-phosphate - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |