Review





Similar Products

96
ATCC atg cct ttc cca gct tat cttc r
Atg Cct Ttc Cca Gct Tat Cttc R, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cttc/GCT/10__1007_slash_s10592___025___01689___z-113-407-442
Average 96 stars, based on 1 article reviews
atg cct ttc cca gct tat cttc r - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

94
MedChemExpress paper pcr primers ctga cttc atca gagg tggc atc sequence based reagent notch1ko f
Paper Pcr Primers Ctga Cttc Atca Gagg Tggc Atc Sequence Based Reagent Notch1ko F, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cttc/Notch+1/10__7554_slash_elife__97268-319-201-242
Average 94 stars, based on 1 article reviews
paper pcr primers ctga cttc atca gagg tggc atc sequence based reagent notch1ko f - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
Addgene inc cttc g ttcgcttcgcttttgcaggc
Cttc G Ttcgcttcgcttttgcaggc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cttc/III-CTTC+(Plasmid+%2343600)/bio_rxiv__2025__01__15__633270-288-2-15
Average 94 stars, based on 1 article reviews
cttc g ttcgcttcgcttttgcaggc - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
Addgene inc cttc g acttgttgagatagtccatg
Cttc G Acttgttgagatagtccatg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cttc/III-CTTC+(Plasmid+%2343600)/bio_rxiv__2025__01__15__633270-288-6-15
Average 94 stars, based on 1 article reviews
cttc g acttgttgagatagtccatg - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

90
Cancer Care Inc cttc registry
Cttc Registry, supplied by Cancer Care Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cttc/cttc+registry/pm37999143-46-16-19
Average 90 stars, based on 1 article reviews
cttc registry - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

96
ATCC 2014 pcr primers tgca ttca actc acag agtt gaac cttc c sequence based reagent gapdh f quénet
2014 Pcr Primers Tgca Ttca Actc Acag Agtt Gaac Cttc C Sequence Based Reagent Gapdh F Quénet, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cttc/HGF-1/10__7554_slash_elife__86709-342-200-224
Average 96 stars, based on 1 article reviews
2014 pcr primers tgca ttca actc acag agtt gaac cttc c sequence based reagent gapdh f quénet - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

90
Clatronic International GmbH planetary mixer cttc clatronic km 3632 1200 w
Planetary Mixer Cttc Clatronic Km 3632 1200 W, supplied by Clatronic International GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cttc/mincing+machine+clatronic+fw+2684/10__1007_slash_s00107___022___01856___w-77-12-14
Average 90 stars, based on 1 article reviews
planetary mixer cttc clatronic km 3632 1200 w - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

96
ATCC 2019 oca2 t306 caca atcc aggc cttc ctgc
2019 Oca2 T306 Caca Atcc Aggc Cttc Ctgc, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cttc/MH-S/10__7554_slash_elife__72124-419-44-48
Average 96 stars, based on 1 article reviews
2019 oca2 t306 caca atcc aggc cttc ctgc - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

90
TIB MOLBIOL probe p2 5’-lc640- ctagtgatgggctcttcccttgagcc cttc-3’-phosphate
Probe P2 5’ Lc640 Ctagtgatgggctcttcccttgagcc Cttc 3’ Phosphate, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cttc/hybridization+probes+t++cruzi+lc640/pmc08531570__mmc1-77-215-218
Average 90 stars, based on 1 article reviews
probe p2 5’-lc640- ctagtgatgggctcttcccttgagcc cttc-3’-phosphate - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results