pmd19 t vector (TaKaRa)
TaKaRa is a verified supplier 
TaKaRa manufactures this product 
97
Structured Review
TaKaRa
pmd19 t vector
Pmd19 T Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 8299 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pmd/T-Vector+pMD+19/pm42859138-83-18-20
Average 97 stars, based on 8299 article reviews
Pmd19 T Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 8299 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pmd/T-Vector+pMD+19/pm42859138-83-18-20
Average 97 stars, based on 8299 article reviews
pmd19 t vector - by Bioz Stars,
2026-10
97/100 stars
Images
Related Articles
TA Cloning:Article Title: Phosphatidylinositol-phospholipase C2 regulates pattern-triggered immunity in Nicotiana benthamiana Article Snippet: .. These cDNA fragments were independently subcloned into the TA cloning site of the Plasmid Preparation:Article Title: Phosphatidylinositol-phospholipase C2 regulates pattern-triggered immunity in Nicotiana benthamiana Article Snippet: .. These cDNA fragments were independently subcloned into the TA cloning site of the Article Title: Functional divergence of the brain-size regulating gene MCPH1 during primate evolution and the origin of humans Article Snippet: The nested PCR was used and the primer sequences are: macaMCPH1-3RACE: 5GAGAAAGAGGAGCATCAGGAGATCTATCA3; macaMCPH1-5RACE: 5GGATTCCTCAGAAGTCACGCAACTGA3; macaMCPH1-nest_3RACE: 5GAAAGAGGAGCATCAGGAGATCTATCAT3; macaMCPH1-nest_5RACE: 5CAGAAGTCACGCAACTGAAAGTTGCA3 gibbonMCPH1-3RACE: 5TTAGCTGTGGGGAGTCTTCATATGATGAC3; gibbonMCPH1-5RACE: 5GCGGGGTCCTCAATGGTGTAAGA3; gibbonMCPH1-nest_3RACE: 5AGCTGTGGGGAGTCTTCATATGATGAC3; gibbonMCPH1-nest_5RACE: 5GGTCCTCAATGGTGTAAGAAAAGCCA3; The macaque MCPH1 PCR products were cloned into the pMD-19 simple-T-vector (Takara, Tokyo, Japan), then digested with BamH I and EcoR I, and cloned into a pCGN-HAM vector. .. The gibbon MCPH1 PCR products were cloned into the Article Title: Effects of different soil moisture on the growth, quality, and root rot disease of organic Panax notoginseng cultivated under pine forests. Article Snippet: The under-forest economy in the agroforestry system can improve land use efficiency, protect ecological environment, and promote arable land sustainable development.. However, the effects of soil moisture in the forest and irrigation strategies on the healthy growth of intercropping crops are still incomplete.. Here, considering the organic Panax notoginseng cultivated under pine forests (PPF) as the research object, we explored the effects of different soil moisture on the physiological state, yield, quality and disease occurrence of PPF. Article Title: First report of bovine herpesvirus 1 isolation from bull semen samples in China. Article Snippet: .. Th e amplifi ed fragments were subsequently cloned into Clone Assay:Article Title: Let-7a-3 hypomethylation is associated with favorable/intermediate karyotypes but not with survival in acute myeloid leukemia. Article Snippet: Aberrant methylation of let-7a-3 promoter has been observed in various malignancies.. However, the clinical relevance of let-7a-3 methylation remains poorly known in acute myeloid leukemia (AML).. This study was to investigate the let-7a-3 methylation status and to explore its clinical significance in AML. let-7a-3 promoter was significantly hypomethylated in AML patients compared to controls (median 4.51 vs 0.49) (P=0.0003). Article Title: Cancer‐testis gene PIWIL 1 promotes cell proliferation, migration, and invasion in lung adenocarcinoma Article Snippet: .. The 410‐bp PCR products, which covered 46 CpG sites (UCSC GRCh37/hg19: chr12:130822264‐130822673) within a CpG‐rich region located in PIWIL1 promoter and exon 1 were cloned into Article Title: Functional divergence of the brain-size regulating gene MCPH1 during primate evolution and the origin of humans Article Snippet: The nested PCR was used and the primer sequences are: macaMCPH1-3RACE: 5GAGAAAGAGGAGCATCAGGAGATCTATCA3; macaMCPH1-5RACE: 5GGATTCCTCAGAAGTCACGCAACTGA3; macaMCPH1-nest_3RACE: 5GAAAGAGGAGCATCAGGAGATCTATCAT3; macaMCPH1-nest_5RACE: 5CAGAAGTCACGCAACTGAAAGTTGCA3 gibbonMCPH1-3RACE: 5TTAGCTGTGGGGAGTCTTCATATGATGAC3; gibbonMCPH1-5RACE: 5GCGGGGTCCTCAATGGTGTAAGA3; gibbonMCPH1-nest_3RACE: 5AGCTGTGGGGAGTCTTCATATGATGAC3; gibbonMCPH1-nest_5RACE: 5GGTCCTCAATGGTGTAAGAAAAGCCA3; The macaque MCPH1 PCR products were cloned into the pMD-19 simple-T-vector (Takara, Tokyo, Japan), then digested with BamH I and EcoR I, and cloned into a pCGN-HAM vector. .. The gibbon MCPH1 PCR products were cloned into the Article Title: Effects of different soil moisture on the growth, quality, and root rot disease of organic Panax notoginseng cultivated under pine forests. Article Snippet: The under-forest economy in the agroforestry system can improve land use efficiency, protect ecological environment, and promote arable land sustainable development.. However, the effects of soil moisture in the forest and irrigation strategies on the healthy growth of intercropping crops are still incomplete.. Here, considering the organic Panax notoginseng cultivated under pine forests (PPF) as the research object, we explored the effects of different soil moisture on the physiological state, yield, quality and disease occurrence of PPF. Article Title: Hypomethylation‐mediated activation of cancer/testis antigen KK‐LC‐1 facilitates hepatocellular carcinoma progression through activating the Notch1/Hes1 signalling Article Snippet: .. The 341‐bp PCR products were cloned into Article Title: First report of bovine herpesvirus 1 isolation from bull semen samples in China. Article Snippet: .. Th e amplifi ed fragments were subsequently cloned into Polymerase Chain Reaction:Article Title: Cancer‐testis gene PIWIL 1 promotes cell proliferation, migration, and invasion in lung adenocarcinoma Article Snippet: .. The 410‐bp PCR products, which covered 46 CpG sites (UCSC GRCh37/hg19: chr12:130822264‐130822673) within a CpG‐rich region located in PIWIL1 promoter and exon 1 were cloned into Article Title: Functional divergence of the brain-size regulating gene MCPH1 during primate evolution and the origin of humans Article Snippet: The nested PCR was used and the primer sequences are: macaMCPH1-3RACE: 5GAGAAAGAGGAGCATCAGGAGATCTATCA3; macaMCPH1-5RACE: 5GGATTCCTCAGAAGTCACGCAACTGA3; macaMCPH1-nest_3RACE: 5GAAAGAGGAGCATCAGGAGATCTATCAT3; macaMCPH1-nest_5RACE: 5CAGAAGTCACGCAACTGAAAGTTGCA3 gibbonMCPH1-3RACE: 5TTAGCTGTGGGGAGTCTTCATATGATGAC3; gibbonMCPH1-5RACE: 5GCGGGGTCCTCAATGGTGTAAGA3; gibbonMCPH1-nest_3RACE: 5AGCTGTGGGGAGTCTTCATATGATGAC3; gibbonMCPH1-nest_5RACE: 5GGTCCTCAATGGTGTAAGAAAAGCCA3; The macaque MCPH1 PCR products were cloned into the pMD-19 simple-T-vector (Takara, Tokyo, Japan), then digested with BamH I and EcoR I, and cloned into a pCGN-HAM vector. .. The gibbon MCPH1 PCR products were cloned into the Article Title: Hypomethylation‐mediated activation of cancer/testis antigen KK‐LC‐1 facilitates hepatocellular carcinoma progression through activating the Notch1/Hes1 signalling Article Snippet: .. The 341‐bp PCR products were cloned into Article Title: Isolation and characterization of a Raf gene from Chinese shrimp Fenneropenaeus chinensis in response to white spot syndrome virus infection. Article Snippet: M AN US CR AC CE PT ED Raf is a member in the Ras/Raf/MAPKK/MAPK signaling transduction pathway.. To obtain a 15 better understanding of Raf in the interaction between the Chinese shrimp Fenneropenaeus 16 chinensis and white spot syndrome virus (WSSV), the sequence of cDNA of Raf from F. chinensis 17 (FcRaf) was obtained.. The FcRaf gene contained a 2421 bp open reading frame (ORF). Amplification:Article Title: Effects of different soil moisture on the growth, quality, and root rot disease of organic Panax notoginseng cultivated under pine forests. Article Snippet: The under-forest economy in the agroforestry system can improve land use efficiency, protect ecological environment, and promote arable land sustainable development.. However, the effects of soil moisture in the forest and irrigation strategies on the healthy growth of intercropping crops are still incomplete.. Here, considering the organic Panax notoginseng cultivated under pine forests (PPF) as the research object, we explored the effects of different soil moisture on the physiological state, yield, quality and disease occurrence of PPF. Transformation Assay:Article Title: Isolation and characterization of a Raf gene from Chinese shrimp Fenneropenaeus chinensis in response to white spot syndrome virus infection. Article Snippet: M AN US CR AC CE PT ED Raf is a member in the Ras/Raf/MAPKK/MAPK signaling transduction pathway.. To obtain a 15 better understanding of Raf in the interaction between the Chinese shrimp Fenneropenaeus 16 chinensis and white spot syndrome virus (WSSV), the sequence of cDNA of Raf from F. chinensis 17 (FcRaf) was obtained.. The FcRaf gene contained a 2421 bp open reading frame (ORF). |