Review



resource source identifier iscript cdna synthesis biorad  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Bio-Rad resource source identifier iscript cdna synthesis biorad
    Resource Source Identifier Iscript Cdna Synthesis Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 6649 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/source/IScript+C+DNA+Synthesis+Kit/pm42815461-276-2-8
    Average 99 stars, based on 6649 article reviews
    resource source identifier iscript cdna synthesis biorad - by Bioz Stars, 2026-10
    99/100 stars

    Images

    Related Articles

    cDNA Synthesis:

    Article Title: Cell-free hemoglobin upregulates pulmonary endothelial heparanase expression to drive glycocalyx destruction and inflammation in sepsis.
    Article Snippet: Heparanase mRNA and Protein Expression Total mRNA was isolated from treated HLMVECs and the pulmonary endothelial cells of septic mice using the Qiagen RNeasy Mini Kit (74104) according to the manufacturer’s instructions. .. 200ng of mRNA were used per 20 μL of iScript cDNA Synthesis reaction mix (1708891, Bio-Rad). .. TaqMan quantitative polymerase chain reaction (qPCR) primers specific to human (Hs00935036) and mouse (Mm00461768) heparanase were used to measure gene expression (4331182, Thermo Fisher Scientific).

    Article Title: In Vitro Generation of TGFb- and IL1a-Induced Fibroblast Subtypes for Mechanistic Studies of Extracellular Matrix Composition and Architecture
    Article Snippet: Lysates were passed 10 times through a sterile BD MicrolanceTM 3 needle (#300635, 27G 0.4 x 13 mm) attached to a 1 mL BD Luer-Lok Syringe (#309628) and RNA was further isolated using the protocol provided by the manufacturer. .. For cDNA, the iScriptTM cDNA Synthesis Kit (Bio-Rad, #1708891) was used. .. RTqPCR was executed with iQTM SYBR Green Supermix (BioRad, ##1708886) on the CFX96TM Touch Real-Time System.

    Article Title: Disruption of local CTCF binding impairs renin expression and blood pressure response in Dahl salt-sensitive rats.
    Article Snippet: 1 in Dahl salt-sensitive rats 2 Mark Vanden Avond, Michael N. Grzybowski, Terry Kurth, Chun Yang, Jason Klotz, Ana 3 Hantke Guixa, Andrew Greene, Sridhar Rao, Qiongzi Qiu, Pengyuan Liu 7, , Yong Liu, 4 Mingyu Liang, Allen W. Cowley Jr., Aron M. Geurts 5 Department of Physiology, Medical College of Wisconsin, Milwaukee, WI, USA 6 The Jackson Laboratory for Mammalian Genetics, Bar Harbor, ME, USA 7 Department of Pediatrics, Division of Hematology, Oncology, and Bone Marrow 8 Transplantation, Medical College of Wisconsin, Milwaukee, WI, USA.. 9 Versiti Blood Research Institute, Milwaukee, WI, USA.. 10 Department of Cell Biology, Neurobiology and Anatomy, Medical College of Wisconsin, 11 Milwaukee, WI, USA.

    Article Title: Salivary miRNAs along with p53 and EGFR in oral exfoliated cells: a pilot study on candidate noninvasive biomarkers for the early detection of oral cancer in tobacco users.
    Article Snippet: 1 Centre for Medical Biotechnology, Maharshi Dayanand University, Rohtak, Haryana 124001, India 2 Swami Shraddhanand College, University of Delhi, New Delhi 110036, India 3 Dept.. of Oral Pathology, Postgraduate Institute of Dental Sciences, Rohtak, Haryana 124001, India Abstract Background The low 5-year survival rate for Oral Squamous Cell Carcinoma (OSCC) is largely attributed to the limitations of current invasive diagnostic procedures and diagnosis at a late stage.. Biomarkers from saliva and exfoliated oral cells could be used to diagnose oral cancer as the malignancy begins in the epithelium and would be particularly useful for screening patients in high-risk categories like tobacco users.

    Article Title: PLOD1 Catalytic Activity Stabilizes ENO1 by Limiting FBXW7-dependent Degradation to Promote Glycolysis and TMZ Resistance in Glioblastoma.
    Article Snippet: .8 RNA Extraction and Quantitative Real-Time CR (qRT-PCR) otal RNA was extracted using the RNeasy Mini Kit (Qiagen, 74104). .. cDNA was synthesized using the iScript cDNA Synthesis it (Bio-Rad, #1708891). .. qRT-PCR was performed on a CFX96 eal-Time PCR Detection System (Bio-Rad) using iTaq Universal YBR Green Supermix (Bio-Rad, #1725121).

    Article Title: Cyclic nucleotide signaling through phosphodiesterase 1 inhibition and its interaction with the competing endogenous RNA network regulates cognition.
    Article Snippet: Total RNA was extracted from the mouse brain with the RNeasy Mini Kit (Qiagen, Cat. No. 74104). .. Reverse transcription was conducted by iScript cDNA Synthesis Kit (Bio-Rad, Cat. No. 1708890) to generate cDNA for further mRNA and miRNA analysis. .. RT-qPCR was performed using custom primers and iTaq Universal SYBR Green Supermix (BioRad) on a Bio-Rad CFX Opus 96 Real-Time PCR System.

    Article Title: Aire is a cell-intrinsic regulator of natural IgM-secreting cells.
    Article Snippet: Flowjo 10 (Trees- tar) software was used for analysis. .. REAGENT or RESOURCE SOURCE IDENTIFIER iScript cDNA Synthesis BioRad Cat# 1708890 TaqMan Fast Advanced Master Mix Thermo Fisher Scientific Cat# 4444557 NEBNext Ultra II New England Biolabs Cat# E7103L OneStep Ahead RT- PCR kit Qiagen Cat# 220211 Deposited data Single cell RNA-seq analysis of mature thymic epithelial cells Sansom et al. GEO: GSE53111 Differential features of Aire-induced and Aire-independent promiscuous gene expression in thymic epithelial cells St. Pierre et al. GEO: GSE65617 RNA sequencing of Aire-reporter-positive CD138+IgM+ cells from Aire+/+ and Aire–/– Aire-HCO mice This paper GEO: GSE310317 Bulk immunoglobulin heavy-chain repertoire sequencing This paper GEO: GSE332886 Experimental models: Organisms/strains Mus musculus (BALB/c): Aire- HCOTG: Aire-HCO4 Aschenbrenner et al.81 N/A Mus musculus (C57BL/6): AdigTG: Tg(Aire-G6pc2/GFP)1Mand Gardner et al.18 N/A Mus musculus (C57BL/6): Tcra -/-: Tcratm1Mom Mombaerts et al.82 N/A Mus musculus (C57BL/6): Cd40-/-: B6.129P2-Cd40tm1Kik/J Kawabe et al.83 N/A Mus musculus (C57BL/6): Airef/f: B6.Cg-Airetm1Dfil/J Dobes et al.52 N/A Mus musculus(BALB/c): Ciita-/-: C.129S2(B6)-Ciitatm1Ccum/J Chang et al.84 N/A Mus musculus (C57BL/6): Mb1-Cre: Cd79atm1(cre)Reth Hobeika et al.53 N/A Mus musculus (C57BL/6): Foxn1-Cre: Tg(Foxn1-cre)8Ghr Rossi et al.54 N/A Mus musculus (C57BL/6); Aire-/-; B6.129S2-Airetm1.1Doi Anderson et al.2 N/A Mus musculus (BALB/c): Aire-/-: C.Cg-Airetm1Pltn Ramsey et al.3 N/A Software and algorithms FlowJo software 10.7.2 Tree Star https://www.flowjo.com GraphPad PRISM 7.0 Graphpad Software https://www.graphpad.com/ NDP.view2 Hamamatsu Photonics https://www.hamamatsu.com/ Image J National Institute of Health https://imagej.net/ LEGENDplex Data Analysis Software Suite BioLegend https://www.biolegend.com/ ll OPEN ACCESS Article e3 Immunity 59, 1–19.e1–e6, December 8, 2026 .. Total RNA was isolated using the RNeasy RNA Isolation Kit (Qiagen).

    Real-time Polymerase Chain Reaction:

    Article Title: Disruption of local CTCF binding impairs renin expression and blood pressure response in Dahl salt-sensitive rats.
    Article Snippet: 1 in Dahl salt-sensitive rats 2 Mark Vanden Avond, Michael N. Grzybowski, Terry Kurth, Chun Yang, Jason Klotz, Ana 3 Hantke Guixa, Andrew Greene, Sridhar Rao, Qiongzi Qiu, Pengyuan Liu 7, , Yong Liu, 4 Mingyu Liang, Allen W. Cowley Jr., Aron M. Geurts 5 Department of Physiology, Medical College of Wisconsin, Milwaukee, WI, USA 6 The Jackson Laboratory for Mammalian Genetics, Bar Harbor, ME, USA 7 Department of Pediatrics, Division of Hematology, Oncology, and Bone Marrow 8 Transplantation, Medical College of Wisconsin, Milwaukee, WI, USA.. 9 Versiti Blood Research Institute, Milwaukee, WI, USA.. 10 Department of Cell Biology, Neurobiology and Anatomy, Medical College of Wisconsin, 11 Milwaukee, WI, USA.

    Article Title: Macrophages modulate ovarian cancer progression by regulating epithelial-mesenchymal transition.
    Article Snippet: The isolated RNA was dissolved in nuclease-free water and quantified using a NanoDrop spectrophotometer (Implen). .. cDNA synthesis was carried out using the iScript cDNA Synthesis Kit (Bio-Rad, Cat. No. 1708890) according to the manufacturer’s instructions under the following cycling conditions: 25 ◦C for 5 min, 46 ◦C for 20 min, and 95 ◦C for 5 min. Quantitative PCR was performed using SYBR Green Supermix (Bio-Rad, Cat. No. 171–5121) on the QuantStudio 5 Real-Time PCR System. .. The expression levels of M1 and M2 markers (CD206, CD163, ARG1, iNOS and CD86) whereas EMT-related genes (E-cadherin, N-cadherin, Snail, Slug, MMP-2, Twist, Vimentin, and ZEB) were analysed, with GAPDH serving as the endogenous control.

    Reverse Transcription:

    Article Title: Disruption of local CTCF binding impairs renin expression and blood pressure response in Dahl salt-sensitive rats.
    Article Snippet: 1 in Dahl salt-sensitive rats 2 Mark Vanden Avond, Michael N. Grzybowski, Terry Kurth, Chun Yang, Jason Klotz, Ana 3 Hantke Guixa, Andrew Greene, Sridhar Rao, Qiongzi Qiu, Pengyuan Liu 7, , Yong Liu, 4 Mingyu Liang, Allen W. Cowley Jr., Aron M. Geurts 5 Department of Physiology, Medical College of Wisconsin, Milwaukee, WI, USA 6 The Jackson Laboratory for Mammalian Genetics, Bar Harbor, ME, USA 7 Department of Pediatrics, Division of Hematology, Oncology, and Bone Marrow 8 Transplantation, Medical College of Wisconsin, Milwaukee, WI, USA.. 9 Versiti Blood Research Institute, Milwaukee, WI, USA.. 10 Department of Cell Biology, Neurobiology and Anatomy, Medical College of Wisconsin, 11 Milwaukee, WI, USA.

    Article Title: Cyclic nucleotide signaling through phosphodiesterase 1 inhibition and its interaction with the competing endogenous RNA network regulates cognition.
    Article Snippet: Total RNA was extracted from the mouse brain with the RNeasy Mini Kit (Qiagen, Cat. No. 74104). .. Reverse transcription was conducted by iScript cDNA Synthesis Kit (Bio-Rad, Cat. No. 1708890) to generate cDNA for further mRNA and miRNA analysis. .. RT-qPCR was performed using custom primers and iTaq Universal SYBR Green Supermix (BioRad) on a Bio-Rad CFX Opus 96 Real-Time PCR System.

    Incubation:

    Article Title: Salivary miRNAs along with p53 and EGFR in oral exfoliated cells: a pilot study on candidate noninvasive biomarkers for the early detection of oral cancer in tobacco users.
    Article Snippet: 1 Centre for Medical Biotechnology, Maharshi Dayanand University, Rohtak, Haryana 124001, India 2 Swami Shraddhanand College, University of Delhi, New Delhi 110036, India 3 Dept.. of Oral Pathology, Postgraduate Institute of Dental Sciences, Rohtak, Haryana 124001, India Abstract Background The low 5-year survival rate for Oral Squamous Cell Carcinoma (OSCC) is largely attributed to the limitations of current invasive diagnostic procedures and diagnosis at a late stage.. Biomarkers from saliva and exfoliated oral cells could be used to diagnose oral cancer as the malignancy begins in the epithelium and would be particularly useful for screening patients in high-risk categories like tobacco users.

    Synthesized:

    Article Title: PLOD1 Catalytic Activity Stabilizes ENO1 by Limiting FBXW7-dependent Degradation to Promote Glycolysis and TMZ Resistance in Glioblastoma.
    Article Snippet: .8 RNA Extraction and Quantitative Real-Time CR (qRT-PCR) otal RNA was extracted using the RNeasy Mini Kit (Qiagen, 74104). .. cDNA was synthesized using the iScript cDNA Synthesis it (Bio-Rad, #1708891). .. qRT-PCR was performed on a CFX96 eal-Time PCR Detection System (Bio-Rad) using iTaq Universal YBR Green Supermix (Bio-Rad, #1725121).

    Analysis:

    Article Title: Cyclic nucleotide signaling through phosphodiesterase 1 inhibition and its interaction with the competing endogenous RNA network regulates cognition.
    Article Snippet: Total RNA was extracted from the mouse brain with the RNeasy Mini Kit (Qiagen, Cat. No. 74104). .. Reverse transcription was conducted by iScript cDNA Synthesis Kit (Bio-Rad, Cat. No. 1708890) to generate cDNA for further mRNA and miRNA analysis. .. RT-qPCR was performed using custom primers and iTaq Universal SYBR Green Supermix (BioRad) on a Bio-Rad CFX Opus 96 Real-Time PCR System.

    Article Title: Aire is a cell-intrinsic regulator of natural IgM-secreting cells.
    Article Snippet: Flowjo 10 (Trees- tar) software was used for analysis. .. REAGENT or RESOURCE SOURCE IDENTIFIER iScript cDNA Synthesis BioRad Cat# 1708890 TaqMan Fast Advanced Master Mix Thermo Fisher Scientific Cat# 4444557 NEBNext Ultra II New England Biolabs Cat# E7103L OneStep Ahead RT- PCR kit Qiagen Cat# 220211 Deposited data Single cell RNA-seq analysis of mature thymic epithelial cells Sansom et al. GEO: GSE53111 Differential features of Aire-induced and Aire-independent promiscuous gene expression in thymic epithelial cells St. Pierre et al. GEO: GSE65617 RNA sequencing of Aire-reporter-positive CD138+IgM+ cells from Aire+/+ and Aire–/– Aire-HCO mice This paper GEO: GSE310317 Bulk immunoglobulin heavy-chain repertoire sequencing This paper GEO: GSE332886 Experimental models: Organisms/strains Mus musculus (BALB/c): Aire- HCOTG: Aire-HCO4 Aschenbrenner et al.81 N/A Mus musculus (C57BL/6): AdigTG: Tg(Aire-G6pc2/GFP)1Mand Gardner et al.18 N/A Mus musculus (C57BL/6): Tcra -/-: Tcratm1Mom Mombaerts et al.82 N/A Mus musculus (C57BL/6): Cd40-/-: B6.129P2-Cd40tm1Kik/J Kawabe et al.83 N/A Mus musculus (C57BL/6): Airef/f: B6.Cg-Airetm1Dfil/J Dobes et al.52 N/A Mus musculus(BALB/c): Ciita-/-: C.129S2(B6)-Ciitatm1Ccum/J Chang et al.84 N/A Mus musculus (C57BL/6): Mb1-Cre: Cd79atm1(cre)Reth Hobeika et al.53 N/A Mus musculus (C57BL/6): Foxn1-Cre: Tg(Foxn1-cre)8Ghr Rossi et al.54 N/A Mus musculus (C57BL/6); Aire-/-; B6.129S2-Airetm1.1Doi Anderson et al.2 N/A Mus musculus (BALB/c): Aire-/-: C.Cg-Airetm1Pltn Ramsey et al.3 N/A Software and algorithms FlowJo software 10.7.2 Tree Star https://www.flowjo.com GraphPad PRISM 7.0 Graphpad Software https://www.graphpad.com/ NDP.view2 Hamamatsu Photonics https://www.hamamatsu.com/ Image J National Institute of Health https://imagej.net/ LEGENDplex Data Analysis Software Suite BioLegend https://www.biolegend.com/ ll OPEN ACCESS Article e3 Immunity 59, 1–19.e1–e6, December 8, 2026 .. Total RNA was isolated using the RNeasy RNA Isolation Kit (Qiagen).

    SYBR Green Assay:

    Article Title: Macrophages modulate ovarian cancer progression by regulating epithelial-mesenchymal transition.
    Article Snippet: The isolated RNA was dissolved in nuclease-free water and quantified using a NanoDrop spectrophotometer (Implen). .. cDNA synthesis was carried out using the iScript cDNA Synthesis Kit (Bio-Rad, Cat. No. 1708890) according to the manufacturer’s instructions under the following cycling conditions: 25 ◦C for 5 min, 46 ◦C for 20 min, and 95 ◦C for 5 min. Quantitative PCR was performed using SYBR Green Supermix (Bio-Rad, Cat. No. 171–5121) on the QuantStudio 5 Real-Time PCR System. .. The expression levels of M1 and M2 markers (CD206, CD163, ARG1, iNOS and CD86) whereas EMT-related genes (E-cadherin, N-cadherin, Snail, Slug, MMP-2, Twist, Vimentin, and ZEB) were analysed, with GAPDH serving as the endogenous control.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Aire is a cell-intrinsic regulator of natural IgM-secreting cells.
    Article Snippet: Flowjo 10 (Trees- tar) software was used for analysis. .. REAGENT or RESOURCE SOURCE IDENTIFIER iScript cDNA Synthesis BioRad Cat# 1708890 TaqMan Fast Advanced Master Mix Thermo Fisher Scientific Cat# 4444557 NEBNext Ultra II New England Biolabs Cat# E7103L OneStep Ahead RT- PCR kit Qiagen Cat# 220211 Deposited data Single cell RNA-seq analysis of mature thymic epithelial cells Sansom et al. GEO: GSE53111 Differential features of Aire-induced and Aire-independent promiscuous gene expression in thymic epithelial cells St. Pierre et al. GEO: GSE65617 RNA sequencing of Aire-reporter-positive CD138+IgM+ cells from Aire+/+ and Aire–/– Aire-HCO mice This paper GEO: GSE310317 Bulk immunoglobulin heavy-chain repertoire sequencing This paper GEO: GSE332886 Experimental models: Organisms/strains Mus musculus (BALB/c): Aire- HCOTG: Aire-HCO4 Aschenbrenner et al.81 N/A Mus musculus (C57BL/6): AdigTG: Tg(Aire-G6pc2/GFP)1Mand Gardner et al.18 N/A Mus musculus (C57BL/6): Tcra -/-: Tcratm1Mom Mombaerts et al.82 N/A Mus musculus (C57BL/6): Cd40-/-: B6.129P2-Cd40tm1Kik/J Kawabe et al.83 N/A Mus musculus (C57BL/6): Airef/f: B6.Cg-Airetm1Dfil/J Dobes et al.52 N/A Mus musculus(BALB/c): Ciita-/-: C.129S2(B6)-Ciitatm1Ccum/J Chang et al.84 N/A Mus musculus (C57BL/6): Mb1-Cre: Cd79atm1(cre)Reth Hobeika et al.53 N/A Mus musculus (C57BL/6): Foxn1-Cre: Tg(Foxn1-cre)8Ghr Rossi et al.54 N/A Mus musculus (C57BL/6); Aire-/-; B6.129S2-Airetm1.1Doi Anderson et al.2 N/A Mus musculus (BALB/c): Aire-/-: C.Cg-Airetm1Pltn Ramsey et al.3 N/A Software and algorithms FlowJo software 10.7.2 Tree Star https://www.flowjo.com GraphPad PRISM 7.0 Graphpad Software https://www.graphpad.com/ NDP.view2 Hamamatsu Photonics https://www.hamamatsu.com/ Image J National Institute of Health https://imagej.net/ LEGENDplex Data Analysis Software Suite BioLegend https://www.biolegend.com/ ll OPEN ACCESS Article e3 Immunity 59, 1–19.e1–e6, December 8, 2026 .. Total RNA was isolated using the RNeasy RNA Isolation Kit (Qiagen).

    Single Cell RNA-Seq:

    Article Title: Aire is a cell-intrinsic regulator of natural IgM-secreting cells.
    Article Snippet: Flowjo 10 (Trees- tar) software was used for analysis. .. REAGENT or RESOURCE SOURCE IDENTIFIER iScript cDNA Synthesis BioRad Cat# 1708890 TaqMan Fast Advanced Master Mix Thermo Fisher Scientific Cat# 4444557 NEBNext Ultra II New England Biolabs Cat# E7103L OneStep Ahead RT- PCR kit Qiagen Cat# 220211 Deposited data Single cell RNA-seq analysis of mature thymic epithelial cells Sansom et al. GEO: GSE53111 Differential features of Aire-induced and Aire-independent promiscuous gene expression in thymic epithelial cells St. Pierre et al. GEO: GSE65617 RNA sequencing of Aire-reporter-positive CD138+IgM+ cells from Aire+/+ and Aire–/– Aire-HCO mice This paper GEO: GSE310317 Bulk immunoglobulin heavy-chain repertoire sequencing This paper GEO: GSE332886 Experimental models: Organisms/strains Mus musculus (BALB/c): Aire- HCOTG: Aire-HCO4 Aschenbrenner et al.81 N/A Mus musculus (C57BL/6): AdigTG: Tg(Aire-G6pc2/GFP)1Mand Gardner et al.18 N/A Mus musculus (C57BL/6): Tcra -/-: Tcratm1Mom Mombaerts et al.82 N/A Mus musculus (C57BL/6): Cd40-/-: B6.129P2-Cd40tm1Kik/J Kawabe et al.83 N/A Mus musculus (C57BL/6): Airef/f: B6.Cg-Airetm1Dfil/J Dobes et al.52 N/A Mus musculus(BALB/c): Ciita-/-: C.129S2(B6)-Ciitatm1Ccum/J Chang et al.84 N/A Mus musculus (C57BL/6): Mb1-Cre: Cd79atm1(cre)Reth Hobeika et al.53 N/A Mus musculus (C57BL/6): Foxn1-Cre: Tg(Foxn1-cre)8Ghr Rossi et al.54 N/A Mus musculus (C57BL/6); Aire-/-; B6.129S2-Airetm1.1Doi Anderson et al.2 N/A Mus musculus (BALB/c): Aire-/-: C.Cg-Airetm1Pltn Ramsey et al.3 N/A Software and algorithms FlowJo software 10.7.2 Tree Star https://www.flowjo.com GraphPad PRISM 7.0 Graphpad Software https://www.graphpad.com/ NDP.view2 Hamamatsu Photonics https://www.hamamatsu.com/ Image J National Institute of Health https://imagej.net/ LEGENDplex Data Analysis Software Suite BioLegend https://www.biolegend.com/ ll OPEN ACCESS Article e3 Immunity 59, 1–19.e1–e6, December 8, 2026 .. Total RNA was isolated using the RNeasy RNA Isolation Kit (Qiagen).

    Gene Expression:

    Article Title: Aire is a cell-intrinsic regulator of natural IgM-secreting cells.
    Article Snippet: Flowjo 10 (Trees- tar) software was used for analysis. .. REAGENT or RESOURCE SOURCE IDENTIFIER iScript cDNA Synthesis BioRad Cat# 1708890 TaqMan Fast Advanced Master Mix Thermo Fisher Scientific Cat# 4444557 NEBNext Ultra II New England Biolabs Cat# E7103L OneStep Ahead RT- PCR kit Qiagen Cat# 220211 Deposited data Single cell RNA-seq analysis of mature thymic epithelial cells Sansom et al. GEO: GSE53111 Differential features of Aire-induced and Aire-independent promiscuous gene expression in thymic epithelial cells St. Pierre et al. GEO: GSE65617 RNA sequencing of Aire-reporter-positive CD138+IgM+ cells from Aire+/+ and Aire–/– Aire-HCO mice This paper GEO: GSE310317 Bulk immunoglobulin heavy-chain repertoire sequencing This paper GEO: GSE332886 Experimental models: Organisms/strains Mus musculus (BALB/c): Aire- HCOTG: Aire-HCO4 Aschenbrenner et al.81 N/A Mus musculus (C57BL/6): AdigTG: Tg(Aire-G6pc2/GFP)1Mand Gardner et al.18 N/A Mus musculus (C57BL/6): Tcra -/-: Tcratm1Mom Mombaerts et al.82 N/A Mus musculus (C57BL/6): Cd40-/-: B6.129P2-Cd40tm1Kik/J Kawabe et al.83 N/A Mus musculus (C57BL/6): Airef/f: B6.Cg-Airetm1Dfil/J Dobes et al.52 N/A Mus musculus(BALB/c): Ciita-/-: C.129S2(B6)-Ciitatm1Ccum/J Chang et al.84 N/A Mus musculus (C57BL/6): Mb1-Cre: Cd79atm1(cre)Reth Hobeika et al.53 N/A Mus musculus (C57BL/6): Foxn1-Cre: Tg(Foxn1-cre)8Ghr Rossi et al.54 N/A Mus musculus (C57BL/6); Aire-/-; B6.129S2-Airetm1.1Doi Anderson et al.2 N/A Mus musculus (BALB/c): Aire-/-: C.Cg-Airetm1Pltn Ramsey et al.3 N/A Software and algorithms FlowJo software 10.7.2 Tree Star https://www.flowjo.com GraphPad PRISM 7.0 Graphpad Software https://www.graphpad.com/ NDP.view2 Hamamatsu Photonics https://www.hamamatsu.com/ Image J National Institute of Health https://imagej.net/ LEGENDplex Data Analysis Software Suite BioLegend https://www.biolegend.com/ ll OPEN ACCESS Article e3 Immunity 59, 1–19.e1–e6, December 8, 2026 .. Total RNA was isolated using the RNeasy RNA Isolation Kit (Qiagen).

    RNA Sequencing:

    Article Title: Aire is a cell-intrinsic regulator of natural IgM-secreting cells.
    Article Snippet: Flowjo 10 (Trees- tar) software was used for analysis. .. REAGENT or RESOURCE SOURCE IDENTIFIER iScript cDNA Synthesis BioRad Cat# 1708890 TaqMan Fast Advanced Master Mix Thermo Fisher Scientific Cat# 4444557 NEBNext Ultra II New England Biolabs Cat# E7103L OneStep Ahead RT- PCR kit Qiagen Cat# 220211 Deposited data Single cell RNA-seq analysis of mature thymic epithelial cells Sansom et al. GEO: GSE53111 Differential features of Aire-induced and Aire-independent promiscuous gene expression in thymic epithelial cells St. Pierre et al. GEO: GSE65617 RNA sequencing of Aire-reporter-positive CD138+IgM+ cells from Aire+/+ and Aire–/– Aire-HCO mice This paper GEO: GSE310317 Bulk immunoglobulin heavy-chain repertoire sequencing This paper GEO: GSE332886 Experimental models: Organisms/strains Mus musculus (BALB/c): Aire- HCOTG: Aire-HCO4 Aschenbrenner et al.81 N/A Mus musculus (C57BL/6): AdigTG: Tg(Aire-G6pc2/GFP)1Mand Gardner et al.18 N/A Mus musculus (C57BL/6): Tcra -/-: Tcratm1Mom Mombaerts et al.82 N/A Mus musculus (C57BL/6): Cd40-/-: B6.129P2-Cd40tm1Kik/J Kawabe et al.83 N/A Mus musculus (C57BL/6): Airef/f: B6.Cg-Airetm1Dfil/J Dobes et al.52 N/A Mus musculus(BALB/c): Ciita-/-: C.129S2(B6)-Ciitatm1Ccum/J Chang et al.84 N/A Mus musculus (C57BL/6): Mb1-Cre: Cd79atm1(cre)Reth Hobeika et al.53 N/A Mus musculus (C57BL/6): Foxn1-Cre: Tg(Foxn1-cre)8Ghr Rossi et al.54 N/A Mus musculus (C57BL/6); Aire-/-; B6.129S2-Airetm1.1Doi Anderson et al.2 N/A Mus musculus (BALB/c): Aire-/-: C.Cg-Airetm1Pltn Ramsey et al.3 N/A Software and algorithms FlowJo software 10.7.2 Tree Star https://www.flowjo.com GraphPad PRISM 7.0 Graphpad Software https://www.graphpad.com/ NDP.view2 Hamamatsu Photonics https://www.hamamatsu.com/ Image J National Institute of Health https://imagej.net/ LEGENDplex Data Analysis Software Suite BioLegend https://www.biolegend.com/ ll OPEN ACCESS Article e3 Immunity 59, 1–19.e1–e6, December 8, 2026 .. Total RNA was isolated using the RNeasy RNA Isolation Kit (Qiagen).

    Sequencing:

    Article Title: Aire is a cell-intrinsic regulator of natural IgM-secreting cells.
    Article Snippet: Flowjo 10 (Trees- tar) software was used for analysis. .. REAGENT or RESOURCE SOURCE IDENTIFIER iScript cDNA Synthesis BioRad Cat# 1708890 TaqMan Fast Advanced Master Mix Thermo Fisher Scientific Cat# 4444557 NEBNext Ultra II New England Biolabs Cat# E7103L OneStep Ahead RT- PCR kit Qiagen Cat# 220211 Deposited data Single cell RNA-seq analysis of mature thymic epithelial cells Sansom et al. GEO: GSE53111 Differential features of Aire-induced and Aire-independent promiscuous gene expression in thymic epithelial cells St. Pierre et al. GEO: GSE65617 RNA sequencing of Aire-reporter-positive CD138+IgM+ cells from Aire+/+ and Aire–/– Aire-HCO mice This paper GEO: GSE310317 Bulk immunoglobulin heavy-chain repertoire sequencing This paper GEO: GSE332886 Experimental models: Organisms/strains Mus musculus (BALB/c): Aire- HCOTG: Aire-HCO4 Aschenbrenner et al.81 N/A Mus musculus (C57BL/6): AdigTG: Tg(Aire-G6pc2/GFP)1Mand Gardner et al.18 N/A Mus musculus (C57BL/6): Tcra -/-: Tcratm1Mom Mombaerts et al.82 N/A Mus musculus (C57BL/6): Cd40-/-: B6.129P2-Cd40tm1Kik/J Kawabe et al.83 N/A Mus musculus (C57BL/6): Airef/f: B6.Cg-Airetm1Dfil/J Dobes et al.52 N/A Mus musculus(BALB/c): Ciita-/-: C.129S2(B6)-Ciitatm1Ccum/J Chang et al.84 N/A Mus musculus (C57BL/6): Mb1-Cre: Cd79atm1(cre)Reth Hobeika et al.53 N/A Mus musculus (C57BL/6): Foxn1-Cre: Tg(Foxn1-cre)8Ghr Rossi et al.54 N/A Mus musculus (C57BL/6); Aire-/-; B6.129S2-Airetm1.1Doi Anderson et al.2 N/A Mus musculus (BALB/c): Aire-/-: C.Cg-Airetm1Pltn Ramsey et al.3 N/A Software and algorithms FlowJo software 10.7.2 Tree Star https://www.flowjo.com GraphPad PRISM 7.0 Graphpad Software https://www.graphpad.com/ NDP.view2 Hamamatsu Photonics https://www.hamamatsu.com/ Image J National Institute of Health https://imagej.net/ LEGENDplex Data Analysis Software Suite BioLegend https://www.biolegend.com/ ll OPEN ACCESS Article e3 Immunity 59, 1–19.e1–e6, December 8, 2026 .. Total RNA was isolated using the RNeasy RNA Isolation Kit (Qiagen).

    Software:

    Article Title: Aire is a cell-intrinsic regulator of natural IgM-secreting cells.
    Article Snippet: Flowjo 10 (Trees- tar) software was used for analysis. .. REAGENT or RESOURCE SOURCE IDENTIFIER iScript cDNA Synthesis BioRad Cat# 1708890 TaqMan Fast Advanced Master Mix Thermo Fisher Scientific Cat# 4444557 NEBNext Ultra II New England Biolabs Cat# E7103L OneStep Ahead RT- PCR kit Qiagen Cat# 220211 Deposited data Single cell RNA-seq analysis of mature thymic epithelial cells Sansom et al. GEO: GSE53111 Differential features of Aire-induced and Aire-independent promiscuous gene expression in thymic epithelial cells St. Pierre et al. GEO: GSE65617 RNA sequencing of Aire-reporter-positive CD138+IgM+ cells from Aire+/+ and Aire–/– Aire-HCO mice This paper GEO: GSE310317 Bulk immunoglobulin heavy-chain repertoire sequencing This paper GEO: GSE332886 Experimental models: Organisms/strains Mus musculus (BALB/c): Aire- HCOTG: Aire-HCO4 Aschenbrenner et al.81 N/A Mus musculus (C57BL/6): AdigTG: Tg(Aire-G6pc2/GFP)1Mand Gardner et al.18 N/A Mus musculus (C57BL/6): Tcra -/-: Tcratm1Mom Mombaerts et al.82 N/A Mus musculus (C57BL/6): Cd40-/-: B6.129P2-Cd40tm1Kik/J Kawabe et al.83 N/A Mus musculus (C57BL/6): Airef/f: B6.Cg-Airetm1Dfil/J Dobes et al.52 N/A Mus musculus(BALB/c): Ciita-/-: C.129S2(B6)-Ciitatm1Ccum/J Chang et al.84 N/A Mus musculus (C57BL/6): Mb1-Cre: Cd79atm1(cre)Reth Hobeika et al.53 N/A Mus musculus (C57BL/6): Foxn1-Cre: Tg(Foxn1-cre)8Ghr Rossi et al.54 N/A Mus musculus (C57BL/6); Aire-/-; B6.129S2-Airetm1.1Doi Anderson et al.2 N/A Mus musculus (BALB/c): Aire-/-: C.Cg-Airetm1Pltn Ramsey et al.3 N/A Software and algorithms FlowJo software 10.7.2 Tree Star https://www.flowjo.com GraphPad PRISM 7.0 Graphpad Software https://www.graphpad.com/ NDP.view2 Hamamatsu Photonics https://www.hamamatsu.com/ Image J National Institute of Health https://imagej.net/ LEGENDplex Data Analysis Software Suite BioLegend https://www.biolegend.com/ ll OPEN ACCESS Article e3 Immunity 59, 1–19.e1–e6, December 8, 2026 .. Total RNA was isolated using the RNeasy RNA Isolation Kit (Qiagen).



    Similar Products

    resource source identifier antibodies rabbit polyclonal anti vwa2 proteintech  (Proteintech)
    93
    Proteintech resource source identifier antibodies rabbit polyclonal anti vwa2 proteintech
    Resource Source Identifier Antibodies Rabbit Polyclonal Anti Vwa2 Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/source/VWA2+Antibody/pm42835275-143-2-9
    Average 93 stars, based on 1 article reviews
    resource source identifier antibodies rabbit polyclonal anti vwa2 proteintech - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    resource source identifier antibodies anti pc1 santa cruz biotechnology  (Santa Cruz Biotechnology)
    93
    Santa Cruz Biotechnology resource source identifier antibodies anti pc1 santa cruz biotechnology
    Resource Source Identifier Antibodies Anti Pc1 Santa Cruz Biotechnology, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/source/Polycystin-1+Antibody/pm42834985-1062-2-7
    Average 93 stars, based on 1 article reviews
    resource source identifier antibodies anti pc1 santa cruz biotechnology - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    resource source identifier antibodies mouse monoclonal anti asc santa cruz  (Santa Cruz Biotechnology)
    96
    Santa Cruz Biotechnology resource source identifier antibodies mouse monoclonal anti asc santa cruz
    Resource Source Identifier Antibodies Mouse Monoclonal Anti Asc Santa Cruz, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/source/ASC+Antibody/10__1016_slash_j__isci__2026__117743-137-5-12
    Average 96 stars, based on 1 article reviews
    resource source identifier antibodies mouse monoclonal anti asc santa cruz - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    resource source identifier antibodies anti hsf1 santa cruz biotechnology  (Santa Cruz Biotechnology)
    94
    Santa Cruz Biotechnology resource source identifier antibodies anti hsf1 santa cruz biotechnology
    Resource Source Identifier Antibodies Anti Hsf1 Santa Cruz Biotechnology, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/source/HSF1+Antibody/pm42831021-386-2-7
    Average 94 stars, based on 1 article reviews
    resource source identifier antibodies anti hsf1 santa cruz biotechnology - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    electrospray ionization esi ion source  (Shimadzu Corporation)
    97
    Shimadzu Corporation electrospray ionization esi ion source
    Electrospray Ionization Esi Ion Source, supplied by Shimadzu Corporation, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/source/LCMS-8045/pm42827133-461-9-15
    Average 97 stars, based on 1 article reviews
    electrospray ionization esi ion source - by Bioz Stars, 2026-10
    97/100 stars
    		  Buy from Supplier
    resource source identifier antibodies anti β actin antibody santa cruz biotechnology rrid ab 626632  (Santa Cruz Biotechnology)
    96
    Santa Cruz Biotechnology resource source identifier antibodies anti β actin antibody santa cruz biotechnology rrid ab 626632
    Resource Source Identifier Antibodies Anti β Actin Antibody Santa Cruz Biotechnology Rrid Ab 626632, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/source/%CE%B2-Actin+Antibody/pm42822446-294-2-8
    Average 96 stars, based on 1 article reviews
    resource source identifier antibodies anti β actin antibody santa cruz biotechnology rrid ab 626632 - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    resource source identifier antibodies neun medchemexpress  (MedChemExpress)
    94
    MedChemExpress resource source identifier antibodies neun medchemexpress
    Resource Source Identifier Antibodies Neun Medchemexpress, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/source/NeuN+Antibody/pm42546689-266-2-7
    Average 94 stars, based on 1 article reviews
    resource source identifier antibodies neun medchemexpress - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    resource source identifier iscript cdna synthesis biorad  (Bio-Rad)
    99
    Bio-Rad resource source identifier iscript cdna synthesis biorad
    Resource Source Identifier Iscript Cdna Synthesis Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/source/IScript+C+DNA+Synthesis+Kit/pm42815461-276-2-8
    Average 99 stars, based on 1 article reviews
    resource source identifier iscript cdna synthesis biorad - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    rt qpcr primer sequence source ctrr3 for cggcctctccttctgtatgc  (OriGene)
    97
    OriGene rt qpcr primer sequence source ctrr3 for cggcctctccttctgtatgc
    Rt Qpcr Primer Sequence Source Ctrr3 For Cggcctctccttctgtatgc, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/source/Primer/pm42816552-656-14-34
    Average 97 stars, based on 1 article reviews
    rt qpcr primer sequence source ctrr3 for cggcctctccttctgtatgc - by Bioz Stars, 2026-10
    97/100 stars
    		  Buy from Supplier
    micro focus genix 3d x ray source  (Xenocs Inc)
    97
    Xenocs Inc micro focus genix 3d x ray source
    Micro Focus Genix 3d X Ray Source, supplied by Xenocs Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/source/GeniX3D/10__3390_slash_batteries12100385-93-6-7
    Average 97 stars, based on 1 article reviews
    micro focus genix 3d x ray source - by Bioz Stars, 2026-10
    97/100 stars
    		  Buy from Supplier

    Image Search Results