amaxa basic nucleofector kit (Amaxa)
86
Structured Review
Amaxa
amaxa basic nucleofector kit
Amaxa Basic Nucleofector Kit, supplied by Amaxa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/basic+nucleofector+kit/basic+kit+nucleofector/pmc13266002-306-14-14
Average 86 stars, based on 1 article reviews
Amaxa Basic Nucleofector Kit, supplied by Amaxa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/basic+nucleofector+kit/basic+kit+nucleofector/pmc13266002-306-14-14
Average 86 stars, based on 1 article reviews
amaxa basic nucleofector kit - by Bioz Stars,
2026-09
86/100 stars
Images
Related Articles
Transfection:Article Title: The Dual Role of the 16mer Motif Within the 3' Untranslated Region of the Variant Surface Glycoprotein of Trypanosoma brucei. Article Snippet: Cell numbers were monitored by counting with a haemocytometer or Z2 Coulter counter (Beckman Coulter). .. For transfections to generate transgenic cell lines, 3 × 107 T. brucei 13–90 cells were electroporated with 10 μg of linearised plasmid DNA using the Amaxa Article Title: The Dual Role of the 16mer Motif Within the 3′ Untranslated Region of the Variant Surface Glycoprotein of Trypanosoma brucei Article Snippet: Cell numbers were monitored by counting with a haemocytometer or Z2 Coulter counter (Beckman Coulter). .. For transfections to generate transgenic cell lines, 3 × 10 7 T. brucei 13–90 cells were electroporated with 10 μg of linearised plasmid DNA using the Amaxa Article Title: Identification of serine/arginine-rich splicing factor 1-interacting proteins in Plasmodium berghei Article Snippet: .. Transfection was performed using an Amaxa Article Title: Identification of serine/arginine-rich splicing factor 1-interacting proteins in Plasmodium berghei. Article Snippet: .. Transfection was performed using an Amaxa Article Title: PIWIL4 regulates gene expression and piRNA levels in RSV-infected airway epithelial cells Article Snippet: .. The siRNAs were transfected by electroporation using the Amaxa Biosystem, Gaithersburg, MD, and the Transgenic Assay:Article Title: The Dual Role of the 16mer Motif Within the 3' Untranslated Region of the Variant Surface Glycoprotein of Trypanosoma brucei. Article Snippet: Cell numbers were monitored by counting with a haemocytometer or Z2 Coulter counter (Beckman Coulter). .. For transfections to generate transgenic cell lines, 3 × 107 T. brucei 13–90 cells were electroporated with 10 μg of linearised plasmid DNA using the Amaxa Article Title: The Dual Role of the 16mer Motif Within the 3′ Untranslated Region of the Variant Surface Glycoprotein of Trypanosoma brucei Article Snippet: Cell numbers were monitored by counting with a haemocytometer or Z2 Coulter counter (Beckman Coulter). .. For transfections to generate transgenic cell lines, 3 × 10 7 T. brucei 13–90 cells were electroporated with 10 μg of linearised plasmid DNA using the Amaxa Plasmid Preparation:Article Title: The Dual Role of the 16mer Motif Within the 3' Untranslated Region of the Variant Surface Glycoprotein of Trypanosoma brucei. Article Snippet: Cell numbers were monitored by counting with a haemocytometer or Z2 Coulter counter (Beckman Coulter). .. For transfections to generate transgenic cell lines, 3 × 107 T. brucei 13–90 cells were electroporated with 10 μg of linearised plasmid DNA using the Amaxa Article Title: The Dual Role of the 16mer Motif Within the 3′ Untranslated Region of the Variant Surface Glycoprotein of Trypanosoma brucei Article Snippet: Cell numbers were monitored by counting with a haemocytometer or Z2 Coulter counter (Beckman Coulter). .. For transfections to generate transgenic cell lines, 3 × 10 7 T. brucei 13–90 cells were electroporated with 10 μg of linearised plasmid DNA using the Amaxa Article Title: Signaling and self-organization in human pluripotent stem cell-based early embryonic models Article Snippet: The previously published guide RNA sequence used to target CDH1 (GCAGTTCCGACGCCACTGAG) was cloned into the gRNA expression vector (addgene plasmid # 73501) using a BsmBI restriction enzyme cloning strategy described in Mandegar et al. .. The guide RNA vector was then electroporated into the parent line containing the 41 CRISPRi system using the Electroporation:Article Title: PIWIL4 regulates gene expression and piRNA levels in RSV-infected airway epithelial cells Article Snippet: .. The siRNAs were transfected by electroporation using the Amaxa Biosystem, Gaithersburg, MD, and the |