Review




Structured Review

Amaxa basic parasite nucleofector kit
Basic Parasite Nucleofector Kit, supplied by Amaxa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/basic+nucleofector+kit/basic+kit+nucleofector/pm41634752-59-6-10
Average 86 stars, based on 1 article reviews
basic parasite nucleofector kit - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

Transfection:

Article Title: The Dual Role of the 16mer Motif Within the 3' Untranslated Region of the Variant Surface Glycoprotein of Trypanosoma brucei.
Article Snippet: Cell numbers were monitored by counting with a haemocytometer or Z2 Coulter counter (Beckman Coulter). .. For transfections to generate transgenic cell lines, 3 × 107 T. brucei 13–90 cells were electroporated with 10 μg of linearised plasmid DNA using the Amaxa Basic Parasite Nucleofector Kit 1 and Nucleofector II device (programme X001) (Lonza, Switzerland). ..

Article Title: The Dual Role of the 16mer Motif Within the 3′ Untranslated Region of the Variant Surface Glycoprotein of Trypanosoma brucei
Article Snippet: Cell numbers were monitored by counting with a haemocytometer or Z2 Coulter counter (Beckman Coulter). .. For transfections to generate transgenic cell lines, 3 × 10 7 T. brucei 13–90 cells were electroporated with 10 μg of linearised plasmid DNA using the Amaxa Basic Parasite Nucleofector Kit 1 and Nucleofector II device (programme X‐001) (Lonza, Switzerland). ..

Article Title: Identification of serine/arginine-rich splicing factor 1-interacting proteins in Plasmodium berghei
Article Snippet: .. Transfection was performed using an Amaxa Basic Parasite Nucleofector Kit (Amaxa GmbH, Cologne, Germany) according to the manufacturer’s protocol as described previously [ , ]. .. Genomic DNA of malaria parasites was extracted from peripheral blood of mice infected with malaria parasites using QIAamp DNA mini kit (Qiagen, Hilden, Germany).

Article Title: Identification of serine/arginine-rich splicing factor 1-interacting proteins in Plasmodium berghei.
Article Snippet: .. Transfection was performed using an Amaxa Basic Parasite Nucleofector Kit (Amaxa GmbH, Cologne, Germany) according to the manufacturer’s protocol as described previously [13, 14]. .. Genomic DNA of malaria parasites was extracted from peripheral blood of mice infected with malaria parasites using QIAamp DNA mini kit (Qiagen, Hilden, Germany).

Article Title: PIWIL4 regulates gene expression and piRNA levels in RSV-infected airway epithelial cells
Article Snippet: .. The siRNAs were transfected by electroporation using the Amaxa Biosystem, Gaithersburg, MD, and the Amaxa Basic Nucleofector Kit (Cat # VPI-1005) for iSAE cells, according to manufacturer instructions, to allow high transfection efficiency. ..

Transgenic Assay:

Article Title: The Dual Role of the 16mer Motif Within the 3' Untranslated Region of the Variant Surface Glycoprotein of Trypanosoma brucei.
Article Snippet: Cell numbers were monitored by counting with a haemocytometer or Z2 Coulter counter (Beckman Coulter). .. For transfections to generate transgenic cell lines, 3 × 107 T. brucei 13–90 cells were electroporated with 10 μg of linearised plasmid DNA using the Amaxa Basic Parasite Nucleofector Kit 1 and Nucleofector II device (programme X001) (Lonza, Switzerland). ..

Article Title: The Dual Role of the 16mer Motif Within the 3′ Untranslated Region of the Variant Surface Glycoprotein of Trypanosoma brucei
Article Snippet: Cell numbers were monitored by counting with a haemocytometer or Z2 Coulter counter (Beckman Coulter). .. For transfections to generate transgenic cell lines, 3 × 10 7 T. brucei 13–90 cells were electroporated with 10 μg of linearised plasmid DNA using the Amaxa Basic Parasite Nucleofector Kit 1 and Nucleofector II device (programme X‐001) (Lonza, Switzerland). ..

Plasmid Preparation:

Article Title: The Dual Role of the 16mer Motif Within the 3' Untranslated Region of the Variant Surface Glycoprotein of Trypanosoma brucei.
Article Snippet: Cell numbers were monitored by counting with a haemocytometer or Z2 Coulter counter (Beckman Coulter). .. For transfections to generate transgenic cell lines, 3 × 107 T. brucei 13–90 cells were electroporated with 10 μg of linearised plasmid DNA using the Amaxa Basic Parasite Nucleofector Kit 1 and Nucleofector II device (programme X001) (Lonza, Switzerland). ..

Article Title: The Dual Role of the 16mer Motif Within the 3′ Untranslated Region of the Variant Surface Glycoprotein of Trypanosoma brucei
Article Snippet: Cell numbers were monitored by counting with a haemocytometer or Z2 Coulter counter (Beckman Coulter). .. For transfections to generate transgenic cell lines, 3 × 10 7 T. brucei 13–90 cells were electroporated with 10 μg of linearised plasmid DNA using the Amaxa Basic Parasite Nucleofector Kit 1 and Nucleofector II device (programme X‐001) (Lonza, Switzerland). ..

Article Title: Signaling and self-organization in human pluripotent stem cell-based early embryonic models
Article Snippet: The previously published guide RNA sequence used to target CDH1 (GCAGTTCCGACGCCACTGAG) was cloned into the gRNA expression vector (addgene plasmid # 73501) using a BsmBI restriction enzyme cloning strategy described in Mandegar et al. .. The guide RNA vector was then electroporated into the parent line containing the 41 CRISPRi system using the Human Stem Cell Nucleofector Kit 1 solution with the Amaxa nucleofector 2b device (Lonza). .. Nucleofected cells were then seeded into a 6-well plate in mTeSRTM-1 supplemented with Y-27632 (10 μM) and underwent blasticidin (ThermoFisher Scientific; 10 μg/ml) selection for 6 days.

Electroporation:

Article Title: PIWIL4 regulates gene expression and piRNA levels in RSV-infected airway epithelial cells
Article Snippet: .. The siRNAs were transfected by electroporation using the Amaxa Biosystem, Gaithersburg, MD, and the Amaxa Basic Nucleofector Kit (Cat # VPI-1005) for iSAE cells, according to manufacturer instructions, to allow high transfection efficiency. ..



Similar Products

86
Amaxa amaxa basic nucleofector kit
Amaxa Basic Nucleofector Kit, supplied by Amaxa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/basic+nucleofector+kit/basic+kit+nucleofector/pmc13266002-306-14-14
Average 86 stars, based on 1 article reviews
amaxa basic nucleofector kit - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Amaxa basic parasite nucleofector kit
Basic Parasite Nucleofector Kit, supplied by Amaxa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/basic+nucleofector+kit/basic+kit+nucleofector/pm41634752-59-6-10
Average 86 stars, based on 1 article reviews
basic parasite nucleofector kit - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Amaxa basic parasite nucleofector kit 1
Basic Parasite Nucleofector Kit 1, supplied by Amaxa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/basic+nucleofector+kit/basic+kit+nucleofector/pm41247779-241-26-25
Average 86 stars, based on 1 article reviews
basic parasite nucleofector kit 1 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
Lonza basic nucleofector kit
Basic Nucleofector Kit, supplied by Lonza, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/basic+nucleofector+kit/4d+nucleofector/pm40663632-107-32-35
Average 90 stars, based on 1 article reviews
basic nucleofector kit - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Lonza basic nucleofector kit for primary mammalian fibroblasts
Basic Nucleofector Kit For Primary Mammalian Fibroblasts, supplied by Lonza, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/basic+nucleofector+kit/4d+nucleofector/10__1096_slash_fj__202500506r-67-15-17
Average 90 stars, based on 1 article reviews
basic nucleofector kit for primary mammalian fibroblasts - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Amaxa basic nucleofector kit for primary mammalian endothelial cells
Basic Nucleofector Kit For Primary Mammalian Endothelial Cells, supplied by Amaxa, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/basic+nucleofector+kit/basic+nucleofector+kit+for+primary+mammalian+endothelial+cells/pmc12255523-88-0-9
Average 90 stars, based on 1 article reviews
basic nucleofector kit for primary mammalian endothelial cells - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Lonza basic primary neurons nucleofector kit
Basic Primary Neurons Nucleofector Kit, supplied by Lonza, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/basic+nucleofector+kit/basic+primary+neurons+nucleofector+kit/pmc12148636-43-7-12
Average 90 stars, based on 1 article reviews
basic primary neurons nucleofector kit - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results