Review



syvn  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC syvn
    Syvn, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 10998 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syvn/K-562/pm41014566-33-322-313
    Average 99 stars, based on 10998 article reviews
    syvn - by Bioz Stars, 2026-10
    99/100 stars

    Images

    Related Articles

    Virus:

    Article Title: Protocol for simplified parallel perturbations using an abridged long non-coding RNA CRISPR library.
    Article Snippet: Antibodies HA-Tag (C29F4) rabbit monoclonal (1:1,000) Cell Signaling Technology Cat # 3724 Bacterial and virus strains E. coli Stellar chemically competent cells Takara Bio Cat # 636763 MegaX DH10B T1R Electrocomp cells Thermo Fisher Scientific Cat # C640003 Chemicals, peptides, and recombinant proteins PolyJet in vitro DNA transfection reagent SignaGen Cat # SL100688 Polybrene infection/transfection reagent Sigma-Aldrich Cat # TR-1003-G RPMI-1640 Biowest Cat # L0490-500 Phosphate-buffered saline (PBS) Sigma-Aldrich Cat # D1408-500ML Dulbecco’s modified Eagle’s medium (DMEM) Sigma-Aldrich Cat # D5796-500ML Trypsin Sigma-Aldrich Cat # T4049-500ML Fetal bovine serum (FBS) Sigma-Aldrich Cat # F9665-500ML L-glutamine Biowest Cat # X0550-100 Penicillin-streptomycin Biowest Cat # L0022-100 NEBNext Ultra II Q5 master mix NEB Cat # M0544X FastDigest Bpu1102I Thermo Fisher Scientific Cat # FD0094 FastDigest BstXI Thermo Fisher Scientific Cat # FD1024 FastDigest Esp3I Thermo Fisher Scientific Cat # FD0454 FastDigest SgsI Thermo Fisher Scientific Cat # FD1894 FastAP thermosensitive alkaline phosphatase Thermo Fisher Scientific Cat # EF0651 Phusion high-fidelity DNA polymerase NEB Cat # M0530L Q5 high-fidelity 23 master mix NEB Cat # M0492L NEBuilder HiFI DNA assembly master mix NEB Cat # E2621L RNase-free microfuge tubes (low-binding, 0.5 mL) Thermo Fisher Scientific Cat # AM12350 RNase-free microfuge tubes (low-binding, 1.5 mL) Thermo Fisher Scientific Cat # AM12450 18-gauge syringe needle Merck Cat # Z102717 Corning Costar Spin-X centrifuge tube filters Merck Cat # CLS8162 GlycoBlue coprecipitant Thermo Fisher Scientific Cat # AM9516 T4 DNA ligase NEB Cat # M0202T Carbenicillin (100 mg/mL) Merck Cat # C1613 Lenti-X concentrator Takara Bio Cat # 631231 Millex-HV filter unit (0.45 μm) Merck Cat # SLHV033RS Puromycin (10 mg/mL solution) InvivoGen Cat # ant-pr-1 Critical commercial assays NucleoSpin gel and PCR cleanup kit Macherey-Nagel Cat # 740609 MinElute reaction cleanup kit QIAGEN Cat # 28204 NucleoSpin plasmid EasyPure mini kit Macherey-Nagel Cat # 740727 NucleoBond Xtra Midi kit Macherey-Nagel Cat # 740410 Experimental models: Cell lines K562 ATCC CCL-243 HEK293T ATCC CRL-3216 Oligonucleotides sgRNA sequence #1 – SYVN1: GGCGCTGGGTTCCTGGTGAGT Weissman Lab12 NA (Continued on next page) 2 STAR Protocols 6, 104110, December 19, 2025 STEP-BY-STEP METHOD DETAILS Designing the dual sgRNA library Timing: 1 day Here we describe the process of designing a dual sgRNA focused library targeting predicted functional lncRNAs in K562.

    Recombinant:

    Article Title: Protocol for simplified parallel perturbations using an abridged long non-coding RNA CRISPR library.
    Article Snippet: Antibodies HA-Tag (C29F4) rabbit monoclonal (1:1,000) Cell Signaling Technology Cat # 3724 Bacterial and virus strains E. coli Stellar chemically competent cells Takara Bio Cat # 636763 MegaX DH10B T1R Electrocomp cells Thermo Fisher Scientific Cat # C640003 Chemicals, peptides, and recombinant proteins PolyJet in vitro DNA transfection reagent SignaGen Cat # SL100688 Polybrene infection/transfection reagent Sigma-Aldrich Cat # TR-1003-G RPMI-1640 Biowest Cat # L0490-500 Phosphate-buffered saline (PBS) Sigma-Aldrich Cat # D1408-500ML Dulbecco’s modified Eagle’s medium (DMEM) Sigma-Aldrich Cat # D5796-500ML Trypsin Sigma-Aldrich Cat # T4049-500ML Fetal bovine serum (FBS) Sigma-Aldrich Cat # F9665-500ML L-glutamine Biowest Cat # X0550-100 Penicillin-streptomycin Biowest Cat # L0022-100 NEBNext Ultra II Q5 master mix NEB Cat # M0544X FastDigest Bpu1102I Thermo Fisher Scientific Cat # FD0094 FastDigest BstXI Thermo Fisher Scientific Cat # FD1024 FastDigest Esp3I Thermo Fisher Scientific Cat # FD0454 FastDigest SgsI Thermo Fisher Scientific Cat # FD1894 FastAP thermosensitive alkaline phosphatase Thermo Fisher Scientific Cat # EF0651 Phusion high-fidelity DNA polymerase NEB Cat # M0530L Q5 high-fidelity 23 master mix NEB Cat # M0492L NEBuilder HiFI DNA assembly master mix NEB Cat # E2621L RNase-free microfuge tubes (low-binding, 0.5 mL) Thermo Fisher Scientific Cat # AM12350 RNase-free microfuge tubes (low-binding, 1.5 mL) Thermo Fisher Scientific Cat # AM12450 18-gauge syringe needle Merck Cat # Z102717 Corning Costar Spin-X centrifuge tube filters Merck Cat # CLS8162 GlycoBlue coprecipitant Thermo Fisher Scientific Cat # AM9516 T4 DNA ligase NEB Cat # M0202T Carbenicillin (100 mg/mL) Merck Cat # C1613 Lenti-X concentrator Takara Bio Cat # 631231 Millex-HV filter unit (0.45 μm) Merck Cat # SLHV033RS Puromycin (10 mg/mL solution) InvivoGen Cat # ant-pr-1 Critical commercial assays NucleoSpin gel and PCR cleanup kit Macherey-Nagel Cat # 740609 MinElute reaction cleanup kit QIAGEN Cat # 28204 NucleoSpin plasmid EasyPure mini kit Macherey-Nagel Cat # 740727 NucleoBond Xtra Midi kit Macherey-Nagel Cat # 740410 Experimental models: Cell lines K562 ATCC CCL-243 HEK293T ATCC CRL-3216 Oligonucleotides sgRNA sequence #1 – SYVN1: GGCGCTGGGTTCCTGGTGAGT Weissman Lab12 NA (Continued on next page) 2 STAR Protocols 6, 104110, December 19, 2025 STEP-BY-STEP METHOD DETAILS Designing the dual sgRNA library Timing: 1 day Here we describe the process of designing a dual sgRNA focused library targeting predicted functional lncRNAs in K562.

    In Vitro:

    Article Title: Protocol for simplified parallel perturbations using an abridged long non-coding RNA CRISPR library.
    Article Snippet: Antibodies HA-Tag (C29F4) rabbit monoclonal (1:1,000) Cell Signaling Technology Cat # 3724 Bacterial and virus strains E. coli Stellar chemically competent cells Takara Bio Cat # 636763 MegaX DH10B T1R Electrocomp cells Thermo Fisher Scientific Cat # C640003 Chemicals, peptides, and recombinant proteins PolyJet in vitro DNA transfection reagent SignaGen Cat # SL100688 Polybrene infection/transfection reagent Sigma-Aldrich Cat # TR-1003-G RPMI-1640 Biowest Cat # L0490-500 Phosphate-buffered saline (PBS) Sigma-Aldrich Cat # D1408-500ML Dulbecco’s modified Eagle’s medium (DMEM) Sigma-Aldrich Cat # D5796-500ML Trypsin Sigma-Aldrich Cat # T4049-500ML Fetal bovine serum (FBS) Sigma-Aldrich Cat # F9665-500ML L-glutamine Biowest Cat # X0550-100 Penicillin-streptomycin Biowest Cat # L0022-100 NEBNext Ultra II Q5 master mix NEB Cat # M0544X FastDigest Bpu1102I Thermo Fisher Scientific Cat # FD0094 FastDigest BstXI Thermo Fisher Scientific Cat # FD1024 FastDigest Esp3I Thermo Fisher Scientific Cat # FD0454 FastDigest SgsI Thermo Fisher Scientific Cat # FD1894 FastAP thermosensitive alkaline phosphatase Thermo Fisher Scientific Cat # EF0651 Phusion high-fidelity DNA polymerase NEB Cat # M0530L Q5 high-fidelity 23 master mix NEB Cat # M0492L NEBuilder HiFI DNA assembly master mix NEB Cat # E2621L RNase-free microfuge tubes (low-binding, 0.5 mL) Thermo Fisher Scientific Cat # AM12350 RNase-free microfuge tubes (low-binding, 1.5 mL) Thermo Fisher Scientific Cat # AM12450 18-gauge syringe needle Merck Cat # Z102717 Corning Costar Spin-X centrifuge tube filters Merck Cat # CLS8162 GlycoBlue coprecipitant Thermo Fisher Scientific Cat # AM9516 T4 DNA ligase NEB Cat # M0202T Carbenicillin (100 mg/mL) Merck Cat # C1613 Lenti-X concentrator Takara Bio Cat # 631231 Millex-HV filter unit (0.45 μm) Merck Cat # SLHV033RS Puromycin (10 mg/mL solution) InvivoGen Cat # ant-pr-1 Critical commercial assays NucleoSpin gel and PCR cleanup kit Macherey-Nagel Cat # 740609 MinElute reaction cleanup kit QIAGEN Cat # 28204 NucleoSpin plasmid EasyPure mini kit Macherey-Nagel Cat # 740727 NucleoBond Xtra Midi kit Macherey-Nagel Cat # 740410 Experimental models: Cell lines K562 ATCC CCL-243 HEK293T ATCC CRL-3216 Oligonucleotides sgRNA sequence #1 – SYVN1: GGCGCTGGGTTCCTGGTGAGT Weissman Lab12 NA (Continued on next page) 2 STAR Protocols 6, 104110, December 19, 2025 STEP-BY-STEP METHOD DETAILS Designing the dual sgRNA library Timing: 1 day Here we describe the process of designing a dual sgRNA focused library targeting predicted functional lncRNAs in K562.

    Transfection:

    Article Title: Protocol for simplified parallel perturbations using an abridged long non-coding RNA CRISPR library.
    Article Snippet: Antibodies HA-Tag (C29F4) rabbit monoclonal (1:1,000) Cell Signaling Technology Cat # 3724 Bacterial and virus strains E. coli Stellar chemically competent cells Takara Bio Cat # 636763 MegaX DH10B T1R Electrocomp cells Thermo Fisher Scientific Cat # C640003 Chemicals, peptides, and recombinant proteins PolyJet in vitro DNA transfection reagent SignaGen Cat # SL100688 Polybrene infection/transfection reagent Sigma-Aldrich Cat # TR-1003-G RPMI-1640 Biowest Cat # L0490-500 Phosphate-buffered saline (PBS) Sigma-Aldrich Cat # D1408-500ML Dulbecco’s modified Eagle’s medium (DMEM) Sigma-Aldrich Cat # D5796-500ML Trypsin Sigma-Aldrich Cat # T4049-500ML Fetal bovine serum (FBS) Sigma-Aldrich Cat # F9665-500ML L-glutamine Biowest Cat # X0550-100 Penicillin-streptomycin Biowest Cat # L0022-100 NEBNext Ultra II Q5 master mix NEB Cat # M0544X FastDigest Bpu1102I Thermo Fisher Scientific Cat # FD0094 FastDigest BstXI Thermo Fisher Scientific Cat # FD1024 FastDigest Esp3I Thermo Fisher Scientific Cat # FD0454 FastDigest SgsI Thermo Fisher Scientific Cat # FD1894 FastAP thermosensitive alkaline phosphatase Thermo Fisher Scientific Cat # EF0651 Phusion high-fidelity DNA polymerase NEB Cat # M0530L Q5 high-fidelity 23 master mix NEB Cat # M0492L NEBuilder HiFI DNA assembly master mix NEB Cat # E2621L RNase-free microfuge tubes (low-binding, 0.5 mL) Thermo Fisher Scientific Cat # AM12350 RNase-free microfuge tubes (low-binding, 1.5 mL) Thermo Fisher Scientific Cat # AM12450 18-gauge syringe needle Merck Cat # Z102717 Corning Costar Spin-X centrifuge tube filters Merck Cat # CLS8162 GlycoBlue coprecipitant Thermo Fisher Scientific Cat # AM9516 T4 DNA ligase NEB Cat # M0202T Carbenicillin (100 mg/mL) Merck Cat # C1613 Lenti-X concentrator Takara Bio Cat # 631231 Millex-HV filter unit (0.45 μm) Merck Cat # SLHV033RS Puromycin (10 mg/mL solution) InvivoGen Cat # ant-pr-1 Critical commercial assays NucleoSpin gel and PCR cleanup kit Macherey-Nagel Cat # 740609 MinElute reaction cleanup kit QIAGEN Cat # 28204 NucleoSpin plasmid EasyPure mini kit Macherey-Nagel Cat # 740727 NucleoBond Xtra Midi kit Macherey-Nagel Cat # 740410 Experimental models: Cell lines K562 ATCC CCL-243 HEK293T ATCC CRL-3216 Oligonucleotides sgRNA sequence #1 – SYVN1: GGCGCTGGGTTCCTGGTGAGT Weissman Lab12 NA (Continued on next page) 2 STAR Protocols 6, 104110, December 19, 2025 STEP-BY-STEP METHOD DETAILS Designing the dual sgRNA library Timing: 1 day Here we describe the process of designing a dual sgRNA focused library targeting predicted functional lncRNAs in K562.

    Infection:

    Article Title: Protocol for simplified parallel perturbations using an abridged long non-coding RNA CRISPR library.
    Article Snippet: Antibodies HA-Tag (C29F4) rabbit monoclonal (1:1,000) Cell Signaling Technology Cat # 3724 Bacterial and virus strains E. coli Stellar chemically competent cells Takara Bio Cat # 636763 MegaX DH10B T1R Electrocomp cells Thermo Fisher Scientific Cat # C640003 Chemicals, peptides, and recombinant proteins PolyJet in vitro DNA transfection reagent SignaGen Cat # SL100688 Polybrene infection/transfection reagent Sigma-Aldrich Cat # TR-1003-G RPMI-1640 Biowest Cat # L0490-500 Phosphate-buffered saline (PBS) Sigma-Aldrich Cat # D1408-500ML Dulbecco’s modified Eagle’s medium (DMEM) Sigma-Aldrich Cat # D5796-500ML Trypsin Sigma-Aldrich Cat # T4049-500ML Fetal bovine serum (FBS) Sigma-Aldrich Cat # F9665-500ML L-glutamine Biowest Cat # X0550-100 Penicillin-streptomycin Biowest Cat # L0022-100 NEBNext Ultra II Q5 master mix NEB Cat # M0544X FastDigest Bpu1102I Thermo Fisher Scientific Cat # FD0094 FastDigest BstXI Thermo Fisher Scientific Cat # FD1024 FastDigest Esp3I Thermo Fisher Scientific Cat # FD0454 FastDigest SgsI Thermo Fisher Scientific Cat # FD1894 FastAP thermosensitive alkaline phosphatase Thermo Fisher Scientific Cat # EF0651 Phusion high-fidelity DNA polymerase NEB Cat # M0530L Q5 high-fidelity 23 master mix NEB Cat # M0492L NEBuilder HiFI DNA assembly master mix NEB Cat # E2621L RNase-free microfuge tubes (low-binding, 0.5 mL) Thermo Fisher Scientific Cat # AM12350 RNase-free microfuge tubes (low-binding, 1.5 mL) Thermo Fisher Scientific Cat # AM12450 18-gauge syringe needle Merck Cat # Z102717 Corning Costar Spin-X centrifuge tube filters Merck Cat # CLS8162 GlycoBlue coprecipitant Thermo Fisher Scientific Cat # AM9516 T4 DNA ligase NEB Cat # M0202T Carbenicillin (100 mg/mL) Merck Cat # C1613 Lenti-X concentrator Takara Bio Cat # 631231 Millex-HV filter unit (0.45 μm) Merck Cat # SLHV033RS Puromycin (10 mg/mL solution) InvivoGen Cat # ant-pr-1 Critical commercial assays NucleoSpin gel and PCR cleanup kit Macherey-Nagel Cat # 740609 MinElute reaction cleanup kit QIAGEN Cat # 28204 NucleoSpin plasmid EasyPure mini kit Macherey-Nagel Cat # 740727 NucleoBond Xtra Midi kit Macherey-Nagel Cat # 740410 Experimental models: Cell lines K562 ATCC CCL-243 HEK293T ATCC CRL-3216 Oligonucleotides sgRNA sequence #1 – SYVN1: GGCGCTGGGTTCCTGGTGAGT Weissman Lab12 NA (Continued on next page) 2 STAR Protocols 6, 104110, December 19, 2025 STEP-BY-STEP METHOD DETAILS Designing the dual sgRNA library Timing: 1 day Here we describe the process of designing a dual sgRNA focused library targeting predicted functional lncRNAs in K562.

    Saline:

    Article Title: Protocol for simplified parallel perturbations using an abridged long non-coding RNA CRISPR library.
    Article Snippet: Antibodies HA-Tag (C29F4) rabbit monoclonal (1:1,000) Cell Signaling Technology Cat # 3724 Bacterial and virus strains E. coli Stellar chemically competent cells Takara Bio Cat # 636763 MegaX DH10B T1R Electrocomp cells Thermo Fisher Scientific Cat # C640003 Chemicals, peptides, and recombinant proteins PolyJet in vitro DNA transfection reagent SignaGen Cat # SL100688 Polybrene infection/transfection reagent Sigma-Aldrich Cat # TR-1003-G RPMI-1640 Biowest Cat # L0490-500 Phosphate-buffered saline (PBS) Sigma-Aldrich Cat # D1408-500ML Dulbecco’s modified Eagle’s medium (DMEM) Sigma-Aldrich Cat # D5796-500ML Trypsin Sigma-Aldrich Cat # T4049-500ML Fetal bovine serum (FBS) Sigma-Aldrich Cat # F9665-500ML L-glutamine Biowest Cat # X0550-100 Penicillin-streptomycin Biowest Cat # L0022-100 NEBNext Ultra II Q5 master mix NEB Cat # M0544X FastDigest Bpu1102I Thermo Fisher Scientific Cat # FD0094 FastDigest BstXI Thermo Fisher Scientific Cat # FD1024 FastDigest Esp3I Thermo Fisher Scientific Cat # FD0454 FastDigest SgsI Thermo Fisher Scientific Cat # FD1894 FastAP thermosensitive alkaline phosphatase Thermo Fisher Scientific Cat # EF0651 Phusion high-fidelity DNA polymerase NEB Cat # M0530L Q5 high-fidelity 23 master mix NEB Cat # M0492L NEBuilder HiFI DNA assembly master mix NEB Cat # E2621L RNase-free microfuge tubes (low-binding, 0.5 mL) Thermo Fisher Scientific Cat # AM12350 RNase-free microfuge tubes (low-binding, 1.5 mL) Thermo Fisher Scientific Cat # AM12450 18-gauge syringe needle Merck Cat # Z102717 Corning Costar Spin-X centrifuge tube filters Merck Cat # CLS8162 GlycoBlue coprecipitant Thermo Fisher Scientific Cat # AM9516 T4 DNA ligase NEB Cat # M0202T Carbenicillin (100 mg/mL) Merck Cat # C1613 Lenti-X concentrator Takara Bio Cat # 631231 Millex-HV filter unit (0.45 μm) Merck Cat # SLHV033RS Puromycin (10 mg/mL solution) InvivoGen Cat # ant-pr-1 Critical commercial assays NucleoSpin gel and PCR cleanup kit Macherey-Nagel Cat # 740609 MinElute reaction cleanup kit QIAGEN Cat # 28204 NucleoSpin plasmid EasyPure mini kit Macherey-Nagel Cat # 740727 NucleoBond Xtra Midi kit Macherey-Nagel Cat # 740410 Experimental models: Cell lines K562 ATCC CCL-243 HEK293T ATCC CRL-3216 Oligonucleotides sgRNA sequence #1 – SYVN1: GGCGCTGGGTTCCTGGTGAGT Weissman Lab12 NA (Continued on next page) 2 STAR Protocols 6, 104110, December 19, 2025 STEP-BY-STEP METHOD DETAILS Designing the dual sgRNA library Timing: 1 day Here we describe the process of designing a dual sgRNA focused library targeting predicted functional lncRNAs in K562.

    Modification:

    Article Title: Protocol for simplified parallel perturbations using an abridged long non-coding RNA CRISPR library.
    Article Snippet: Antibodies HA-Tag (C29F4) rabbit monoclonal (1:1,000) Cell Signaling Technology Cat # 3724 Bacterial and virus strains E. coli Stellar chemically competent cells Takara Bio Cat # 636763 MegaX DH10B T1R Electrocomp cells Thermo Fisher Scientific Cat # C640003 Chemicals, peptides, and recombinant proteins PolyJet in vitro DNA transfection reagent SignaGen Cat # SL100688 Polybrene infection/transfection reagent Sigma-Aldrich Cat # TR-1003-G RPMI-1640 Biowest Cat # L0490-500 Phosphate-buffered saline (PBS) Sigma-Aldrich Cat # D1408-500ML Dulbecco’s modified Eagle’s medium (DMEM) Sigma-Aldrich Cat # D5796-500ML Trypsin Sigma-Aldrich Cat # T4049-500ML Fetal bovine serum (FBS) Sigma-Aldrich Cat # F9665-500ML L-glutamine Biowest Cat # X0550-100 Penicillin-streptomycin Biowest Cat # L0022-100 NEBNext Ultra II Q5 master mix NEB Cat # M0544X FastDigest Bpu1102I Thermo Fisher Scientific Cat # FD0094 FastDigest BstXI Thermo Fisher Scientific Cat # FD1024 FastDigest Esp3I Thermo Fisher Scientific Cat # FD0454 FastDigest SgsI Thermo Fisher Scientific Cat # FD1894 FastAP thermosensitive alkaline phosphatase Thermo Fisher Scientific Cat # EF0651 Phusion high-fidelity DNA polymerase NEB Cat # M0530L Q5 high-fidelity 23 master mix NEB Cat # M0492L NEBuilder HiFI DNA assembly master mix NEB Cat # E2621L RNase-free microfuge tubes (low-binding, 0.5 mL) Thermo Fisher Scientific Cat # AM12350 RNase-free microfuge tubes (low-binding, 1.5 mL) Thermo Fisher Scientific Cat # AM12450 18-gauge syringe needle Merck Cat # Z102717 Corning Costar Spin-X centrifuge tube filters Merck Cat # CLS8162 GlycoBlue coprecipitant Thermo Fisher Scientific Cat # AM9516 T4 DNA ligase NEB Cat # M0202T Carbenicillin (100 mg/mL) Merck Cat # C1613 Lenti-X concentrator Takara Bio Cat # 631231 Millex-HV filter unit (0.45 μm) Merck Cat # SLHV033RS Puromycin (10 mg/mL solution) InvivoGen Cat # ant-pr-1 Critical commercial assays NucleoSpin gel and PCR cleanup kit Macherey-Nagel Cat # 740609 MinElute reaction cleanup kit QIAGEN Cat # 28204 NucleoSpin plasmid EasyPure mini kit Macherey-Nagel Cat # 740727 NucleoBond Xtra Midi kit Macherey-Nagel Cat # 740410 Experimental models: Cell lines K562 ATCC CCL-243 HEK293T ATCC CRL-3216 Oligonucleotides sgRNA sequence #1 – SYVN1: GGCGCTGGGTTCCTGGTGAGT Weissman Lab12 NA (Continued on next page) 2 STAR Protocols 6, 104110, December 19, 2025 STEP-BY-STEP METHOD DETAILS Designing the dual sgRNA library Timing: 1 day Here we describe the process of designing a dual sgRNA focused library targeting predicted functional lncRNAs in K562.

    Polymerase Chain Reaction:

    Article Title: Protocol for simplified parallel perturbations using an abridged long non-coding RNA CRISPR library.
    Article Snippet: Antibodies HA-Tag (C29F4) rabbit monoclonal (1:1,000) Cell Signaling Technology Cat # 3724 Bacterial and virus strains E. coli Stellar chemically competent cells Takara Bio Cat # 636763 MegaX DH10B T1R Electrocomp cells Thermo Fisher Scientific Cat # C640003 Chemicals, peptides, and recombinant proteins PolyJet in vitro DNA transfection reagent SignaGen Cat # SL100688 Polybrene infection/transfection reagent Sigma-Aldrich Cat # TR-1003-G RPMI-1640 Biowest Cat # L0490-500 Phosphate-buffered saline (PBS) Sigma-Aldrich Cat # D1408-500ML Dulbecco’s modified Eagle’s medium (DMEM) Sigma-Aldrich Cat # D5796-500ML Trypsin Sigma-Aldrich Cat # T4049-500ML Fetal bovine serum (FBS) Sigma-Aldrich Cat # F9665-500ML L-glutamine Biowest Cat # X0550-100 Penicillin-streptomycin Biowest Cat # L0022-100 NEBNext Ultra II Q5 master mix NEB Cat # M0544X FastDigest Bpu1102I Thermo Fisher Scientific Cat # FD0094 FastDigest BstXI Thermo Fisher Scientific Cat # FD1024 FastDigest Esp3I Thermo Fisher Scientific Cat # FD0454 FastDigest SgsI Thermo Fisher Scientific Cat # FD1894 FastAP thermosensitive alkaline phosphatase Thermo Fisher Scientific Cat # EF0651 Phusion high-fidelity DNA polymerase NEB Cat # M0530L Q5 high-fidelity 23 master mix NEB Cat # M0492L NEBuilder HiFI DNA assembly master mix NEB Cat # E2621L RNase-free microfuge tubes (low-binding, 0.5 mL) Thermo Fisher Scientific Cat # AM12350 RNase-free microfuge tubes (low-binding, 1.5 mL) Thermo Fisher Scientific Cat # AM12450 18-gauge syringe needle Merck Cat # Z102717 Corning Costar Spin-X centrifuge tube filters Merck Cat # CLS8162 GlycoBlue coprecipitant Thermo Fisher Scientific Cat # AM9516 T4 DNA ligase NEB Cat # M0202T Carbenicillin (100 mg/mL) Merck Cat # C1613 Lenti-X concentrator Takara Bio Cat # 631231 Millex-HV filter unit (0.45 μm) Merck Cat # SLHV033RS Puromycin (10 mg/mL solution) InvivoGen Cat # ant-pr-1 Critical commercial assays NucleoSpin gel and PCR cleanup kit Macherey-Nagel Cat # 740609 MinElute reaction cleanup kit QIAGEN Cat # 28204 NucleoSpin plasmid EasyPure mini kit Macherey-Nagel Cat # 740727 NucleoBond Xtra Midi kit Macherey-Nagel Cat # 740410 Experimental models: Cell lines K562 ATCC CCL-243 HEK293T ATCC CRL-3216 Oligonucleotides sgRNA sequence #1 – SYVN1: GGCGCTGGGTTCCTGGTGAGT Weissman Lab12 NA (Continued on next page) 2 STAR Protocols 6, 104110, December 19, 2025 STEP-BY-STEP METHOD DETAILS Designing the dual sgRNA library Timing: 1 day Here we describe the process of designing a dual sgRNA focused library targeting predicted functional lncRNAs in K562.

    Plasmid Preparation:

    Article Title: Protocol for simplified parallel perturbations using an abridged long non-coding RNA CRISPR library.
    Article Snippet: Antibodies HA-Tag (C29F4) rabbit monoclonal (1:1,000) Cell Signaling Technology Cat # 3724 Bacterial and virus strains E. coli Stellar chemically competent cells Takara Bio Cat # 636763 MegaX DH10B T1R Electrocomp cells Thermo Fisher Scientific Cat # C640003 Chemicals, peptides, and recombinant proteins PolyJet in vitro DNA transfection reagent SignaGen Cat # SL100688 Polybrene infection/transfection reagent Sigma-Aldrich Cat # TR-1003-G RPMI-1640 Biowest Cat # L0490-500 Phosphate-buffered saline (PBS) Sigma-Aldrich Cat # D1408-500ML Dulbecco’s modified Eagle’s medium (DMEM) Sigma-Aldrich Cat # D5796-500ML Trypsin Sigma-Aldrich Cat # T4049-500ML Fetal bovine serum (FBS) Sigma-Aldrich Cat # F9665-500ML L-glutamine Biowest Cat # X0550-100 Penicillin-streptomycin Biowest Cat # L0022-100 NEBNext Ultra II Q5 master mix NEB Cat # M0544X FastDigest Bpu1102I Thermo Fisher Scientific Cat # FD0094 FastDigest BstXI Thermo Fisher Scientific Cat # FD1024 FastDigest Esp3I Thermo Fisher Scientific Cat # FD0454 FastDigest SgsI Thermo Fisher Scientific Cat # FD1894 FastAP thermosensitive alkaline phosphatase Thermo Fisher Scientific Cat # EF0651 Phusion high-fidelity DNA polymerase NEB Cat # M0530L Q5 high-fidelity 23 master mix NEB Cat # M0492L NEBuilder HiFI DNA assembly master mix NEB Cat # E2621L RNase-free microfuge tubes (low-binding, 0.5 mL) Thermo Fisher Scientific Cat # AM12350 RNase-free microfuge tubes (low-binding, 1.5 mL) Thermo Fisher Scientific Cat # AM12450 18-gauge syringe needle Merck Cat # Z102717 Corning Costar Spin-X centrifuge tube filters Merck Cat # CLS8162 GlycoBlue coprecipitant Thermo Fisher Scientific Cat # AM9516 T4 DNA ligase NEB Cat # M0202T Carbenicillin (100 mg/mL) Merck Cat # C1613 Lenti-X concentrator Takara Bio Cat # 631231 Millex-HV filter unit (0.45 μm) Merck Cat # SLHV033RS Puromycin (10 mg/mL solution) InvivoGen Cat # ant-pr-1 Critical commercial assays NucleoSpin gel and PCR cleanup kit Macherey-Nagel Cat # 740609 MinElute reaction cleanup kit QIAGEN Cat # 28204 NucleoSpin plasmid EasyPure mini kit Macherey-Nagel Cat # 740727 NucleoBond Xtra Midi kit Macherey-Nagel Cat # 740410 Experimental models: Cell lines K562 ATCC CCL-243 HEK293T ATCC CRL-3216 Oligonucleotides sgRNA sequence #1 – SYVN1: GGCGCTGGGTTCCTGGTGAGT Weissman Lab12 NA (Continued on next page) 2 STAR Protocols 6, 104110, December 19, 2025 STEP-BY-STEP METHOD DETAILS Designing the dual sgRNA library Timing: 1 day Here we describe the process of designing a dual sgRNA focused library targeting predicted functional lncRNAs in K562.

    Sequencing:

    Article Title: Protocol for simplified parallel perturbations using an abridged long non-coding RNA CRISPR library.
    Article Snippet: Antibodies HA-Tag (C29F4) rabbit monoclonal (1:1,000) Cell Signaling Technology Cat # 3724 Bacterial and virus strains E. coli Stellar chemically competent cells Takara Bio Cat # 636763 MegaX DH10B T1R Electrocomp cells Thermo Fisher Scientific Cat # C640003 Chemicals, peptides, and recombinant proteins PolyJet in vitro DNA transfection reagent SignaGen Cat # SL100688 Polybrene infection/transfection reagent Sigma-Aldrich Cat # TR-1003-G RPMI-1640 Biowest Cat # L0490-500 Phosphate-buffered saline (PBS) Sigma-Aldrich Cat # D1408-500ML Dulbecco’s modified Eagle’s medium (DMEM) Sigma-Aldrich Cat # D5796-500ML Trypsin Sigma-Aldrich Cat # T4049-500ML Fetal bovine serum (FBS) Sigma-Aldrich Cat # F9665-500ML L-glutamine Biowest Cat # X0550-100 Penicillin-streptomycin Biowest Cat # L0022-100 NEBNext Ultra II Q5 master mix NEB Cat # M0544X FastDigest Bpu1102I Thermo Fisher Scientific Cat # FD0094 FastDigest BstXI Thermo Fisher Scientific Cat # FD1024 FastDigest Esp3I Thermo Fisher Scientific Cat # FD0454 FastDigest SgsI Thermo Fisher Scientific Cat # FD1894 FastAP thermosensitive alkaline phosphatase Thermo Fisher Scientific Cat # EF0651 Phusion high-fidelity DNA polymerase NEB Cat # M0530L Q5 high-fidelity 23 master mix NEB Cat # M0492L NEBuilder HiFI DNA assembly master mix NEB Cat # E2621L RNase-free microfuge tubes (low-binding, 0.5 mL) Thermo Fisher Scientific Cat # AM12350 RNase-free microfuge tubes (low-binding, 1.5 mL) Thermo Fisher Scientific Cat # AM12450 18-gauge syringe needle Merck Cat # Z102717 Corning Costar Spin-X centrifuge tube filters Merck Cat # CLS8162 GlycoBlue coprecipitant Thermo Fisher Scientific Cat # AM9516 T4 DNA ligase NEB Cat # M0202T Carbenicillin (100 mg/mL) Merck Cat # C1613 Lenti-X concentrator Takara Bio Cat # 631231 Millex-HV filter unit (0.45 μm) Merck Cat # SLHV033RS Puromycin (10 mg/mL solution) InvivoGen Cat # ant-pr-1 Critical commercial assays NucleoSpin gel and PCR cleanup kit Macherey-Nagel Cat # 740609 MinElute reaction cleanup kit QIAGEN Cat # 28204 NucleoSpin plasmid EasyPure mini kit Macherey-Nagel Cat # 740727 NucleoBond Xtra Midi kit Macherey-Nagel Cat # 740410 Experimental models: Cell lines K562 ATCC CCL-243 HEK293T ATCC CRL-3216 Oligonucleotides sgRNA sequence #1 – SYVN1: GGCGCTGGGTTCCTGGTGAGT Weissman Lab12 NA (Continued on next page) 2 STAR Protocols 6, 104110, December 19, 2025 STEP-BY-STEP METHOD DETAILS Designing the dual sgRNA library Timing: 1 day Here we describe the process of designing a dual sgRNA focused library targeting predicted functional lncRNAs in K562.

    Functional Assay:

    Article Title: Protocol for simplified parallel perturbations using an abridged long non-coding RNA CRISPR library.
    Article Snippet: Antibodies HA-Tag (C29F4) rabbit monoclonal (1:1,000) Cell Signaling Technology Cat # 3724 Bacterial and virus strains E. coli Stellar chemically competent cells Takara Bio Cat # 636763 MegaX DH10B T1R Electrocomp cells Thermo Fisher Scientific Cat # C640003 Chemicals, peptides, and recombinant proteins PolyJet in vitro DNA transfection reagent SignaGen Cat # SL100688 Polybrene infection/transfection reagent Sigma-Aldrich Cat # TR-1003-G RPMI-1640 Biowest Cat # L0490-500 Phosphate-buffered saline (PBS) Sigma-Aldrich Cat # D1408-500ML Dulbecco’s modified Eagle’s medium (DMEM) Sigma-Aldrich Cat # D5796-500ML Trypsin Sigma-Aldrich Cat # T4049-500ML Fetal bovine serum (FBS) Sigma-Aldrich Cat # F9665-500ML L-glutamine Biowest Cat # X0550-100 Penicillin-streptomycin Biowest Cat # L0022-100 NEBNext Ultra II Q5 master mix NEB Cat # M0544X FastDigest Bpu1102I Thermo Fisher Scientific Cat # FD0094 FastDigest BstXI Thermo Fisher Scientific Cat # FD1024 FastDigest Esp3I Thermo Fisher Scientific Cat # FD0454 FastDigest SgsI Thermo Fisher Scientific Cat # FD1894 FastAP thermosensitive alkaline phosphatase Thermo Fisher Scientific Cat # EF0651 Phusion high-fidelity DNA polymerase NEB Cat # M0530L Q5 high-fidelity 23 master mix NEB Cat # M0492L NEBuilder HiFI DNA assembly master mix NEB Cat # E2621L RNase-free microfuge tubes (low-binding, 0.5 mL) Thermo Fisher Scientific Cat # AM12350 RNase-free microfuge tubes (low-binding, 1.5 mL) Thermo Fisher Scientific Cat # AM12450 18-gauge syringe needle Merck Cat # Z102717 Corning Costar Spin-X centrifuge tube filters Merck Cat # CLS8162 GlycoBlue coprecipitant Thermo Fisher Scientific Cat # AM9516 T4 DNA ligase NEB Cat # M0202T Carbenicillin (100 mg/mL) Merck Cat # C1613 Lenti-X concentrator Takara Bio Cat # 631231 Millex-HV filter unit (0.45 μm) Merck Cat # SLHV033RS Puromycin (10 mg/mL solution) InvivoGen Cat # ant-pr-1 Critical commercial assays NucleoSpin gel and PCR cleanup kit Macherey-Nagel Cat # 740609 MinElute reaction cleanup kit QIAGEN Cat # 28204 NucleoSpin plasmid EasyPure mini kit Macherey-Nagel Cat # 740727 NucleoBond Xtra Midi kit Macherey-Nagel Cat # 740410 Experimental models: Cell lines K562 ATCC CCL-243 HEK293T ATCC CRL-3216 Oligonucleotides sgRNA sequence #1 – SYVN1: GGCGCTGGGTTCCTGGTGAGT Weissman Lab12 NA (Continued on next page) 2 STAR Protocols 6, 104110, December 19, 2025 STEP-BY-STEP METHOD DETAILS Designing the dual sgRNA library Timing: 1 day Here we describe the process of designing a dual sgRNA focused library targeting predicted functional lncRNAs in K562.



    Similar Products

    syvn  (ATCC)
    99
    ATCC syvn
    Syvn, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syvn/K-562/pm41014566-33-322-313
    Average 99 stars, based on 1 article reviews
    syvn - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    rabbit α syvn hrd1  (Cell Signaling Technology Inc)
    94
    Cell Signaling Technology Inc rabbit α syvn hrd1
    a. Illustration of the ER membrane topology of the model ERAD substrate H2a-BAP-SV5 together with cytosolic BirA and the luminal sec-BirA, highlighting three proposed retrotranslocation mechanisms that allow cytosolic BAP biotinylation. b. Western blot of HEK 293 cells expressing H2a-BAP alone or together with BirA or sec-BirA after incubation with Biotin (100µM, 30 min). Biotinylated H2a-BAP was detected with StAv-HRP and total H2a-BAP with α-SV5. c, d. Immunofluorescence of U2OS cells expressing H2a-BAP without BirA untreated or upon bortezomib (Bz, 2.5µM, 3 hours) treatment, stained with α-SV5 and StAv-Cy2 to visualize total and background biotin signal; yellow dashed ROIs mark the ERQC and white boxes indicate zoomed regions, shown on the right. e, f. Localization of total and biotinylated H2a-BAP in U2OS cells expressing the H2a-BAP – BirA system under basal and Bz-treated conditions. g. Quantification of total and biotinylated H2a-BAP in the ERQC relative to whole-cell signal (mean ± SD, n=28; unpaired t-test with Welch’s correction). h-k. Colocalization of biotinylated H2a-BAP with endogenous ER/ERQC markers, Sec61β and calreticulin (CRT). l-n . Colocalization of biotinylated H2a-BAP with ERAD components, endogenous <t>HRD1</t> and transfected HERP-FLAG. Scale bars= 10 µm. o. Pearson’s R values (Coloc2) for colocalization of biotinylated H2a-BAP with total-H2a-BAP, Sec61β, CRT, HRD1, BiP, and GalT (BiP and GalT from Suppl. Fig. 1) in untreated and Bz-treated cells (unpaired T-test with Welch’s correction).
    Rabbit α Syvn Hrd1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syvn/SYVN1+Rabbit+mAb/bio_rxiv__64898__2026__02__04__703732-215-21-23
    Average 94 stars, based on 1 article reviews
    rabbit α syvn hrd1 - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    anti-hrd1 (syvn) c-terminal antibody  (WuXi AppTec)
    90
    WuXi AppTec anti-hrd1 (syvn) c-terminal antibody
    a. Illustration of the ER membrane topology of the model ERAD substrate H2a-BAP-SV5 together with cytosolic BirA and the luminal sec-BirA, highlighting three proposed retrotranslocation mechanisms that allow cytosolic BAP biotinylation. b. Western blot of HEK 293 cells expressing H2a-BAP alone or together with BirA or sec-BirA after incubation with Biotin (100µM, 30 min). Biotinylated H2a-BAP was detected with StAv-HRP and total H2a-BAP with α-SV5. c, d. Immunofluorescence of U2OS cells expressing H2a-BAP without BirA untreated or upon bortezomib (Bz, 2.5µM, 3 hours) treatment, stained with α-SV5 and StAv-Cy2 to visualize total and background biotin signal; yellow dashed ROIs mark the ERQC and white boxes indicate zoomed regions, shown on the right. e, f. Localization of total and biotinylated H2a-BAP in U2OS cells expressing the H2a-BAP – BirA system under basal and Bz-treated conditions. g. Quantification of total and biotinylated H2a-BAP in the ERQC relative to whole-cell signal (mean ± SD, n=28; unpaired t-test with Welch’s correction). h-k. Colocalization of biotinylated H2a-BAP with endogenous ER/ERQC markers, Sec61β and calreticulin (CRT). l-n . Colocalization of biotinylated H2a-BAP with ERAD components, endogenous <t>HRD1</t> and transfected HERP-FLAG. Scale bars= 10 µm. o. Pearson’s R values (Coloc2) for colocalization of biotinylated H2a-BAP with total-H2a-BAP, Sec61β, CRT, HRD1, BiP, and GalT (BiP and GalT from Suppl. Fig. 1) in untreated and Bz-treated cells (unpaired T-test with Welch’s correction).
    Anti Hrd1 (Syvn) C Terminal Antibody, supplied by WuXi AppTec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syvn/anti+hrd1/pmc03531736-126-10-14
    Average 90 stars, based on 1 article reviews
    anti-hrd1 (syvn) c-terminal antibody - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    a. Illustration of the ER membrane topology of the model ERAD substrate H2a-BAP-SV5 together with cytosolic BirA and the luminal sec-BirA, highlighting three proposed retrotranslocation mechanisms that allow cytosolic BAP biotinylation. b. Western blot of HEK 293 cells expressing H2a-BAP alone or together with BirA or sec-BirA after incubation with Biotin (100µM, 30 min). Biotinylated H2a-BAP was detected with StAv-HRP and total H2a-BAP with α-SV5. c, d. Immunofluorescence of U2OS cells expressing H2a-BAP without BirA untreated or upon bortezomib (Bz, 2.5µM, 3 hours) treatment, stained with α-SV5 and StAv-Cy2 to visualize total and background biotin signal; yellow dashed ROIs mark the ERQC and white boxes indicate zoomed regions, shown on the right. e, f. Localization of total and biotinylated H2a-BAP in U2OS cells expressing the H2a-BAP – BirA system under basal and Bz-treated conditions. g. Quantification of total and biotinylated H2a-BAP in the ERQC relative to whole-cell signal (mean ± SD, n=28; unpaired t-test with Welch’s correction). h-k. Colocalization of biotinylated H2a-BAP with endogenous ER/ERQC markers, Sec61β and calreticulin (CRT). l-n . Colocalization of biotinylated H2a-BAP with ERAD components, endogenous HRD1 and transfected HERP-FLAG. Scale bars= 10 µm. o. Pearson’s R values (Coloc2) for colocalization of biotinylated H2a-BAP with total-H2a-BAP, Sec61β, CRT, HRD1, BiP, and GalT (BiP and GalT from Suppl. Fig. 1) in untreated and Bz-treated cells (unpaired T-test with Welch’s correction).

    Journal: bioRxiv

    Article Title: ER-associated protein degradation initiates by retrotranslocation from the ER quality control compartment

    doi: 10.64898/2026.02.04.703732

    Figure Lengend Snippet: a. Illustration of the ER membrane topology of the model ERAD substrate H2a-BAP-SV5 together with cytosolic BirA and the luminal sec-BirA, highlighting three proposed retrotranslocation mechanisms that allow cytosolic BAP biotinylation. b. Western blot of HEK 293 cells expressing H2a-BAP alone or together with BirA or sec-BirA after incubation with Biotin (100µM, 30 min). Biotinylated H2a-BAP was detected with StAv-HRP and total H2a-BAP with α-SV5. c, d. Immunofluorescence of U2OS cells expressing H2a-BAP without BirA untreated or upon bortezomib (Bz, 2.5µM, 3 hours) treatment, stained with α-SV5 and StAv-Cy2 to visualize total and background biotin signal; yellow dashed ROIs mark the ERQC and white boxes indicate zoomed regions, shown on the right. e, f. Localization of total and biotinylated H2a-BAP in U2OS cells expressing the H2a-BAP – BirA system under basal and Bz-treated conditions. g. Quantification of total and biotinylated H2a-BAP in the ERQC relative to whole-cell signal (mean ± SD, n=28; unpaired t-test with Welch’s correction). h-k. Colocalization of biotinylated H2a-BAP with endogenous ER/ERQC markers, Sec61β and calreticulin (CRT). l-n . Colocalization of biotinylated H2a-BAP with ERAD components, endogenous HRD1 and transfected HERP-FLAG. Scale bars= 10 µm. o. Pearson’s R values (Coloc2) for colocalization of biotinylated H2a-BAP with total-H2a-BAP, Sec61β, CRT, HRD1, BiP, and GalT (BiP and GalT from Suppl. Fig. 1) in untreated and Bz-treated cells (unpaired T-test with Welch’s correction).

    Article Snippet: Streptavidin-HRP (Jackson ImmunoResearch-016-030-084; 1:5000-7500; WB), Rabbit-α-SV5 (CellSignalling-D3H8Q; 1:2000 (WB), 1:750 (IF), 1:250 (ExM)), Mouse-α-SV5 (GeneScript-A01724-100; 1:1000 (WB), 1:750 (IF), 1:250 (ExM)), Rabbit-α-SYVN (Hrd1) (CellSignaling-14773; 1:1000 (WB), 1:100 (IF)), Rabbit-α-H2a (against N-terminus of H2a as described in ) Rabbit-α-Calnexin (Abcam-92573; 1:5000 (WB)), Rabbit-α-RPL26 (CellSignaling-5400; 1:1000 (WB)), Mouse-α-eIF2α (MBL-AT6031; 1:1000 (WB)), Rabbit-α-C9 (20S) (Abcam-ab118902; 1:1000 (WB)), Rabbit-α-Calnexin (SigmaAldrich - C4731; 1:1000 (WB), 1:500 (IF)), Rabbit-α-Calreticulin (CellSignaling-D3E6; 1:400 (IF)).

    Techniques: Membrane, Western Blot, Expressing, Incubation, Immunofluorescence, Staining, Transfection

    a. HEK 293 cells expressing H2a-BAP - BirA were left untreated or treated for 3 hours with Bz (2.5µM), NB-DNJ (200µM) or Kifunensine (Kif, 100µM), alone or with Bz, and lysates were analyzed for total (α-SV5) and biotinylated H2a-BAP (StAv-HRP) or subjected to StAv-agarose pulldown to detect precipitated (α-SV5) and ubiquitylated H2a-BAP (α-Ubiquitin). Deglycosylated species are indicated by red arrows. b, c. Biotinylated H2a-BAP and polyubiquitylated biotinylated H2a-BAP were quantified and normalized to total or StAv-precipitated H2a-BAP, respectively. d. HEK 293 cells co-expressing H2a-BAP - BirA with dominant-negative HRD1 (HRD1-DN) were analyzed under basal or Bz-treated conditions using the same biochemical readouts as in (a). e, f. Quantification of biotinylated and polyubiquitylated H2a-BAP (from d). Statistics were performed using ordinary two-way ANOVA with Tukey’s multiple-comparisons test. g-i. U2OS cells co-expressing H2a-BAP - BirA with HRD1-WT or HRD1-DN, with or without Bz, were stained for total and biotinylated H2a-BAP and HRD1/HRD1-DN (α-Myc) to visualize the impact of HRD1 activity and proteasome inhibition on H2a-BAP localization. j. Pearson’s R values (Coloc2) for colocalization of biotinylated H2a-BAP with HRD1-DN under untreated and Bz-treated cells (unpaired T-test with Welch’s correction). Scale bars= 10 µm.

    Journal: bioRxiv

    Article Title: ER-associated protein degradation initiates by retrotranslocation from the ER quality control compartment

    doi: 10.64898/2026.02.04.703732

    Figure Lengend Snippet: a. HEK 293 cells expressing H2a-BAP - BirA were left untreated or treated for 3 hours with Bz (2.5µM), NB-DNJ (200µM) or Kifunensine (Kif, 100µM), alone or with Bz, and lysates were analyzed for total (α-SV5) and biotinylated H2a-BAP (StAv-HRP) or subjected to StAv-agarose pulldown to detect precipitated (α-SV5) and ubiquitylated H2a-BAP (α-Ubiquitin). Deglycosylated species are indicated by red arrows. b, c. Biotinylated H2a-BAP and polyubiquitylated biotinylated H2a-BAP were quantified and normalized to total or StAv-precipitated H2a-BAP, respectively. d. HEK 293 cells co-expressing H2a-BAP - BirA with dominant-negative HRD1 (HRD1-DN) were analyzed under basal or Bz-treated conditions using the same biochemical readouts as in (a). e, f. Quantification of biotinylated and polyubiquitylated H2a-BAP (from d). Statistics were performed using ordinary two-way ANOVA with Tukey’s multiple-comparisons test. g-i. U2OS cells co-expressing H2a-BAP - BirA with HRD1-WT or HRD1-DN, with or without Bz, were stained for total and biotinylated H2a-BAP and HRD1/HRD1-DN (α-Myc) to visualize the impact of HRD1 activity and proteasome inhibition on H2a-BAP localization. j. Pearson’s R values (Coloc2) for colocalization of biotinylated H2a-BAP with HRD1-DN under untreated and Bz-treated cells (unpaired T-test with Welch’s correction). Scale bars= 10 µm.

    Article Snippet: Streptavidin-HRP (Jackson ImmunoResearch-016-030-084; 1:5000-7500; WB), Rabbit-α-SV5 (CellSignalling-D3H8Q; 1:2000 (WB), 1:750 (IF), 1:250 (ExM)), Mouse-α-SV5 (GeneScript-A01724-100; 1:1000 (WB), 1:750 (IF), 1:250 (ExM)), Rabbit-α-SYVN (Hrd1) (CellSignaling-14773; 1:1000 (WB), 1:100 (IF)), Rabbit-α-H2a (against N-terminus of H2a as described in ) Rabbit-α-Calnexin (Abcam-92573; 1:5000 (WB)), Rabbit-α-RPL26 (CellSignaling-5400; 1:1000 (WB)), Mouse-α-eIF2α (MBL-AT6031; 1:1000 (WB)), Rabbit-α-C9 (20S) (Abcam-ab118902; 1:1000 (WB)), Rabbit-α-Calnexin (SigmaAldrich - C4731; 1:1000 (WB), 1:500 (IF)), Rabbit-α-Calreticulin (CellSignaling-D3E6; 1:400 (IF)).

    Techniques: Expressing, Ubiquitin Proteomics, Dominant Negative Mutation, Staining, Activity Assay, Inhibition

    a, b. H2a-BAP – BirA expressing HEK 293 cells, left untreated (a) or treated with Bz (2.5 µM, 3 hours) (b), were homogenized and post-nuclear supernatants were layered on iodixanol step gradients (10, 16, 22, 28 and 34%) and centrifuged at 24,000 r.p.m. for 16 hours. 1 mL fractions were collected from the top and analyzed by Western blot with StAv-HRP to detect biotinylated H2a-BAP and with α-SV5 (or α-Myc) for total H2a-BAP, together with organelle markers α-CNX, α-HRD1, α-Sec61β, α-20S, α-RPL26 and α-Cab45; the deglycosylated H2a-BAP species is indicated by a red arrow. c . H2a-Myc lacking the BAP tag was co-expressed with BirA as a negative control for biotinylation. d. For each protein, the signal in every fraction was expressed as a percentage of total and plotted versus fraction number; one representative experiment of three is shown. Yellow shading marks fractions enriched in membrane-bound organelles, with fractions 1–2 containing soluble proteins and low-density organelles (Golgi), and green shading marks the ERQC peak. e. HEK 293 cells expressing H2a-BAP - BirA were treated with the p97 inhibitor CB5083 (2.5 µM, 3 hours), alone or with Bz (2.5µM, 3 hours), and analyzed by Western blot. f. Glycosylated and deglycosylated biotinylated H2a-BAP species (from (e)) were quantified, normalized to total H2a-BAP (α-SV5) and expressed relative to untreated cells (mean of 5 experiments ± SD; ordinary two-way ANOVA with Tukey’s multiple-comparisons test).

    Journal: bioRxiv

    Article Title: ER-associated protein degradation initiates by retrotranslocation from the ER quality control compartment

    doi: 10.64898/2026.02.04.703732

    Figure Lengend Snippet: a, b. H2a-BAP – BirA expressing HEK 293 cells, left untreated (a) or treated with Bz (2.5 µM, 3 hours) (b), were homogenized and post-nuclear supernatants were layered on iodixanol step gradients (10, 16, 22, 28 and 34%) and centrifuged at 24,000 r.p.m. for 16 hours. 1 mL fractions were collected from the top and analyzed by Western blot with StAv-HRP to detect biotinylated H2a-BAP and with α-SV5 (or α-Myc) for total H2a-BAP, together with organelle markers α-CNX, α-HRD1, α-Sec61β, α-20S, α-RPL26 and α-Cab45; the deglycosylated H2a-BAP species is indicated by a red arrow. c . H2a-Myc lacking the BAP tag was co-expressed with BirA as a negative control for biotinylation. d. For each protein, the signal in every fraction was expressed as a percentage of total and plotted versus fraction number; one representative experiment of three is shown. Yellow shading marks fractions enriched in membrane-bound organelles, with fractions 1–2 containing soluble proteins and low-density organelles (Golgi), and green shading marks the ERQC peak. e. HEK 293 cells expressing H2a-BAP - BirA were treated with the p97 inhibitor CB5083 (2.5 µM, 3 hours), alone or with Bz (2.5µM, 3 hours), and analyzed by Western blot. f. Glycosylated and deglycosylated biotinylated H2a-BAP species (from (e)) were quantified, normalized to total H2a-BAP (α-SV5) and expressed relative to untreated cells (mean of 5 experiments ± SD; ordinary two-way ANOVA with Tukey’s multiple-comparisons test).

    Article Snippet: Streptavidin-HRP (Jackson ImmunoResearch-016-030-084; 1:5000-7500; WB), Rabbit-α-SV5 (CellSignalling-D3H8Q; 1:2000 (WB), 1:750 (IF), 1:250 (ExM)), Mouse-α-SV5 (GeneScript-A01724-100; 1:1000 (WB), 1:750 (IF), 1:250 (ExM)), Rabbit-α-SYVN (Hrd1) (CellSignaling-14773; 1:1000 (WB), 1:100 (IF)), Rabbit-α-H2a (against N-terminus of H2a as described in ) Rabbit-α-Calnexin (Abcam-92573; 1:5000 (WB)), Rabbit-α-RPL26 (CellSignaling-5400; 1:1000 (WB)), Mouse-α-eIF2α (MBL-AT6031; 1:1000 (WB)), Rabbit-α-C9 (20S) (Abcam-ab118902; 1:1000 (WB)), Rabbit-α-Calnexin (SigmaAldrich - C4731; 1:1000 (WB), 1:500 (IF)), Rabbit-α-Calreticulin (CellSignaling-D3E6; 1:400 (IF)).

    Techniques: Expressing, Western Blot, Negative Control, Membrane

    H2a-BAP – BirA expressing HEK 293 cells were processed as in but using iodixanol gradients optimized to achieve higher resolution of low and medium density fractions (10%, 13%, 16%, 20% and 24%) under three microsome conditions: untreated microsomes (M), SDS/Triton X-100/NaDOC lysis (S) or Na₂CO₃ extraction (C). a. 1-mL fractions were collected and immunoblotted for biotinylated H2a-BAP (StAv-HRP), deglycosylated species are indicated by red arrows), total H2a-BAP (α-SV5) and calnexin (CNX). b. Parallel blots were probed for endogenous HRD1 and cytosolic or cytosol-facing membrane proteins (α-20S, α-RPL26 and α-eIF2α). c-f. Signals for biotinylated, total, glycosylated and deglycosylated H2a-BAP were quantified for each condition (M, S, C), expressed as percentage of total signal and compared between untreated and Bz-treated cells; one representative experiment of three is shown. g. Scheme of alkaline carbonate extraction release of peripherally membrane-associated proteins from microsomes while retaining integral ER membrane proteins.

    Journal: bioRxiv

    Article Title: ER-associated protein degradation initiates by retrotranslocation from the ER quality control compartment

    doi: 10.64898/2026.02.04.703732

    Figure Lengend Snippet: H2a-BAP – BirA expressing HEK 293 cells were processed as in but using iodixanol gradients optimized to achieve higher resolution of low and medium density fractions (10%, 13%, 16%, 20% and 24%) under three microsome conditions: untreated microsomes (M), SDS/Triton X-100/NaDOC lysis (S) or Na₂CO₃ extraction (C). a. 1-mL fractions were collected and immunoblotted for biotinylated H2a-BAP (StAv-HRP), deglycosylated species are indicated by red arrows), total H2a-BAP (α-SV5) and calnexin (CNX). b. Parallel blots were probed for endogenous HRD1 and cytosolic or cytosol-facing membrane proteins (α-20S, α-RPL26 and α-eIF2α). c-f. Signals for biotinylated, total, glycosylated and deglycosylated H2a-BAP were quantified for each condition (M, S, C), expressed as percentage of total signal and compared between untreated and Bz-treated cells; one representative experiment of three is shown. g. Scheme of alkaline carbonate extraction release of peripherally membrane-associated proteins from microsomes while retaining integral ER membrane proteins.

    Article Snippet: Streptavidin-HRP (Jackson ImmunoResearch-016-030-084; 1:5000-7500; WB), Rabbit-α-SV5 (CellSignalling-D3H8Q; 1:2000 (WB), 1:750 (IF), 1:250 (ExM)), Mouse-α-SV5 (GeneScript-A01724-100; 1:1000 (WB), 1:750 (IF), 1:250 (ExM)), Rabbit-α-SYVN (Hrd1) (CellSignaling-14773; 1:1000 (WB), 1:100 (IF)), Rabbit-α-H2a (against N-terminus of H2a as described in ) Rabbit-α-Calnexin (Abcam-92573; 1:5000 (WB)), Rabbit-α-RPL26 (CellSignaling-5400; 1:1000 (WB)), Mouse-α-eIF2α (MBL-AT6031; 1:1000 (WB)), Rabbit-α-C9 (20S) (Abcam-ab118902; 1:1000 (WB)), Rabbit-α-Calnexin (SigmaAldrich - C4731; 1:1000 (WB), 1:500 (IF)), Rabbit-α-Calreticulin (CellSignaling-D3E6; 1:400 (IF)).

    Techniques: Expressing, Lysis, Extraction, Membrane