Review

sb505124 (Tocris)

Tocris is a verified supplier

Tocris manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Tocris sb505124
Sb505124, supplied by Tocris, used in various techniques. Bioz Stars score: 95/100, based on 59 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sb505124/SB+505124/bio_rxiv__64898__2025__12__17__694993-187-9-18
Average 95 stars, based on 59 article reviews

sb505124 - by Bioz Stars, 2026-10

95/100 stars

Images

Shear:

Article Title: Protocol for the generation of HLF+ HOXA+ human hematopoietic progenitor cells from pluripotent stem cells.
Article Snippet: Zheng et al., STAR Protocols 6, 103592 March 21, 2025 a 2025 The Hematopoietic stem cells (HSCs) generate blood and immune cells.. Here, we present a protocol to differentiate human pluripotent stem cells (hPSCs) into hematopoietic progenitors that express the signature HSC transcription factors HLF, HOXA5, HOXA7, HOXA9, and HOXA10. hPSCs are dissociated, seeded, and then sequentially differentiated into posterior primitive streak, lateral mesoderm, artery endothelium, hemogenic endothelium, and hematopoietic progenitors through the sequential addition of defined, serum-free media.. This 10-day protocol enables the manufacturing of blood and immune cells in monolayer cultures.

In Vivo:

Functional Assay:

Concentration Assay:

Generated:

other:

Article Title: circTGFBR2(3-6) acts as an assembly platform for RNA-binding protein IGF2BP3 and TGFBR1 mRNA to enhance breast cancer cell plasticity
Article Snippet: To detect the expression of TGF-β target genes, MDA-MB-231 cells were treated with TGF-β (1 ng/ml) or a vehicle control for 8 h. Total RNA was isolated using the NucleoSpin RNA kit (740955; Macherey Nagel, Duren, Germany), and reverse transcription was performed with the RevertAid RT Reverse Transcription Kit (K1691; Thermo Fisher Scientific, Vilnius, Lithuania).

Article Title: VEGF/ERK activation and PI3K inhibition together drive a vein-to-artery transition in an in vitro model of human angiogenesis
Article Snippet: Finally differentiating pre-vein ECs in CDM2 media supplemented with SB505124 (2 μM), RO4929097 (2 μM), PD0325901 (500 nM, Tocris), CHIR99021 (1 μM) and AA2P (200 μg/mL) for 24 hours yielded vECs.

Article Title: LINC01518 functions as an oncogene in head and neck squamous cell carcinoma (HNSCC) by modulating miR-1-3p/Slug and miR-216b-5p/GRP78 axis.
Article Snippet: Serum-starved HNSCC cells were treated with TGF-β1 (PeproTech, #100-21) in a serumfree medium for the dose and duration indicated in the figures and legends.

Control:

Article Title: circTGFBR2(3-6) acts as an assembly platform for RNA-binding protein IGF2BP3 and TGFBR1 mRNA to enhance breast cancer cell plasticity.
Article Snippet: siRNA transfection MDA-MB-231 cells (1.2 × 105) were seeded in 12-well plates and transfected with Lipofectamine 3000 (L3000015; Thermo Fisher Scientific, Vilnius, Lithuania) with 25 nM of either non-targeting siRNA (si-NT; Horizon Cambridge, UK), sicircTGFBR2(3-6) (GUCGUUAUUAACUCCCACUGCAUU; Horizon, Cambridge, UK), or si-AGO2 (L-004639-00-0005; Horizon, Cambridge, UK). .. A549 cells were treated with TGF-β (5 ng/mL in Fig. 3F and 1 ng/mL in Fig. 3G), SB505124 (SB; 1 μM; 3263; Tocris, Abingdon, UK), or vehicle control for 48 h. Cells were then stained with Phalloidin conjugated to Alexa Fluor 488 (1:500 dilution; A12379; Thermo Fisher Scientific, Bleiswijk, the Netherlands), as previously described [92]. .. RT‒qPCR To detect the expression of TGF-β target genes, MDA-MB-231 cells were treated with TGF-β (1 ng/ml) or a vehicle control for 8 h. Total RNA was isolated using the NucleoSpin RNA kit (740955; Macherey Nagel, Duren, Germany), and reverse transcription was performed with the RevertAid RT Reverse Transcription Kit (K1691; Thermo Fisher Scientific, Vilnius, Lithuania).

Staining:

Saline:

Article Title: Chronic cerebral hypoperfusion induces venous dysfunction via EPAS1 regulation in mice
Article Snippet: .. Pre-vein cells were differentiated into venous endothelial cells using CDM comprises 2 μM SB505124, 2 μM RO4929097, 500 nM PD0325901 (Tocris, 4192), 1 μM CHIR99021 and 200 μg/mL L-Ascorbic acid 2-phosphate sesquimagnesium, with a duration of 24 h. Notably, cells were briefly washed with Dulbecco’s Phosphate Buffered Saline (DPBS) (Cytiva, SH30028.03) to eliminate any residual traces of their respective induction medium before proceeding to the next stage of differentiation. .. Following differentiation, arterial endothelial cells were maintained in EGM-2 media (Lonza, cat no. CC-3162), and venous endothelial cells were maintained in EGM-2 media supplemented with 2 μM SB505124 and 2 μM RO4929097.

Similar Products

Image Search Results

$CD11c mediates phosphorylated SMAD3 nuclear translocation to perform its functions. (A) Left panel, representative confocal images showing p-SMAD3 levels in ITGAX- OE KYSE30 cells treated without or with TGFBR1 inhibitor SB505124. Antibody for each channel is labeled in the panels: p-SMAD3 (green), DiI (red, for cell membrane), and DAPI (blue, for cell nuclei). Right panel, quantitative results of mean fluorescence intensity of p-SMAD3. Data represent mean ± SEM from 3 independent experiments. (B) Left panel, representative confocal images showing ITGAX- KO (sg ITGAX ) KYSE30 cells treated without or with TGFβ1. Antibody for each channel is labeled in the panels: p-SMAD3 (green), DiI (red, for cell membrane), and DAPI (blue, for cell nuclei). Right panel, quantitative results of mean fluorescence intensity of p-SMAD3. Data represent mean ± SEM from 3 independent experiments. (C) Immunoblot of the coimmunoprecipitation products collected from whole cell lysates with SMAD3 (upper panel) or CD11c antibody (lower panel) in KYSE30 cells. (D) Western blot analysis of immunoprecipitation products collected using SMAD3 antibody shows the interaction of TGFBR1-SMAD3 in KYSE30 cells with ITGAX KO or OE. (E) Coimmunoprecipitation assay of the binding of CD11c truncated mutants and SMAD3 (Flag). (F) Cell membrane (marked by Na, K-ATPase), cytoplasm (marked by β-actin), and nucleus (marked by Lamin B1) fractions of ITGAX -OE KYSE30 cells were collected and subjected to IB analysis of p-SMAD3 and SMAD3. (G) Chromatin immunoprecipitation-coupled qPCR assays show enrichment of CD80 or CD86 promoter in cell lysates obtained with anti-p-SMAD3 antibody in KYSE30 cells stimulated with vehicle (Ctrl) or TGFβ1. (H) Luciferase reporter assays in KYSE30 cells using the indicated reporter plasmids of CD80 (left) or CD86 (right) promoters or siRNA targeting SMAD3 . Data are mean ± SEM from 3 experiments, and each had 3 replicates. P values from Student t test. Abbreviations: ITGAX , integrin alpha X; sgCtrl, single guide RNA control; sg ITGAX , single guide RNA targeting ITGAX gene; Vector, control for OE group; OE, overexpression; Δ, deletion; FG-GAP (1 and 2), Phenylalanine-Glycine-GAP repeat fragment 1 to 2; FG-GAP (3 to 7), Phenylalanine-Glycine-GAP repeat fragment 3 to 7; ICD, intracellular domain; Wt- CD80 -P, wild-type CD80 promoter; Mut -CD80 -P, mutant-type CD80 promoter (without p-SMAD3 binding motif); Wt- CD86 -P, wild-type CD86 promoter; Mut- CD86 -P, mutant-type CD86 promoter (without p-SMAD3 binding motif); SMAD3, mothers against decapentaplegic homolog 3; p-SMAD3, phosphorylated SMAD3;. HA, HA tag, CD11c-Δ; Flag, Flag-SMAD3; TGFBR1, transforming growth factor beta receptor I; IB, immunoblot; IP, immunoprecipitation; TGFβ1, transforming growth factor beta 1; Ctrl, control.$

Journal: Cancer Communications

Article Title: Ectopic CD11c Drives SMAD3-Mediated Aberrant Antigen Presentation and Epithelial–Mesenchymal Transition in Esophageal Squamous Cell Carcinoma

doi: 10.34133/cancomm.0014

Figure Lengend Snippet: CD11c mediates phosphorylated SMAD3 nuclear translocation to perform its functions. (A) Left panel, representative confocal images showing p-SMAD3 levels in ITGAX- OE KYSE30 cells treated without or with TGFBR1 inhibitor SB505124. Antibody for each channel is labeled in the panels: p-SMAD3 (green), DiI (red, for cell membrane), and DAPI (blue, for cell nuclei). Right panel, quantitative results of mean fluorescence intensity of p-SMAD3. Data represent mean ± SEM from 3 independent experiments. (B) Left panel, representative confocal images showing ITGAX- KO (sg ITGAX ) KYSE30 cells treated without or with TGFβ1. Antibody for each channel is labeled in the panels: p-SMAD3 (green), DiI (red, for cell membrane), and DAPI (blue, for cell nuclei). Right panel, quantitative results of mean fluorescence intensity of p-SMAD3. Data represent mean ± SEM from 3 independent experiments. (C) Immunoblot of the coimmunoprecipitation products collected from whole cell lysates with SMAD3 (upper panel) or CD11c antibody (lower panel) in KYSE30 cells. (D) Western blot analysis of immunoprecipitation products collected using SMAD3 antibody shows the interaction of TGFBR1-SMAD3 in KYSE30 cells with ITGAX KO or OE. (E) Coimmunoprecipitation assay of the binding of CD11c truncated mutants and SMAD3 (Flag). (F) Cell membrane (marked by Na, K-ATPase), cytoplasm (marked by β-actin), and nucleus (marked by Lamin B1) fractions of ITGAX -OE KYSE30 cells were collected and subjected to IB analysis of p-SMAD3 and SMAD3. (G) Chromatin immunoprecipitation-coupled qPCR assays show enrichment of CD80 or CD86 promoter in cell lysates obtained with anti-p-SMAD3 antibody in KYSE30 cells stimulated with vehicle (Ctrl) or TGFβ1. (H) Luciferase reporter assays in KYSE30 cells using the indicated reporter plasmids of CD80 (left) or CD86 (right) promoters or siRNA targeting SMAD3 . Data are mean ± SEM from 3 experiments, and each had 3 replicates. P values from Student t test. Abbreviations: ITGAX , integrin alpha X; sgCtrl, single guide RNA control; sg ITGAX , single guide RNA targeting ITGAX gene; Vector, control for OE group; OE, overexpression; Δ, deletion; FG-GAP (1 and 2), Phenylalanine-Glycine-GAP repeat fragment 1 to 2; FG-GAP (3 to 7), Phenylalanine-Glycine-GAP repeat fragment 3 to 7; ICD, intracellular domain; Wt- CD80 -P, wild-type CD80 promoter; Mut -CD80 -P, mutant-type CD80 promoter (without p-SMAD3 binding motif); Wt- CD86 -P, wild-type CD86 promoter; Mut- CD86 -P, mutant-type CD86 promoter (without p-SMAD3 binding motif); SMAD3, mothers against decapentaplegic homolog 3; p-SMAD3, phosphorylated SMAD3;. HA, HA tag, CD11c-Δ; Flag, Flag-SMAD3; TGFBR1, transforming growth factor beta receptor I; IB, immunoblot; IP, immunoprecipitation; TGFβ1, transforming growth factor beta 1; Ctrl, control.

Article Snippet: For the treatment with rhTGFβ1 (Proteintech, Cat. #HZ-1011) or transforming growth factor beta receptor I (TGFBR1) inhibitor SB505124 (Selleck, Cat. #S2186), the reagents were dissolved in phosphate-buffered saline (PBS) and added to cell culture medium at a final concentration of 10 ng/ml rhTGFβ1 or 10 μ mol/l SB505124.

Techniques: Translocation Assay, Labeling, Membrane, Fluorescence, Western Blot, Immunoprecipitation, Co-Immunoprecipitation Assay, Binding Assay, Chromatin Immunoprecipitation, Luciferase, Control, Plasmid Preparation, Over Expression, Mutagenesis

Ectopic CD11c expression in epithelial cells is associated with TP53 mutations. (A) Copy number variations of the ITGAX gene in multistage human ESCC development . Each point indicates a micro-biopsy sample. Sample size at each stage: NOR, 603; LGIN, 245; HGIN, 247; and ESCC, 180. (B) Levels of ITGAX copy number (GISTIC score) among human esophageal epithelial clones with different TP53 states . Each point represents one epithelial clone. Sample size for each group: WT, 35; 1 mut, 24; >1 mut, 8; and Loss, 11. (C) Effect of TP53- knockout on ITGAX copy number in human esophageal epithelial cells. Top: Representative images of ITGAX copy number in TP53 -unknockout or TP53 -knockout HET-1A, KYSE150, and KYSE30 cells with ITGAX -specific probe (red, arrow pointed). Bottom: Quantitative statistics of the percentage of cells with ITGAX copy number in TP53 -unknockout versus TP53 -knockout cells. The number of cells ( n ) obtained from 3 independent experiments is indicated on each bar. (D) Immunoblot of CD11c in HET-1A, KYSE150, and KYSE30 cells with or without TP53 KO. Each experiment had 3 biological repeats. (E) Proposed role of ectopically expressed CD11c for cancer cells to escape immune killing and acquire malignant phenotypes. TP53 loss-associated ITGAX amplification results in CD11c ectopic overexpression in epithelial cells. CD11c interacts with SMAD3 and enhances its binding to TGFβ/TGFBR1, promoting SMAD3 phosphorylation. Hyperactivated SMAD3 subsequently translocates to the nucleus, where it suppresses CD80/CD86 transcription while up-regulating the levels of MHC class II molecules. Together, these changes impair tumor cell-mediated antigen presentation and induce EMT, thereby promoting cancer development. In (A) to (C), P values were from the Wilcoxon rank-sum test. ns, not significant. Abbreviations: ITGAX , integrin alpha X; NOR, normal epithelial tissue; INF, inflammatory tissue; LGIN, low-grade intraepithelial neoplasia tissue; HGIN, high-grade intraepithelial neoplasia tissue; ESCC, esophageal squamous cell carcinoma; GISTIC, Genomic Identification of Significant Targets in Cancer; WT, wild type; 1 mut, one mutation; >1 mut, multiple mutations; Loss, TP53 biallelic loss; Ctrl, control; EMT, epithelial–mesenchymal transition; SMAD3, mothers against decapentaplegic homolog 3; P, phosphorylation; TGFβ, transforming growth factor beta; TGFBR1, transforming growth factor beta receptor I; Treg, regulatory T cell; MHC II, major histocompatibility complex class II.

Journal: Cancer Communications

Article Title: Ectopic CD11c Drives SMAD3-Mediated Aberrant Antigen Presentation and Epithelial–Mesenchymal Transition in Esophageal Squamous Cell Carcinoma

doi: 10.34133/cancomm.0014

Figure Lengend Snippet: Ectopic CD11c expression in epithelial cells is associated with TP53 mutations. (A) Copy number variations of the ITGAX gene in multistage human ESCC development . Each point indicates a micro-biopsy sample. Sample size at each stage: NOR, 603; LGIN, 245; HGIN, 247; and ESCC, 180. (B) Levels of ITGAX copy number (GISTIC score) among human esophageal epithelial clones with different TP53 states . Each point represents one epithelial clone. Sample size for each group: WT, 35; 1 mut, 24; >1 mut, 8; and Loss, 11. (C) Effect of TP53- knockout on ITGAX copy number in human esophageal epithelial cells. Top: Representative images of ITGAX copy number in TP53 -unknockout or TP53 -knockout HET-1A, KYSE150, and KYSE30 cells with ITGAX -specific probe (red, arrow pointed). Bottom: Quantitative statistics of the percentage of cells with ITGAX copy number in TP53 -unknockout versus TP53 -knockout cells. The number of cells ( n ) obtained from 3 independent experiments is indicated on each bar. (D) Immunoblot of CD11c in HET-1A, KYSE150, and KYSE30 cells with or without TP53 KO. Each experiment had 3 biological repeats. (E) Proposed role of ectopically expressed CD11c for cancer cells to escape immune killing and acquire malignant phenotypes. TP53 loss-associated ITGAX amplification results in CD11c ectopic overexpression in epithelial cells. CD11c interacts with SMAD3 and enhances its binding to TGFβ/TGFBR1, promoting SMAD3 phosphorylation. Hyperactivated SMAD3 subsequently translocates to the nucleus, where it suppresses CD80/CD86 transcription while up-regulating the levels of MHC class II molecules. Together, these changes impair tumor cell-mediated antigen presentation and induce EMT, thereby promoting cancer development. In (A) to (C), P values were from the Wilcoxon rank-sum test. ns, not significant. Abbreviations: ITGAX , integrin alpha X; NOR, normal epithelial tissue; INF, inflammatory tissue; LGIN, low-grade intraepithelial neoplasia tissue; HGIN, high-grade intraepithelial neoplasia tissue; ESCC, esophageal squamous cell carcinoma; GISTIC, Genomic Identification of Significant Targets in Cancer; WT, wild type; 1 mut, one mutation; >1 mut, multiple mutations; Loss, TP53 biallelic loss; Ctrl, control; EMT, epithelial–mesenchymal transition; SMAD3, mothers against decapentaplegic homolog 3; P, phosphorylation; TGFβ, transforming growth factor beta; TGFBR1, transforming growth factor beta receptor I; Treg, regulatory T cell; MHC II, major histocompatibility complex class II.

Techniques: Expressing, Clone Assay, Knock-Out, Western Blot, Amplification, Over Expression, Binding Assay, Phospho-proteomics, Immunopeptidomics, Mutagenesis, Control

Review

Structured Review

Images

Related Articles

Shear:

In Vivo:

Functional Assay:

Concentration Assay:

Generated:

other:

Control:

Staining:

Saline:

Similar Products

Image Search Results