Review



crgdyk peptide  (MedChemExpress)


Bioz Verified Symbol MedChemExpress is a verified supplier
Bioz Manufacturer Symbol MedChemExpress manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    MedChemExpress crgdyk peptide
    The construction and characterization of OE‐ACAD11@R‐PLT. (A) Schematic representation of the construction of OE‐ACAD11@R‐PLT. (B) The size distribution of PLT, OE‐ACAD11, <t>cRGDyk,</t> and OE‐ACAD11@R‐PLT. (C) The zeta potential of PLT, cRGDyk, OE‐ACAD11, and OE‐ACAD11@R‐PLT. (D) SEM images of raw PLT and OE‐ACAD11@R‐PLT. (E) The marker protein (CD62P, CD61, CD41, and GAPDH) in raw PLT and OE‐ACAD11@R‐PLT. (F) CLSM results of OE‐ACAD11@R‐PLT. Green, FITC‐labeled PLTs. <t>Red,</t> <t>Cy5‐labeled</t> cRGDyk. (G) Drug loading efficiency and encapsulation rate of OE‐ACAD11@R‐PLT.
    Crgdyk Peptide, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 97/100, based on 106 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peptides/CY5/pmc13650033-67-2-8
    Average 97 stars, based on 106 article reviews
    crgdyk peptide - by Bioz Stars, 2026-10
    97/100 stars

    Images

    1) Product Images from "A Biomimetic cRGDyk‐Engineered Platelet Nanoplatform for ACAD11 Delivery to Trigger Pyroptosis in Hepatocellular Carcinoma"

    Article Title: A Biomimetic cRGDyk‐Engineered Platelet Nanoplatform for ACAD11 Delivery to Trigger Pyroptosis in Hepatocellular Carcinoma

    Journal: Advanced Science

    doi: 10.1002/advs.78219

    The construction and characterization of OE‐ACAD11@R‐PLT. (A) Schematic representation of the construction of OE‐ACAD11@R‐PLT. (B) The size distribution of PLT, OE‐ACAD11, cRGDyk, and OE‐ACAD11@R‐PLT. (C) The zeta potential of PLT, cRGDyk, OE‐ACAD11, and OE‐ACAD11@R‐PLT. (D) SEM images of raw PLT and OE‐ACAD11@R‐PLT. (E) The marker protein (CD62P, CD61, CD41, and GAPDH) in raw PLT and OE‐ACAD11@R‐PLT. (F) CLSM results of OE‐ACAD11@R‐PLT. Green, FITC‐labeled PLTs. Red, Cy5‐labeled cRGDyk. (G) Drug loading efficiency and encapsulation rate of OE‐ACAD11@R‐PLT.
    Figure Legend Snippet: The construction and characterization of OE‐ACAD11@R‐PLT. (A) Schematic representation of the construction of OE‐ACAD11@R‐PLT. (B) The size distribution of PLT, OE‐ACAD11, cRGDyk, and OE‐ACAD11@R‐PLT. (C) The zeta potential of PLT, cRGDyk, OE‐ACAD11, and OE‐ACAD11@R‐PLT. (D) SEM images of raw PLT and OE‐ACAD11@R‐PLT. (E) The marker protein (CD62P, CD61, CD41, and GAPDH) in raw PLT and OE‐ACAD11@R‐PLT. (F) CLSM results of OE‐ACAD11@R‐PLT. Green, FITC‐labeled PLTs. Red, Cy5‐labeled cRGDyk. (G) Drug loading efficiency and encapsulation rate of OE‐ACAD11@R‐PLT.

    Techniques Used: Zeta Potential Analyzer, Marker, Labeling, Encapsulation

    Related Articles

    Virus:

    Article Title: A combined "eat me/don't eat me" strategy based on exosome for acute liver injury treatment.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TSG101 Proteintech Cat# 28283-1-AP; RRID:AB_2881104 Anti-VDAC1 Proteintech Cat# 55259-1-AP; RRID:AB_10837225 Anti-Flotillin 1 Proteintech Cat# 15571-1-AP; RRID:AB_2106746 Anti-Wnt2 ABclonal Cat# A23997; RRID:AB_3677320 Anti-CD47 ABclonal Cat# A21904; RRID:AB_3677321 Anti-LYVE1 Invitrogen Cat# 14-0443-82; RRID:AB_1633414 Anti-CLEC4F Invitrogen Cat# PA5-47396; RRID:AB_2608299 Anti-F4/80 Servicebio Cat# GB113373-100; RRID: AB_3677324 Anti-LY6G Proteintech Cat# 65078-1-Ig; RRID:AB_2918382 Anti-Ki67 Servicebio Cat# GB111141-100; RRID: AB_3677325 PE anti-mouse CD31 BioLegend Cat# 102407; RRID:AB_312902 APC anti-mouse F4/80 BioLegend Cat# 123115; RRID:AB_893493 Anti-Rabbit IgG H&L (HRP Conjugated) ZENBIO Cat# 511203; RRID:AB_2927753 Anti-Mouse IgG H&L (HRP Conjugated) ZENBIO Cat# 511103; RRID:AB_2893489 Donkey anti-Rat IgG H&L (Alexa Fluor 594) Invitrogen Cat# A21209; RRID:AB_2535795 Donkey anti-Rat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A48269; RRID:AB_2893137 Donkey anti-Goat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A32814; RRID:AB_2762838 Donkey anti-Rabbit IgG H&L (CY3) Servicebio Cat# GB21403; RRID:AB_2818951 Bacterial and virus strains CD47 overexpressing lentiviral vector Hanbio JY20230330ZY-LP01 Wnt2 overexpressing lentiviral vector Hanbio HH20230916ZY-LV01 Biological samples Liver Serum Primary liver sinusoidal endothelial cell Primary hepatocyte Mice in this study N/A Chemicals, peptides, and recombinant proteins DMPE-PEG2000-CRLTRKRGLK Ruixibio R-DMK-0125 Acetaminophen MCE HY-66005 Dimethylnitrosamine TCI D0761 Puromycin, Sterile MCE HY-K1057 Blasticidin S, Sterile MCE HY-K1054 TRizolTM Invitrogen 15596026 Fetal bovine serum BioInd 1706126 Dulbecco’s Modified Eagle’s Medium Gibco C11995500 DiI Yeasen 40726ES10 DiO Yeasen 40725ES10 TRITC Phalloidin Yeasen 40734ES75 Cell Counting Kit-8 TargetMol C0005 Critical commercial assays SYBR Green Pro Taq HS qPCR kit Accurate Biology 11701 Mouse Protein Wnt-2 (WNT2) ELISA kit CUSABIO CSB-EL026133MO One Step TUNEL Apoptosis Assay Kit Beyotime C1089 Mouse cluster of differentiation 47 (CD47) ELISA Kit Jonlnbio JL49445 (Continued on next page) Cell Reports Medicine 6, 102033, April 15, 2025 e1 OPEN ACCESS .. Experimental mouse models and exosomes injection 8- to 10-week-old C57BL/6 mice (male) were purchased from Charles River Laboratories.

    Article Title: NFE2-driven neutrophil polarization promotes pancreatic cancer liver metastasis progression.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat Anti-Rabbit IgG H&L (HRP) Abcam Cat# ab205718; RRID:AB_2819160 Recombinant Anti-S100A12/CGRP antibody Abcam Cat# ab272713; RRID:AB_2920851 Recombinant Anti-S100A8 + S100A9 antibody Abcam Cat# ab288715 PADI4 antibody Proteintech Cat# 17373-1-AP; RRID:AB_2878398 Recombinant Anti-MMP9 antibody Abcam Cat# ab283575; RRID:AB_2928971 TGM2 antibody Proteintech Cat# 15100-1-AP; RRID:AB_2202885 Galectin-3 Polyclonal antibody Proteintech Cat# 14979-1-AP; RRID:AB_2136768 Recombinant Anti-Ly6g antibody Abcam Cat# ab238132; RRID:AB_2923218 MPO antibody Proteintech Cat# 22225-1-AP; RRID:AB_2879037 Recombinant Anti-CD66b antibody Abcam Cat# ab300122; RRID:AB_3097803 Mouse Anti-CD68 Monoclonal Antibody, Unconjugated, Clone KP1 Abcam Cat# ab955; RRID:AB_307338 NFE2 antibody Proteintech Cat# 11089-1-AP; RRID:AB_2152928 Recombinant Anti-Histone H3 (citrulline R2 + R8 + R17) antibody Abcam Cat# ab281584 Recombinant Anti-Macrophage Inflammatory Protein 1 alpha/CCL3 + CCL3L1 antibody Abcam Cat# ab259372; RRID:AB_3094596 ISG15 antibody Proteintech Cat# 15981-1-AP; RRID:AB_2126302 GRO Alpha antibody Proteintech Cat# 12335-1-AP; RRID:AB_2087568 HSPA6 antibody Proteintech Cat# 13616-1-AP; RRID:AB_2120122 RPS19 antibody Proteintech Cat# 15085-1-AP; RRID:AB_2180202 Fixable Viability Stain 780 BD Biosciences Cat# 565388; RRID:AB_2869673 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc BlockTM) Clone 2.4G2 BD Biosciences Cat# 553141; RRID:AB_394656 FITC anti-mouse CD45 Recombinant BioLegend Cat# 157608; RRID:AB_2832554 Brilliant Violet 421(TM) anti-mouse/human CD11b BioLegend Cat# 101235; RRID:AB_10897942 PE anti-mouse Ly-6G BioLegend Cat# 127607; RRID:AB_1186104 Alexa Fluor(R) 700 anti-mouse CD3 BioLegend Cat# 100216; RRID:AB_493697 Brilliant Violet 510(TM) anti-mouse CD8a BioLegend Cat# 100752; RRID:AB_2563057 PerCP/Cyanine5.5 anti-mouse F4/80 BioLegend Cat# 123128; RRID:AB_893484 PE/Cyanine7 anti-mouse CD279 (PD-1) BioLegend Cat# 109110; RRID:AB_572017 HRP-conjugated goat anti-mouse secondary antibody Zsbio ZB-2305 HRP-conjugated goat anti-rabbit secondary antibody Zsbio ZB-2306 Bacterial and virus strains LV-Tgfb1-RNAi Genechem N/A LV-Luciferase Genechem N/A Biological samples Surgical excision samples Peking Union Medical College Hospital N/A Chemicals, peptides, and recombinant proteins SM16 MedChemExpress Cat# HY-111482 Cl-amidine Selleck Cat# S8141 (Continued on next page) 16 Cell Reports 44, 115226, February 25, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER anti-mouse Ly6G BioXcell Cat# BE0075-1 IgG2a isotype control BioXcell Cat# BE0085 SB431542 MedChemExpress Cat# HY-10431 HumanKine recombinant human TGF-b Proteintech Cat# HZ-1011 Collagenase IV Thermo Fisher SCIENTIFIC Cat# 17104019 DNase I Thermo Fisher SCIENTIFIC Cat# 90083 Dispase II Thermo Fisher SCIENTIFIC Cat# 17105041 Heparin sodium MedChemExpress Cat# HY-17567A EGTA Beyotime Biotechnology Ca# ST068 DMEM/F12 Gibco Cat# 11320033 DMEM Gibco Cat# 11965118 IMDM Procell Cat# PM150510 RPMI-1640 Procell Cat# PM150110 PBS Procell Cat# PB180327 FBS Thermo Fisher SCIENTIFIC Cat# A3160901 BSA Beyotime Biotechnology Cat# ST023 DPBS Thermo Fisher SCIENTIFIC Cat# 14190144 Percoll Cytiva Cat# 17089101 Penicillin-Streptomycin Solution Beyotime Biotechnology Cat# C0222 Puromycin MedChemExpress Cat# HY-B1743A DMSO Thermo Fisher SCIENTIFIC Cat# D12345 Lipofectamine 3000 Transfection Reagent Thermo Fisher SCIENTIFIC Cat# L3000001 RIPA Lysis Buffer APPLYGEN Cat# C1053-100 Protease inhibitor cocktail Aqlabtech Cat# AQ551 Phosphatase inhibitor APPLYGEN Cat# P1260 PMSF Beyotime Biotechnology Cat# ST505 Skim milk Aqlabtech Cat# AQ62321 SYBR Green Master Mix Thermo Fisher SCIENTIFIC Cat# A25742 Crystal violet Beyotime Biotechnology Cat# C0121 Red Blood Cell Lysis Buffer Beyotime Biotechnology Cat# C3702 G418 Beyotime Biotechnology Cat# ST081 Critical commercial assays Single Cell 30 GEM, Library & Gel Bead Kit V3.1 10x Genomics N/A Chromium Single Cell B Chip Kit 10x Genomics N/A PANO 7-plex IHC kit Panovue Cat# 0004100100 Dual Luciferase Reporter Assay Promega Cat# E1910 SF Cell Line 4D-NucleofectorTM X Kit S Lonza Bioscience Cat# V4XC-2024 Human Monocyte Nucleofector Kit Lonza Bioscience Cat# VPA-1007 Enhanced BCA Protein Assay Kit Beyotime Biotechnology Cat# P0010 Super ECL Reagent Aqlabtech Cat# AQ529 RNA-Quick Purification Kit ESScience Cat# RN001 PrimeScript RT reagent Kit Takara Cat# RR047A Mouse TGF-beta 1 ELISA Kit RayBiotech Cat# P04202 MycoBlue Mycoplasma Detector Kit Vazyme Cat# D101 Cell counting kit 8 Dojindo Cat# CK04-05 Deposited data scRNA-seq and ST data This paper GSE281288 JASPAR database https://jaspar.genereg.net/ TCGA data https://xenabrowser.net/ (Continued on next page) Cell Reports 44, 115226, February 25, 2025 17

    Article Title: MIF-ACKR3 causes irreversible fat loss by impairing adipogenesis in cancer cachexia.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (clone D13.14.4E; 1:1000 dilution) Cell Signaling Technology Cat# 4370; RRID: AB_2315112 Rabbit monoclonal anti-p44/42 MAPK (Erk1/2) (clone 137F5; 1:1000 dilution) Cell Signaling Technology Cat# 4695; RRID: AB_390779 Rabbit monoclonal anti-phospho-IkBa (Ser32) (clone 14D4; 1:1000 dilution) Cell Signaling Technology Cat# 2859; RRID: AB_561111 Mouse monoclonal anti-IkBa (clone L35A5; 1:1000 dilution) Cell Signaling Technology Cat# 4814; RRID: AB_390781 Rabbit polyclonal anti-GPCR RDC1/CXCR-7 (1:100 dilution) Abcam Cat# ab117836; RRID: AB_10903623 Rabbit monoclonal anti-GRK2 (clone HL1562; 1:1000 dilution) GeneTex Cat# GTX637038 Mouse Monoclonal anti-b-Tubulin (HRP Conjugated; 1:3000 dilution) Beyotime Cat# AF2839 Anti-Mouse CD45 FITC (clone 30-F11; 1:100 dilution) BD Biosciences Cat# 561088 Rabbit monoclonal anti-Collagen VI (clone EPR17072; 1:250) Abcam Cat# ab182744; RRID: AB_2847919 Rabbit monoclonal anti- Fibronectin (clone EPR23110-46; 1:2000) Abcam Cat# ab268020; RRID: AB_2941028 HRP-conjugated goat anti-rabbit/mouse secondary antibody GeneTech Cat# GK500705 Goat Anti-Rabbit IgG (H&L)-HRP Conjugated EASYBIO Cat# BE0101-100 Goat Anti-Mouse IgG (H&L)-HRP Conjugated EASYBIO Cat# BE0102-100 Bacterial and virus strains HBAD-Cre HanBio Cat#HH20230208GX-AP01 Biological samples Human peripheral blood from healthy donors Dazhou Central Hospital See Table S5 for details Human peripheral blood from LUAD patients Dazhou Central Hospital See Table S5 for details Human abdominal subcutaneous adipose tissue samples from LUAD patients Dazhou Central Hospital See Table S5 for details Chemicals, peptides, and recombinant proteins ISO-1 MedChemExpress Cat# HY-16692 Dulbecco’s Modified Eagle Medium (DMEM) Solarbio Cat# 11965 Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F-12) Solarbio Cat# D6570 RPMI-1640 medium Invitrogen Cat# 11875093 Tissue storage solution Miltenyi Biotec Cat# 130-100-008 Fetal bovine serum (FBS) Vistech Cat# SE100-B Goat serum Beyotime Cat# C0256 Penicillin-streptomycin Gibco Cat# 15070063 Collagenase Type II Gibco Cat# 17101015 Red Blood Cell Lysis Buffer Beyotime Cat# C3702-500 mL Insulin (10 mg/mL) Sigma–Aldrich Cat# I9278 (Continued on next page) e1 Cell Metabolism 37, 1–17.e1–e8, April 1, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER 3-isobutyl-1-methylxantine (0.5mM) MedChemExpress Cat# HY-dd12318 Dexamethasone (1 mM) MedChemExpress Cat# HY-14648 Rosiglitazone (2.5 mM) MedChemExpress Cat# HY-17386 Mouse recombinant MIF MedChemExpress Cat# HY-P7388 Gallein (10 mM) MedChemExpress Cat# HY-D0254 PTX (100 ng/mL) List Biological Laboratories Cat# 180 TRIzol Invitrogen Cat# 15596026 Hifair III 1st Strand cDNA Synthesis SuperMix Yeasen Cat# 11141ES60 ChamQ SYBR qPCR Master Mix Vazyme Cat# Q321-02 Lipofectamine RNAiMAX Thermo Fisher Scientific Cat# 13778030 4% paraformaldehyde fix solution Beyotime Cat# P0099-500mL RIPA lysis buffer Solarbio Cat# R0010 Critical commercial assays Glycerol Assay Kit Nanjing Jiancheng Bioengineering Institute Cat# F005-1-1 NEB Next Ultra RNA Library Prep Kit for Illumina NEB Cat# E7530S Chromium Next GEM Single Cell 30 GEM, Library & Gel Bead Kit 10x Genomics Cat# PN-1000121 Chromium Next GEM Chip G Single Cell Kit 10x Genomics Cat# PN-1000120 Oil Red O Staining Kit Beyotime Cat# C0158M Masson’s Trichrome Staining Kit Solarbio Cat# G1340 DAB Horseradish Peroxidase Color Development Kit Beyotime Cat# P0203 Mouse MIF SimpleStep ELISA Kit Abcam Cat# ab209885 Human MIF ELISA Kit Multi Sciences Cat# EK1158 Mouse Tumor Necrosis Factor a (TNF-a) ELISA Kit Cusabio Cat# CSB-E04741m Mouse Interleukin 1b (IL-1b) ELISA Kit Cusabio Cat# CSB-E08054m Mouse Interleukin 6 (IL-6) ELISA KIT Cusabio Cat# CSB-E04639m BCA protein assay kit Thermo Fisher Scientific Cat# 23227 NF-kB activation-nuclear translocation assay kit Beyotime Cat# SN371 Deposited data Source data This paper Data S1 Source Data Data files for sequencing data for cachexia mouse model (raw data) This paper GSA: CRA009162 Data files for sequencing data for human adipose tissue (raw data) This paper GSA: HRA003574 scRNA-seq dataset of human and mice white adipose tissue Emont et al.8 SCP: SCP1376 scRNA-seq dataset of mice white adipose tissue Burl et al.9 SRA: SRP145475 scRNA-seq dataset of mice white adipose tissue Hepler et al.10 GEO: GSE111588 scRNA-seq dataset of mice white adipose tissue Merrick et al.11 GEO: dGSE128889 snRNA-seq dataset of mice white adipose tissue Sárvári et al.12 SCP: SCP1179 scRNA-seq dataset of mice white adipose tissue Schwalie et al.13 ArrayExpress: E-MTAB-5785, E-MTAB-5818, E-MTAB-5802, E-MTAB-5787 and E-MTAB-6677 (Continued on next page) Cell Metabolism 37, 1–17.e1–e8, April 1, 2025 e2

    Plasmid Preparation:

    Article Title: A combined "eat me/don't eat me" strategy based on exosome for acute liver injury treatment.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TSG101 Proteintech Cat# 28283-1-AP; RRID:AB_2881104 Anti-VDAC1 Proteintech Cat# 55259-1-AP; RRID:AB_10837225 Anti-Flotillin 1 Proteintech Cat# 15571-1-AP; RRID:AB_2106746 Anti-Wnt2 ABclonal Cat# A23997; RRID:AB_3677320 Anti-CD47 ABclonal Cat# A21904; RRID:AB_3677321 Anti-LYVE1 Invitrogen Cat# 14-0443-82; RRID:AB_1633414 Anti-CLEC4F Invitrogen Cat# PA5-47396; RRID:AB_2608299 Anti-F4/80 Servicebio Cat# GB113373-100; RRID: AB_3677324 Anti-LY6G Proteintech Cat# 65078-1-Ig; RRID:AB_2918382 Anti-Ki67 Servicebio Cat# GB111141-100; RRID: AB_3677325 PE anti-mouse CD31 BioLegend Cat# 102407; RRID:AB_312902 APC anti-mouse F4/80 BioLegend Cat# 123115; RRID:AB_893493 Anti-Rabbit IgG H&L (HRP Conjugated) ZENBIO Cat# 511203; RRID:AB_2927753 Anti-Mouse IgG H&L (HRP Conjugated) ZENBIO Cat# 511103; RRID:AB_2893489 Donkey anti-Rat IgG H&L (Alexa Fluor 594) Invitrogen Cat# A21209; RRID:AB_2535795 Donkey anti-Rat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A48269; RRID:AB_2893137 Donkey anti-Goat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A32814; RRID:AB_2762838 Donkey anti-Rabbit IgG H&L (CY3) Servicebio Cat# GB21403; RRID:AB_2818951 Bacterial and virus strains CD47 overexpressing lentiviral vector Hanbio JY20230330ZY-LP01 Wnt2 overexpressing lentiviral vector Hanbio HH20230916ZY-LV01 Biological samples Liver Serum Primary liver sinusoidal endothelial cell Primary hepatocyte Mice in this study N/A Chemicals, peptides, and recombinant proteins DMPE-PEG2000-CRLTRKRGLK Ruixibio R-DMK-0125 Acetaminophen MCE HY-66005 Dimethylnitrosamine TCI D0761 Puromycin, Sterile MCE HY-K1057 Blasticidin S, Sterile MCE HY-K1054 TRizolTM Invitrogen 15596026 Fetal bovine serum BioInd 1706126 Dulbecco’s Modified Eagle’s Medium Gibco C11995500 DiI Yeasen 40726ES10 DiO Yeasen 40725ES10 TRITC Phalloidin Yeasen 40734ES75 Cell Counting Kit-8 TargetMol C0005 Critical commercial assays SYBR Green Pro Taq HS qPCR kit Accurate Biology 11701 Mouse Protein Wnt-2 (WNT2) ELISA kit CUSABIO CSB-EL026133MO One Step TUNEL Apoptosis Assay Kit Beyotime C1089 Mouse cluster of differentiation 47 (CD47) ELISA Kit Jonlnbio JL49445 (Continued on next page) Cell Reports Medicine 6, 102033, April 15, 2025 e1 OPEN ACCESS .. Experimental mouse models and exosomes injection 8- to 10-week-old C57BL/6 mice (male) were purchased from Charles River Laboratories.

    Mouse Assay:

    Article Title: A combined "eat me/don't eat me" strategy based on exosome for acute liver injury treatment.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TSG101 Proteintech Cat# 28283-1-AP; RRID:AB_2881104 Anti-VDAC1 Proteintech Cat# 55259-1-AP; RRID:AB_10837225 Anti-Flotillin 1 Proteintech Cat# 15571-1-AP; RRID:AB_2106746 Anti-Wnt2 ABclonal Cat# A23997; RRID:AB_3677320 Anti-CD47 ABclonal Cat# A21904; RRID:AB_3677321 Anti-LYVE1 Invitrogen Cat# 14-0443-82; RRID:AB_1633414 Anti-CLEC4F Invitrogen Cat# PA5-47396; RRID:AB_2608299 Anti-F4/80 Servicebio Cat# GB113373-100; RRID: AB_3677324 Anti-LY6G Proteintech Cat# 65078-1-Ig; RRID:AB_2918382 Anti-Ki67 Servicebio Cat# GB111141-100; RRID: AB_3677325 PE anti-mouse CD31 BioLegend Cat# 102407; RRID:AB_312902 APC anti-mouse F4/80 BioLegend Cat# 123115; RRID:AB_893493 Anti-Rabbit IgG H&L (HRP Conjugated) ZENBIO Cat# 511203; RRID:AB_2927753 Anti-Mouse IgG H&L (HRP Conjugated) ZENBIO Cat# 511103; RRID:AB_2893489 Donkey anti-Rat IgG H&L (Alexa Fluor 594) Invitrogen Cat# A21209; RRID:AB_2535795 Donkey anti-Rat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A48269; RRID:AB_2893137 Donkey anti-Goat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A32814; RRID:AB_2762838 Donkey anti-Rabbit IgG H&L (CY3) Servicebio Cat# GB21403; RRID:AB_2818951 Bacterial and virus strains CD47 overexpressing lentiviral vector Hanbio JY20230330ZY-LP01 Wnt2 overexpressing lentiviral vector Hanbio HH20230916ZY-LV01 Biological samples Liver Serum Primary liver sinusoidal endothelial cell Primary hepatocyte Mice in this study N/A Chemicals, peptides, and recombinant proteins DMPE-PEG2000-CRLTRKRGLK Ruixibio R-DMK-0125 Acetaminophen MCE HY-66005 Dimethylnitrosamine TCI D0761 Puromycin, Sterile MCE HY-K1057 Blasticidin S, Sterile MCE HY-K1054 TRizolTM Invitrogen 15596026 Fetal bovine serum BioInd 1706126 Dulbecco’s Modified Eagle’s Medium Gibco C11995500 DiI Yeasen 40726ES10 DiO Yeasen 40725ES10 TRITC Phalloidin Yeasen 40734ES75 Cell Counting Kit-8 TargetMol C0005 Critical commercial assays SYBR Green Pro Taq HS qPCR kit Accurate Biology 11701 Mouse Protein Wnt-2 (WNT2) ELISA kit CUSABIO CSB-EL026133MO One Step TUNEL Apoptosis Assay Kit Beyotime C1089 Mouse cluster of differentiation 47 (CD47) ELISA Kit Jonlnbio JL49445 (Continued on next page) Cell Reports Medicine 6, 102033, April 15, 2025 e1 OPEN ACCESS .. Experimental mouse models and exosomes injection 8- to 10-week-old C57BL/6 mice (male) were purchased from Charles River Laboratories.

    Article Title: IRE1α regulates macrophage phagocytosis in immune thrombocytopenia through NR1D1 mRNA decay and lysosomal biogenesis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies for Platelet Depletion in Mice Emfret Cat#R300 RRID:AB_2721041 Phosphorylated IRE1α at Ser724 (p-IRE1α) Novus Biologicals Cat#NB100-2323 RRID:AB_3151655 NR1D1 Recombinant Rabbit Monoclonal Antibody HUABIO Cat#ET7106-92 RRID:AB_3070710 ATF4 Recombinant Rabbit Monoclonal Antibody HUABIO Cat#ET1612-37 RRID:AB_3070110 Anti-eIF2 alpha Antibody HUABIO Cat#ET7111-34 RRID:AB_3071091 Anti-XBP1 Antibody Abcam Cat#ab220783 RRID:AB_2920809 Anti-GAPDH Antibody Abcam Cat#ab181602 RRID:AB_2630358 IRE1 alpha (14C10) Rabbit Monoclonal Antibody Cell Signaling Technology Cat#3294T RRID:AB_823545 Phospho-eIF2 alpha (Ser51) Antibody Cell Signaling Technology Cat#9721S RRID:AB_330951 beta-Tubulin Antibody Cell Signaling Technology Cat#2146S RRID:AB_2210545 BiP (C50B12) Rabbit Monoclonal Antibody Cell Signaling Technology Cat#3177T RRID:AB_2119845 HRP Conjugated Goat anti-Rabbit IgG polyclonal Antibody HUABIO Cat#HA1001 RRID:AB_2819166 HRP Conjugated Goat anti-Mouse IgG polyclonal Antibody HUABIO Cat#HA1006 RRID:AB_2819167 Anti-F4/80 antibody [CI:A3-1] - Macrophage Marker Abcam Cat#ab6640 RRID:AB_1140040 Biological samples Peripheral blood mononuclear cells were isolated from heparinized blood provided by patients with ITP and healthy control The First Affiliated Hospital, Zhejiang University School of Medicine https://www.zy91.com/ Chemicals, peptides, and recombinant proteins 4μ8C Selleck Chemicals Cat#S7272; CAS: 14003-96-4 SR8278 MedChemExpress Cat#HY-14415; CAS No. : 1254944-66-5 CellTracker Green 5-Chloromethylfluorescein Diacetate (CMFDA) Invitrogen Cat#C2925 Hoechst 33342 Solarbio Cat#C0031 prostaglandin E1 Sigma Cat#P5515; CAS: 745-65-3 Catrite-dextrose solution(ACD) Sigma Cat#C3821; CAS: 8013-89-6 RPMI 1640 medium Gibco Cat#C11875500BT DMEM (High Glucose) Gibco Cat#C11995500BT Fetal Bovine Serum Gibco Cat#110099141C Molecular Probes TM Dextran Invitrogen Cat#D1818 pHrodo TM Red Zymosan BioParticles Invitrogen Cat#P35364 Eltrombopag MedChemExpress Cat#HY-15306; CAS No. : 496775-61-2 Thapsigargin MedChemExpress Cat#HY-13433; CAS No. : 67526-95-8 Tauroursodeoxycholate MedChemExpress Cat#HY-19696; CAS No. : 14605-22-2 SR9009 MedChemExpress Cat#HY-16989; CAS No. : 1379686-30-2 Phorbol 12-myristate 13-acetate MedChemExpress Cat#HY-18739; CAS No. : 16561-29-8 Recombinant Murine M-CSF PeproTech Cat#Cat # 315-02-50UG Critical commercial assays BCA assay Bestbio Cat#BB-3401 Advanced DNA RNA Transfection Reagent ZETA LIFE Inc. AD600025 (Continued on next page) 18 Cell Reports 45, 117083, March 24, 2026 ..

    Recombinant:

    Article Title: A combined "eat me/don't eat me" strategy based on exosome for acute liver injury treatment.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TSG101 Proteintech Cat# 28283-1-AP; RRID:AB_2881104 Anti-VDAC1 Proteintech Cat# 55259-1-AP; RRID:AB_10837225 Anti-Flotillin 1 Proteintech Cat# 15571-1-AP; RRID:AB_2106746 Anti-Wnt2 ABclonal Cat# A23997; RRID:AB_3677320 Anti-CD47 ABclonal Cat# A21904; RRID:AB_3677321 Anti-LYVE1 Invitrogen Cat# 14-0443-82; RRID:AB_1633414 Anti-CLEC4F Invitrogen Cat# PA5-47396; RRID:AB_2608299 Anti-F4/80 Servicebio Cat# GB113373-100; RRID: AB_3677324 Anti-LY6G Proteintech Cat# 65078-1-Ig; RRID:AB_2918382 Anti-Ki67 Servicebio Cat# GB111141-100; RRID: AB_3677325 PE anti-mouse CD31 BioLegend Cat# 102407; RRID:AB_312902 APC anti-mouse F4/80 BioLegend Cat# 123115; RRID:AB_893493 Anti-Rabbit IgG H&L (HRP Conjugated) ZENBIO Cat# 511203; RRID:AB_2927753 Anti-Mouse IgG H&L (HRP Conjugated) ZENBIO Cat# 511103; RRID:AB_2893489 Donkey anti-Rat IgG H&L (Alexa Fluor 594) Invitrogen Cat# A21209; RRID:AB_2535795 Donkey anti-Rat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A48269; RRID:AB_2893137 Donkey anti-Goat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A32814; RRID:AB_2762838 Donkey anti-Rabbit IgG H&L (CY3) Servicebio Cat# GB21403; RRID:AB_2818951 Bacterial and virus strains CD47 overexpressing lentiviral vector Hanbio JY20230330ZY-LP01 Wnt2 overexpressing lentiviral vector Hanbio HH20230916ZY-LV01 Biological samples Liver Serum Primary liver sinusoidal endothelial cell Primary hepatocyte Mice in this study N/A Chemicals, peptides, and recombinant proteins DMPE-PEG2000-CRLTRKRGLK Ruixibio R-DMK-0125 Acetaminophen MCE HY-66005 Dimethylnitrosamine TCI D0761 Puromycin, Sterile MCE HY-K1057 Blasticidin S, Sterile MCE HY-K1054 TRizolTM Invitrogen 15596026 Fetal bovine serum BioInd 1706126 Dulbecco’s Modified Eagle’s Medium Gibco C11995500 DiI Yeasen 40726ES10 DiO Yeasen 40725ES10 TRITC Phalloidin Yeasen 40734ES75 Cell Counting Kit-8 TargetMol C0005 Critical commercial assays SYBR Green Pro Taq HS qPCR kit Accurate Biology 11701 Mouse Protein Wnt-2 (WNT2) ELISA kit CUSABIO CSB-EL026133MO One Step TUNEL Apoptosis Assay Kit Beyotime C1089 Mouse cluster of differentiation 47 (CD47) ELISA Kit Jonlnbio JL49445 (Continued on next page) Cell Reports Medicine 6, 102033, April 15, 2025 e1 OPEN ACCESS .. Experimental mouse models and exosomes injection 8- to 10-week-old C57BL/6 mice (male) were purchased from Charles River Laboratories.

    Article Title: Wnt activation and dual SMAD inhibition for induction and maintenance of hindbrain-like neural stem cell from hiPSCs.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SOX1 Cell Signaling 4194S SOX2 R&D systems MAB2018 NESTIN R&D systems MAB1259 NANOG R&D systems AF1997 POU5F1 Santa Cruz Biotechnology sc-5279 PAX6 Abcam EPR15858 TUBB3 GeneTex GTX85469 OLIG2 GeneTex GTX132732 GFAP Santa Cruz Biotechnology sc-33673 hNCAM Santa Cruz Biotechnology sc-106 Chemicals, peptides, and recombinant proteins A-83-01 Tocris 2939 CHIR9902 Axon 1386 LDN193189 MedChem Express HY-12071 Y-27632 WAKO 253–00513 iMatrix-511 Nippi 892021 NeurobasalTM ThermoFisher 21103049 DMEM/F-12 Gibco 11320–033 B27 ThermoFisher 17504044 N-2 ThermoFisher 17502048 GlutaMAXTM Gibco 35050 Ascorbic acid Nacalai Tesque 03420–52 Insulin WAKO 097–06474 BDNF BioLegend 788902 GDNF BioLegend 760402 Deposited data Single cell RNAseq data This paper GEO: GSE317025 RNAseq data This paper GEO: GSE317319 RNAseq datasets of human iPSCs Kamiya et al.18 GEO: GSE206128 Experimental models: Cell lines 1231A3 iPSC Obtained from the Yamanaka laboratory, CiRA, Japan https://cellbank.brc.riken.jp/cell_bank/CellInfo/ ?cellNo=HPS0381&lang=En RPChiPS771-2 ReproCELL, N/A Ff-XT28s05-Abo_To CiRA foundation, CiRA, Japan https://www.cira-foundation.or.jp/e/assets/file/ provision-of-ips-cells/E_Ff-XT28s05_ABo_To.pdf Experimental models: Organisms/strains NSG mice The Jackson Laboratory N/A Oligonucleotides RT-qPCR primers, see Table S1 This paper N/A Software and algorithms Python 3.11 https://www.python.org/downloads/ N/A RStudio https://posit.co/download/rstudio-desktop/ N/A Custom code for figure generation This paper https://doi.org/10.5281/zenodo.18653633 e1 Cell Reports Methods 6, 101372, April 20, 2026 Article ll OPEN ACCESS ..

    Article Title: Targeted degradation of CDK9 potently disrupts the MYC-regulated network.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-Vinculin (E1E9V) Cell Signaling Technology Cat#13901S; RRID: AB_2728768 Mouse monoclonal anti-Rpb1 CTD (4H8) Cell Signaling Technology Cat#2629S; RRID: AB_2167468 Rabbit monoclonal anti-cMYC (D84C12) Cell Signaling Technology Cat#5605S; RRID: AB_1903938 Rabbit monoclonal anti-P-Rpb1 S2 (E1Z3G) Cell Signaling Technology Cat#13499S; RRID: AB_2798238 Rabbit anti-Histone H3 Cell Signaling Technology Cat#9715L; RRID: AB_331563 Rabbit monoclonal anti-GAPDH (14C10) Cell Signaling Technology Cat#2118S; RRID: AB_561053 Mouse monoclonal anti-CDK7 (MO1) Cell Signaling Technology Cat#2916S; RRID: AB_2077142 Rabbit monoclonal anti-CDK9 (C12F7) Cell Signaling Technology Cat#2316S; RRID: AB_2291505 Rabbit monoclonal anti-CDK10 (D8Z7Z) Cell Signaling Technology Cat#36106S; RRID: AB_2799094 Ant-mouse IgG HRP-Linked Cell Signaling Technology Cat#7076S; RRID: AB_330924 Anti-rabbit IgG HRP-Linked Cell Signaling Technology Cat#7074S; RRID: AB_2099233 Rabbit polyclonal anti-DDX21 Novus Biologicals Cat#NB100-1718; RRID: AB_523207 Rabbit monoclonal anti-NPM1 Abcam Cat#ab180607 Alexa Fluor 488 Thermo Fisher Scientific Cat#A-11008; RRID: AB_143165 Alexa Fluor 647 Thermo Fisher Scientific Cat#A-27040; RRID: AB_2536101 Chemicals, peptides, and recombinant proteins KI-CDK9d-32 This manuscript N/A KI-CDK9d-32N This manuscript N/A KI-ARv-03 Koehler Lab Richters et al. KB-0742 dihydrochloride Medchem Express Cat#HY-137478A Protease inhibitors Thermo FIsher Scientific Cat#87786 Phosphatase inhibitors (PhosSTOP) Millipore SIGMA Cat#4906845001 Critical commercial assays HotSpot Wildtype Kinase Panel Reaction Biology N/A Nano-Glo HiBiT Lytic Detection System Promega Cat#N3030 PRISM Screen Broad Institute N/A Deposited data RNA Sequencing data of MOLT-4 Cells treated with KI-CDK9d-32 and KB-0742 This manuscript GEO: GSE263153 Mass Spectrometry Proteomics data of MOLT-4 Cells treated with KI-CDK9d-32 This manuscript ProteomeXchange: PXD052300; 10.6019/PXD052300 Experimental models: Cell lines Human: MOLT-4 ATCC cat#CRL-1582 Human: RH-4 Cellosaurus cat#CVL_5916 Human: PSN-1 ATCC cat#CRL-3211 Human: HeLa ATCC cat#CCL-2 Oligonucleotides MYC Forward: 50-tcctcggattctctgctctc-30 This manuscript N/A MYC Reverse: 50-tcttcctcatcttcttgttcctc-30 This manuscript N/A CDK9 Forward: 50-ctgaagaaggtgctgatggaa-30 This manuscript N/A CDK9 Reverse: 50-agttgaccacattctcgtgtt-30 This manuscript N/A POLR2A Forward: 50- ggatgatctggaatgctcag-30 This manuscript N/A POLR2A Reverse: 50- attccttgactccctccac-30 This manuscript N/A (Continued on next page) Cell Chemical Biology 32, 1–14.e1–e10, April 17, 2025 e1 .. Human acute lymphoblastic leukemia cells MOLT-4 (ATCC, CRL-1582, sex of cell: male), rhabdomyosarcoma cells RH-4 (Cellosaurus, CVL_5916, sex of cell: female), pancreatic adenocarcinoma cells PSN-1 (ATCC, CRL-3211, sex of cell: male), and adenocarcinoma HeLa cells (ATCC, CCL-2, sex of cell: female) were obtained from the Koch Institute’s Preclinical Modeling (ES Cell and Transgenics Facility) Core.

    Article Title: Inhibiting UPF1 methylation enhances tumor immunotherapy sensitivity by reducing nonsense-mediated mRNA decay.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies UPF1 Abclonal A5071 GAPDH Abclonal A19056 LC3B Abclonal A19665 mono-methyl arginine Cell Signaling Technology #8015 asymmetric di-methyl arginine Cell Signaling Technology #13522 FLAG tag Cell Signaling Technology #14793 HA-tag Cell Signaling Technology #3724 .. UPF1 Proteintech 66898-1-Ig ATG5 Proteintech 10181-2-AP BECN1 Proteintech 11306-1-AP NDP52 Proteintech 66401-1-Ig asymmetric di-methyl-histone H3 PTM BIO PTM-650RM Goat anti-rabbit (HRP) Abclonal AS062 Goat anti-mouse (HRP) Abclonal AS061 DyLight 488, goat anti-mouse Abbkine A23210 Dylight 649, goat anti-rabbit IgG Abbkine A23620 FITC-conjugated anti-mouse CD8 BioLegend 100804 Brilliant Violet 650 TM anti-mouse CD8 BioLegend 100741 Brilliant Violet 510 TM anti-mouse CD4 BioLegend 157219 Zombie NIR Fixable Viability Kit BioLegend 423106 Brilliant Violet 785 TM anti-mouse CD3 BioLegend 100232 Biological samples Human Colorectal Cancer Samples TongjiHospital (Wuhan) N/A Chemicals, peptides, and recombinant proteins EZM 2302 MedChemExpress HY-111109 NMDI14 MedChemExpress HY-111374 chloroquine phosphate MedChemExpress HY-17589 CHX MedChemExpress HY-12320 MG132 MedChemExpress HY-13259 adenosine dialdehyde MedChemExpress HY-123055 deacetylase inhibitor cocktail MedChemExpress HY-K0030 Benzyl-α-GalNAc MedChemExpress HY-129389 anti-HA magnetic beads MedChemExpress HY-K0201 anti-Flag magnetic beads MedChemExpress HY-K0207 protein A/G magnetic beads MedChemExpress HY-K0202 EBSS Beyotime C0213 Tunicamycin Beyotime SC0393 Experimental models: Cell lines SW480 ATCC CCL-228 .. (Continued on next page) Cell Reports 44, 115919, July 22, 2025 17 Continued REAGENT or RESOURCE SOURCE IDENTIFIER SW620 ATCC CCL-227 HCT116 ATCC CCL-247 RKO ATCC CRL-2577 LOVO ATCC CCL-229 SW48 ATCC CCL-231 HEK 293T ATCC CRL-3216 CT26 ATCC CRL-2638 MC38 Cell Resource Center, Peking Union Medical College 1101MOU-PUMC000523 Oligonucleotides mCherry-Forward Primer CACGAGTTCGAGATCGAGGG This paper N/A mCherry-Reverse Primer CAAGTAGTCGGGGATGTCGG This paper N/A EGFP-Forward Primer GGACGACGGCAACTACAAGA Thispaper N/A EGFP-Reverse Primer AAGTCGATGCCCTTCAGCTC This paper N/A Human shPRMT4 #1 CTATGGGAACTGGGACACTTT This paper N/A Human shPRMT4 #2 GCAGAACATGATGCAGGACTA This paper N/A Mouse shPRMT4 #1 CCCGACCAACACCATGCACTA This paper N/A Mouse shPRMT4 #2 GCCATGAAGATGTGTGTGTTT This paper N/A Human UPF1 sgRNAs GAGATATGCCTGCGGTACAA This paper N/A Human NDP52 sgRNAs CAATCCAATCCTTTCGACGA This paper N/A Human ATG5 sgRNAs GTGCTTCGAGATGTGTGGTT This paper N/A Human BECN1 sgRNAs ATTTATTGAAACTCCTCGCC This paper N/A Mouse UPF1 sgRNAs GCCGAGGAAATACTTCTGGC This paper N/A Recombinant DNA pEnCMV-UPF1(human)-FLAG MiaolingBiotech P19194 pLV3-CMV-HA-UPF1(mouse)-Puro MiaolingBiotech P42350 pCMV-PPRMT4(human)-FLAG-Neo MiaolingBiotech P51354 pLV3-CMV-PPRMT4(mouse)-HA-Puro MiaolingBiotech P46703 pCMV-NIX(human)-FLAG-Neo MiaolingBiotech P53425 pCMV-NDP52(human)-FLAG-Neo MiaolingBiotech P56753 pCMV-TOLLIP(human)-FLAG-SV40-Neo MiaolingBiotech P36596 pCMV-P62(human)-FLAG-Neo MiaolingBiotech P45981 pCMV-OPTN(human)-Myc-Neo MiaolingBiotech P66058 pCMV-TurboRFP-NBR1(human)-FLAG-Neo MiaolingBiotech P53428 Software and algorithms ImageJ NIH https://imagej.nih.gov/ij/ PRISM GraphPadSoftware Version 8 FlowJo FlowJo Version 10 (Continued on next page) 18 Cell Reports 44, 115919, July 22, 2025

    Article Title: NFE2-driven neutrophil polarization promotes pancreatic cancer liver metastasis progression.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat Anti-Rabbit IgG H&L (HRP) Abcam Cat# ab205718; RRID:AB_2819160 Recombinant Anti-S100A12/CGRP antibody Abcam Cat# ab272713; RRID:AB_2920851 Recombinant Anti-S100A8 + S100A9 antibody Abcam Cat# ab288715 PADI4 antibody Proteintech Cat# 17373-1-AP; RRID:AB_2878398 Recombinant Anti-MMP9 antibody Abcam Cat# ab283575; RRID:AB_2928971 TGM2 antibody Proteintech Cat# 15100-1-AP; RRID:AB_2202885 Galectin-3 Polyclonal antibody Proteintech Cat# 14979-1-AP; RRID:AB_2136768 Recombinant Anti-Ly6g antibody Abcam Cat# ab238132; RRID:AB_2923218 MPO antibody Proteintech Cat# 22225-1-AP; RRID:AB_2879037 Recombinant Anti-CD66b antibody Abcam Cat# ab300122; RRID:AB_3097803 Mouse Anti-CD68 Monoclonal Antibody, Unconjugated, Clone KP1 Abcam Cat# ab955; RRID:AB_307338 NFE2 antibody Proteintech Cat# 11089-1-AP; RRID:AB_2152928 Recombinant Anti-Histone H3 (citrulline R2 + R8 + R17) antibody Abcam Cat# ab281584 Recombinant Anti-Macrophage Inflammatory Protein 1 alpha/CCL3 + CCL3L1 antibody Abcam Cat# ab259372; RRID:AB_3094596 ISG15 antibody Proteintech Cat# 15981-1-AP; RRID:AB_2126302 GRO Alpha antibody Proteintech Cat# 12335-1-AP; RRID:AB_2087568 HSPA6 antibody Proteintech Cat# 13616-1-AP; RRID:AB_2120122 RPS19 antibody Proteintech Cat# 15085-1-AP; RRID:AB_2180202 Fixable Viability Stain 780 BD Biosciences Cat# 565388; RRID:AB_2869673 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc BlockTM) Clone 2.4G2 BD Biosciences Cat# 553141; RRID:AB_394656 FITC anti-mouse CD45 Recombinant BioLegend Cat# 157608; RRID:AB_2832554 Brilliant Violet 421(TM) anti-mouse/human CD11b BioLegend Cat# 101235; RRID:AB_10897942 PE anti-mouse Ly-6G BioLegend Cat# 127607; RRID:AB_1186104 Alexa Fluor(R) 700 anti-mouse CD3 BioLegend Cat# 100216; RRID:AB_493697 Brilliant Violet 510(TM) anti-mouse CD8a BioLegend Cat# 100752; RRID:AB_2563057 PerCP/Cyanine5.5 anti-mouse F4/80 BioLegend Cat# 123128; RRID:AB_893484 PE/Cyanine7 anti-mouse CD279 (PD-1) BioLegend Cat# 109110; RRID:AB_572017 HRP-conjugated goat anti-mouse secondary antibody Zsbio ZB-2305 HRP-conjugated goat anti-rabbit secondary antibody Zsbio ZB-2306 Bacterial and virus strains LV-Tgfb1-RNAi Genechem N/A LV-Luciferase Genechem N/A Biological samples Surgical excision samples Peking Union Medical College Hospital N/A Chemicals, peptides, and recombinant proteins SM16 MedChemExpress Cat# HY-111482 Cl-amidine Selleck Cat# S8141 (Continued on next page) 16 Cell Reports 44, 115226, February 25, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER anti-mouse Ly6G BioXcell Cat# BE0075-1 IgG2a isotype control BioXcell Cat# BE0085 SB431542 MedChemExpress Cat# HY-10431 HumanKine recombinant human TGF-b Proteintech Cat# HZ-1011 Collagenase IV Thermo Fisher SCIENTIFIC Cat# 17104019 DNase I Thermo Fisher SCIENTIFIC Cat# 90083 Dispase II Thermo Fisher SCIENTIFIC Cat# 17105041 Heparin sodium MedChemExpress Cat# HY-17567A EGTA Beyotime Biotechnology Ca# ST068 DMEM/F12 Gibco Cat# 11320033 DMEM Gibco Cat# 11965118 IMDM Procell Cat# PM150510 RPMI-1640 Procell Cat# PM150110 PBS Procell Cat# PB180327 FBS Thermo Fisher SCIENTIFIC Cat# A3160901 BSA Beyotime Biotechnology Cat# ST023 DPBS Thermo Fisher SCIENTIFIC Cat# 14190144 Percoll Cytiva Cat# 17089101 Penicillin-Streptomycin Solution Beyotime Biotechnology Cat# C0222 Puromycin MedChemExpress Cat# HY-B1743A DMSO Thermo Fisher SCIENTIFIC Cat# D12345 Lipofectamine 3000 Transfection Reagent Thermo Fisher SCIENTIFIC Cat# L3000001 RIPA Lysis Buffer APPLYGEN Cat# C1053-100 Protease inhibitor cocktail Aqlabtech Cat# AQ551 Phosphatase inhibitor APPLYGEN Cat# P1260 PMSF Beyotime Biotechnology Cat# ST505 Skim milk Aqlabtech Cat# AQ62321 SYBR Green Master Mix Thermo Fisher SCIENTIFIC Cat# A25742 Crystal violet Beyotime Biotechnology Cat# C0121 Red Blood Cell Lysis Buffer Beyotime Biotechnology Cat# C3702 G418 Beyotime Biotechnology Cat# ST081 Critical commercial assays Single Cell 30 GEM, Library & Gel Bead Kit V3.1 10x Genomics N/A Chromium Single Cell B Chip Kit 10x Genomics N/A PANO 7-plex IHC kit Panovue Cat# 0004100100 Dual Luciferase Reporter Assay Promega Cat# E1910 SF Cell Line 4D-NucleofectorTM X Kit S Lonza Bioscience Cat# V4XC-2024 Human Monocyte Nucleofector Kit Lonza Bioscience Cat# VPA-1007 Enhanced BCA Protein Assay Kit Beyotime Biotechnology Cat# P0010 Super ECL Reagent Aqlabtech Cat# AQ529 RNA-Quick Purification Kit ESScience Cat# RN001 PrimeScript RT reagent Kit Takara Cat# RR047A Mouse TGF-beta 1 ELISA Kit RayBiotech Cat# P04202 MycoBlue Mycoplasma Detector Kit Vazyme Cat# D101 Cell counting kit 8 Dojindo Cat# CK04-05 Deposited data scRNA-seq and ST data This paper GSE281288 JASPAR database https://jaspar.genereg.net/ TCGA data https://xenabrowser.net/ (Continued on next page) Cell Reports 44, 115226, February 25, 2025 17

    Article Title: IRE1α regulates macrophage phagocytosis in immune thrombocytopenia through NR1D1 mRNA decay and lysosomal biogenesis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies for Platelet Depletion in Mice Emfret Cat#R300 RRID:AB_2721041 Phosphorylated IRE1α at Ser724 (p-IRE1α) Novus Biologicals Cat#NB100-2323 RRID:AB_3151655 NR1D1 Recombinant Rabbit Monoclonal Antibody HUABIO Cat#ET7106-92 RRID:AB_3070710 ATF4 Recombinant Rabbit Monoclonal Antibody HUABIO Cat#ET1612-37 RRID:AB_3070110 Anti-eIF2 alpha Antibody HUABIO Cat#ET7111-34 RRID:AB_3071091 Anti-XBP1 Antibody Abcam Cat#ab220783 RRID:AB_2920809 Anti-GAPDH Antibody Abcam Cat#ab181602 RRID:AB_2630358 IRE1 alpha (14C10) Rabbit Monoclonal Antibody Cell Signaling Technology Cat#3294T RRID:AB_823545 Phospho-eIF2 alpha (Ser51) Antibody Cell Signaling Technology Cat#9721S RRID:AB_330951 beta-Tubulin Antibody Cell Signaling Technology Cat#2146S RRID:AB_2210545 BiP (C50B12) Rabbit Monoclonal Antibody Cell Signaling Technology Cat#3177T RRID:AB_2119845 HRP Conjugated Goat anti-Rabbit IgG polyclonal Antibody HUABIO Cat#HA1001 RRID:AB_2819166 HRP Conjugated Goat anti-Mouse IgG polyclonal Antibody HUABIO Cat#HA1006 RRID:AB_2819167 Anti-F4/80 antibody [CI:A3-1] - Macrophage Marker Abcam Cat#ab6640 RRID:AB_1140040 Biological samples Peripheral blood mononuclear cells were isolated from heparinized blood provided by patients with ITP and healthy control The First Affiliated Hospital, Zhejiang University School of Medicine https://www.zy91.com/ Chemicals, peptides, and recombinant proteins 4μ8C Selleck Chemicals Cat#S7272; CAS: 14003-96-4 SR8278 MedChemExpress Cat#HY-14415; CAS No. : 1254944-66-5 CellTracker Green 5-Chloromethylfluorescein Diacetate (CMFDA) Invitrogen Cat#C2925 Hoechst 33342 Solarbio Cat#C0031 prostaglandin E1 Sigma Cat#P5515; CAS: 745-65-3 Catrite-dextrose solution(ACD) Sigma Cat#C3821; CAS: 8013-89-6 RPMI 1640 medium Gibco Cat#C11875500BT DMEM (High Glucose) Gibco Cat#C11995500BT Fetal Bovine Serum Gibco Cat#110099141C Molecular Probes TM Dextran Invitrogen Cat#D1818 pHrodo TM Red Zymosan BioParticles Invitrogen Cat#P35364 Eltrombopag MedChemExpress Cat#HY-15306; CAS No. : 496775-61-2 Thapsigargin MedChemExpress Cat#HY-13433; CAS No. : 67526-95-8 Tauroursodeoxycholate MedChemExpress Cat#HY-19696; CAS No. : 14605-22-2 SR9009 MedChemExpress Cat#HY-16989; CAS No. : 1379686-30-2 Phorbol 12-myristate 13-acetate MedChemExpress Cat#HY-18739; CAS No. : 16561-29-8 Recombinant Murine M-CSF PeproTech Cat#Cat # 315-02-50UG Critical commercial assays BCA assay Bestbio Cat#BB-3401 Advanced DNA RNA Transfection Reagent ZETA LIFE Inc. AD600025 (Continued on next page) 18 Cell Reports 45, 117083, March 24, 2026 ..

    Article Title: MIF-ACKR3 causes irreversible fat loss by impairing adipogenesis in cancer cachexia.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (clone D13.14.4E; 1:1000 dilution) Cell Signaling Technology Cat# 4370; RRID: AB_2315112 Rabbit monoclonal anti-p44/42 MAPK (Erk1/2) (clone 137F5; 1:1000 dilution) Cell Signaling Technology Cat# 4695; RRID: AB_390779 Rabbit monoclonal anti-phospho-IkBa (Ser32) (clone 14D4; 1:1000 dilution) Cell Signaling Technology Cat# 2859; RRID: AB_561111 Mouse monoclonal anti-IkBa (clone L35A5; 1:1000 dilution) Cell Signaling Technology Cat# 4814; RRID: AB_390781 Rabbit polyclonal anti-GPCR RDC1/CXCR-7 (1:100 dilution) Abcam Cat# ab117836; RRID: AB_10903623 Rabbit monoclonal anti-GRK2 (clone HL1562; 1:1000 dilution) GeneTex Cat# GTX637038 Mouse Monoclonal anti-b-Tubulin (HRP Conjugated; 1:3000 dilution) Beyotime Cat# AF2839 Anti-Mouse CD45 FITC (clone 30-F11; 1:100 dilution) BD Biosciences Cat# 561088 Rabbit monoclonal anti-Collagen VI (clone EPR17072; 1:250) Abcam Cat# ab182744; RRID: AB_2847919 Rabbit monoclonal anti- Fibronectin (clone EPR23110-46; 1:2000) Abcam Cat# ab268020; RRID: AB_2941028 HRP-conjugated goat anti-rabbit/mouse secondary antibody GeneTech Cat# GK500705 Goat Anti-Rabbit IgG (H&L)-HRP Conjugated EASYBIO Cat# BE0101-100 Goat Anti-Mouse IgG (H&L)-HRP Conjugated EASYBIO Cat# BE0102-100 Bacterial and virus strains HBAD-Cre HanBio Cat#HH20230208GX-AP01 Biological samples Human peripheral blood from healthy donors Dazhou Central Hospital See Table S5 for details Human peripheral blood from LUAD patients Dazhou Central Hospital See Table S5 for details Human abdominal subcutaneous adipose tissue samples from LUAD patients Dazhou Central Hospital See Table S5 for details Chemicals, peptides, and recombinant proteins ISO-1 MedChemExpress Cat# HY-16692 Dulbecco’s Modified Eagle Medium (DMEM) Solarbio Cat# 11965 Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F-12) Solarbio Cat# D6570 RPMI-1640 medium Invitrogen Cat# 11875093 Tissue storage solution Miltenyi Biotec Cat# 130-100-008 Fetal bovine serum (FBS) Vistech Cat# SE100-B Goat serum Beyotime Cat# C0256 Penicillin-streptomycin Gibco Cat# 15070063 Collagenase Type II Gibco Cat# 17101015 Red Blood Cell Lysis Buffer Beyotime Cat# C3702-500 mL Insulin (10 mg/mL) Sigma–Aldrich Cat# I9278 (Continued on next page) e1 Cell Metabolism 37, 1–17.e1–e8, April 1, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER 3-isobutyl-1-methylxantine (0.5mM) MedChemExpress Cat# HY-dd12318 Dexamethasone (1 mM) MedChemExpress Cat# HY-14648 Rosiglitazone (2.5 mM) MedChemExpress Cat# HY-17386 Mouse recombinant MIF MedChemExpress Cat# HY-P7388 Gallein (10 mM) MedChemExpress Cat# HY-D0254 PTX (100 ng/mL) List Biological Laboratories Cat# 180 TRIzol Invitrogen Cat# 15596026 Hifair III 1st Strand cDNA Synthesis SuperMix Yeasen Cat# 11141ES60 ChamQ SYBR qPCR Master Mix Vazyme Cat# Q321-02 Lipofectamine RNAiMAX Thermo Fisher Scientific Cat# 13778030 4% paraformaldehyde fix solution Beyotime Cat# P0099-500mL RIPA lysis buffer Solarbio Cat# R0010 Critical commercial assays Glycerol Assay Kit Nanjing Jiancheng Bioengineering Institute Cat# F005-1-1 NEB Next Ultra RNA Library Prep Kit for Illumina NEB Cat# E7530S Chromium Next GEM Single Cell 30 GEM, Library & Gel Bead Kit 10x Genomics Cat# PN-1000121 Chromium Next GEM Chip G Single Cell Kit 10x Genomics Cat# PN-1000120 Oil Red O Staining Kit Beyotime Cat# C0158M Masson’s Trichrome Staining Kit Solarbio Cat# G1340 DAB Horseradish Peroxidase Color Development Kit Beyotime Cat# P0203 Mouse MIF SimpleStep ELISA Kit Abcam Cat# ab209885 Human MIF ELISA Kit Multi Sciences Cat# EK1158 Mouse Tumor Necrosis Factor a (TNF-a) ELISA Kit Cusabio Cat# CSB-E04741m Mouse Interleukin 1b (IL-1b) ELISA Kit Cusabio Cat# CSB-E08054m Mouse Interleukin 6 (IL-6) ELISA KIT Cusabio Cat# CSB-E04639m BCA protein assay kit Thermo Fisher Scientific Cat# 23227 NF-kB activation-nuclear translocation assay kit Beyotime Cat# SN371 Deposited data Source data This paper Data S1 Source Data Data files for sequencing data for cachexia mouse model (raw data) This paper GSA: CRA009162 Data files for sequencing data for human adipose tissue (raw data) This paper GSA: HRA003574 scRNA-seq dataset of human and mice white adipose tissue Emont et al.8 SCP: SCP1376 scRNA-seq dataset of mice white adipose tissue Burl et al.9 SRA: SRP145475 scRNA-seq dataset of mice white adipose tissue Hepler et al.10 GEO: GSE111588 scRNA-seq dataset of mice white adipose tissue Merrick et al.11 GEO: dGSE128889 snRNA-seq dataset of mice white adipose tissue Sárvári et al.12 SCP: SCP1179 scRNA-seq dataset of mice white adipose tissue Schwalie et al.13 ArrayExpress: E-MTAB-5785, E-MTAB-5818, E-MTAB-5802, E-MTAB-5787 and E-MTAB-6677 (Continued on next page) Cell Metabolism 37, 1–17.e1–e8, April 1, 2025 e2

    Sterility:

    Article Title: A combined "eat me/don't eat me" strategy based on exosome for acute liver injury treatment.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TSG101 Proteintech Cat# 28283-1-AP; RRID:AB_2881104 Anti-VDAC1 Proteintech Cat# 55259-1-AP; RRID:AB_10837225 Anti-Flotillin 1 Proteintech Cat# 15571-1-AP; RRID:AB_2106746 Anti-Wnt2 ABclonal Cat# A23997; RRID:AB_3677320 Anti-CD47 ABclonal Cat# A21904; RRID:AB_3677321 Anti-LYVE1 Invitrogen Cat# 14-0443-82; RRID:AB_1633414 Anti-CLEC4F Invitrogen Cat# PA5-47396; RRID:AB_2608299 Anti-F4/80 Servicebio Cat# GB113373-100; RRID: AB_3677324 Anti-LY6G Proteintech Cat# 65078-1-Ig; RRID:AB_2918382 Anti-Ki67 Servicebio Cat# GB111141-100; RRID: AB_3677325 PE anti-mouse CD31 BioLegend Cat# 102407; RRID:AB_312902 APC anti-mouse F4/80 BioLegend Cat# 123115; RRID:AB_893493 Anti-Rabbit IgG H&L (HRP Conjugated) ZENBIO Cat# 511203; RRID:AB_2927753 Anti-Mouse IgG H&L (HRP Conjugated) ZENBIO Cat# 511103; RRID:AB_2893489 Donkey anti-Rat IgG H&L (Alexa Fluor 594) Invitrogen Cat# A21209; RRID:AB_2535795 Donkey anti-Rat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A48269; RRID:AB_2893137 Donkey anti-Goat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A32814; RRID:AB_2762838 Donkey anti-Rabbit IgG H&L (CY3) Servicebio Cat# GB21403; RRID:AB_2818951 Bacterial and virus strains CD47 overexpressing lentiviral vector Hanbio JY20230330ZY-LP01 Wnt2 overexpressing lentiviral vector Hanbio HH20230916ZY-LV01 Biological samples Liver Serum Primary liver sinusoidal endothelial cell Primary hepatocyte Mice in this study N/A Chemicals, peptides, and recombinant proteins DMPE-PEG2000-CRLTRKRGLK Ruixibio R-DMK-0125 Acetaminophen MCE HY-66005 Dimethylnitrosamine TCI D0761 Puromycin, Sterile MCE HY-K1057 Blasticidin S, Sterile MCE HY-K1054 TRizolTM Invitrogen 15596026 Fetal bovine serum BioInd 1706126 Dulbecco’s Modified Eagle’s Medium Gibco C11995500 DiI Yeasen 40726ES10 DiO Yeasen 40725ES10 TRITC Phalloidin Yeasen 40734ES75 Cell Counting Kit-8 TargetMol C0005 Critical commercial assays SYBR Green Pro Taq HS qPCR kit Accurate Biology 11701 Mouse Protein Wnt-2 (WNT2) ELISA kit CUSABIO CSB-EL026133MO One Step TUNEL Apoptosis Assay Kit Beyotime C1089 Mouse cluster of differentiation 47 (CD47) ELISA Kit Jonlnbio JL49445 (Continued on next page) Cell Reports Medicine 6, 102033, April 15, 2025 e1 OPEN ACCESS .. Experimental mouse models and exosomes injection 8- to 10-week-old C57BL/6 mice (male) were purchased from Charles River Laboratories.

    Modification:

    Article Title: A combined "eat me/don't eat me" strategy based on exosome for acute liver injury treatment.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TSG101 Proteintech Cat# 28283-1-AP; RRID:AB_2881104 Anti-VDAC1 Proteintech Cat# 55259-1-AP; RRID:AB_10837225 Anti-Flotillin 1 Proteintech Cat# 15571-1-AP; RRID:AB_2106746 Anti-Wnt2 ABclonal Cat# A23997; RRID:AB_3677320 Anti-CD47 ABclonal Cat# A21904; RRID:AB_3677321 Anti-LYVE1 Invitrogen Cat# 14-0443-82; RRID:AB_1633414 Anti-CLEC4F Invitrogen Cat# PA5-47396; RRID:AB_2608299 Anti-F4/80 Servicebio Cat# GB113373-100; RRID: AB_3677324 Anti-LY6G Proteintech Cat# 65078-1-Ig; RRID:AB_2918382 Anti-Ki67 Servicebio Cat# GB111141-100; RRID: AB_3677325 PE anti-mouse CD31 BioLegend Cat# 102407; RRID:AB_312902 APC anti-mouse F4/80 BioLegend Cat# 123115; RRID:AB_893493 Anti-Rabbit IgG H&L (HRP Conjugated) ZENBIO Cat# 511203; RRID:AB_2927753 Anti-Mouse IgG H&L (HRP Conjugated) ZENBIO Cat# 511103; RRID:AB_2893489 Donkey anti-Rat IgG H&L (Alexa Fluor 594) Invitrogen Cat# A21209; RRID:AB_2535795 Donkey anti-Rat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A48269; RRID:AB_2893137 Donkey anti-Goat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A32814; RRID:AB_2762838 Donkey anti-Rabbit IgG H&L (CY3) Servicebio Cat# GB21403; RRID:AB_2818951 Bacterial and virus strains CD47 overexpressing lentiviral vector Hanbio JY20230330ZY-LP01 Wnt2 overexpressing lentiviral vector Hanbio HH20230916ZY-LV01 Biological samples Liver Serum Primary liver sinusoidal endothelial cell Primary hepatocyte Mice in this study N/A Chemicals, peptides, and recombinant proteins DMPE-PEG2000-CRLTRKRGLK Ruixibio R-DMK-0125 Acetaminophen MCE HY-66005 Dimethylnitrosamine TCI D0761 Puromycin, Sterile MCE HY-K1057 Blasticidin S, Sterile MCE HY-K1054 TRizolTM Invitrogen 15596026 Fetal bovine serum BioInd 1706126 Dulbecco’s Modified Eagle’s Medium Gibco C11995500 DiI Yeasen 40726ES10 DiO Yeasen 40725ES10 TRITC Phalloidin Yeasen 40734ES75 Cell Counting Kit-8 TargetMol C0005 Critical commercial assays SYBR Green Pro Taq HS qPCR kit Accurate Biology 11701 Mouse Protein Wnt-2 (WNT2) ELISA kit CUSABIO CSB-EL026133MO One Step TUNEL Apoptosis Assay Kit Beyotime C1089 Mouse cluster of differentiation 47 (CD47) ELISA Kit Jonlnbio JL49445 (Continued on next page) Cell Reports Medicine 6, 102033, April 15, 2025 e1 OPEN ACCESS .. Experimental mouse models and exosomes injection 8- to 10-week-old C57BL/6 mice (male) were purchased from Charles River Laboratories.

    Article Title: MIF-ACKR3 causes irreversible fat loss by impairing adipogenesis in cancer cachexia.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (clone D13.14.4E; 1:1000 dilution) Cell Signaling Technology Cat# 4370; RRID: AB_2315112 Rabbit monoclonal anti-p44/42 MAPK (Erk1/2) (clone 137F5; 1:1000 dilution) Cell Signaling Technology Cat# 4695; RRID: AB_390779 Rabbit monoclonal anti-phospho-IkBa (Ser32) (clone 14D4; 1:1000 dilution) Cell Signaling Technology Cat# 2859; RRID: AB_561111 Mouse monoclonal anti-IkBa (clone L35A5; 1:1000 dilution) Cell Signaling Technology Cat# 4814; RRID: AB_390781 Rabbit polyclonal anti-GPCR RDC1/CXCR-7 (1:100 dilution) Abcam Cat# ab117836; RRID: AB_10903623 Rabbit monoclonal anti-GRK2 (clone HL1562; 1:1000 dilution) GeneTex Cat# GTX637038 Mouse Monoclonal anti-b-Tubulin (HRP Conjugated; 1:3000 dilution) Beyotime Cat# AF2839 Anti-Mouse CD45 FITC (clone 30-F11; 1:100 dilution) BD Biosciences Cat# 561088 Rabbit monoclonal anti-Collagen VI (clone EPR17072; 1:250) Abcam Cat# ab182744; RRID: AB_2847919 Rabbit monoclonal anti- Fibronectin (clone EPR23110-46; 1:2000) Abcam Cat# ab268020; RRID: AB_2941028 HRP-conjugated goat anti-rabbit/mouse secondary antibody GeneTech Cat# GK500705 Goat Anti-Rabbit IgG (H&L)-HRP Conjugated EASYBIO Cat# BE0101-100 Goat Anti-Mouse IgG (H&L)-HRP Conjugated EASYBIO Cat# BE0102-100 Bacterial and virus strains HBAD-Cre HanBio Cat#HH20230208GX-AP01 Biological samples Human peripheral blood from healthy donors Dazhou Central Hospital See Table S5 for details Human peripheral blood from LUAD patients Dazhou Central Hospital See Table S5 for details Human abdominal subcutaneous adipose tissue samples from LUAD patients Dazhou Central Hospital See Table S5 for details Chemicals, peptides, and recombinant proteins ISO-1 MedChemExpress Cat# HY-16692 Dulbecco’s Modified Eagle Medium (DMEM) Solarbio Cat# 11965 Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F-12) Solarbio Cat# D6570 RPMI-1640 medium Invitrogen Cat# 11875093 Tissue storage solution Miltenyi Biotec Cat# 130-100-008 Fetal bovine serum (FBS) Vistech Cat# SE100-B Goat serum Beyotime Cat# C0256 Penicillin-streptomycin Gibco Cat# 15070063 Collagenase Type II Gibco Cat# 17101015 Red Blood Cell Lysis Buffer Beyotime Cat# C3702-500 mL Insulin (10 mg/mL) Sigma–Aldrich Cat# I9278 (Continued on next page) e1 Cell Metabolism 37, 1–17.e1–e8, April 1, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER 3-isobutyl-1-methylxantine (0.5mM) MedChemExpress Cat# HY-dd12318 Dexamethasone (1 mM) MedChemExpress Cat# HY-14648 Rosiglitazone (2.5 mM) MedChemExpress Cat# HY-17386 Mouse recombinant MIF MedChemExpress Cat# HY-P7388 Gallein (10 mM) MedChemExpress Cat# HY-D0254 PTX (100 ng/mL) List Biological Laboratories Cat# 180 TRIzol Invitrogen Cat# 15596026 Hifair III 1st Strand cDNA Synthesis SuperMix Yeasen Cat# 11141ES60 ChamQ SYBR qPCR Master Mix Vazyme Cat# Q321-02 Lipofectamine RNAiMAX Thermo Fisher Scientific Cat# 13778030 4% paraformaldehyde fix solution Beyotime Cat# P0099-500mL RIPA lysis buffer Solarbio Cat# R0010 Critical commercial assays Glycerol Assay Kit Nanjing Jiancheng Bioengineering Institute Cat# F005-1-1 NEB Next Ultra RNA Library Prep Kit for Illumina NEB Cat# E7530S Chromium Next GEM Single Cell 30 GEM, Library & Gel Bead Kit 10x Genomics Cat# PN-1000121 Chromium Next GEM Chip G Single Cell Kit 10x Genomics Cat# PN-1000120 Oil Red O Staining Kit Beyotime Cat# C0158M Masson’s Trichrome Staining Kit Solarbio Cat# G1340 DAB Horseradish Peroxidase Color Development Kit Beyotime Cat# P0203 Mouse MIF SimpleStep ELISA Kit Abcam Cat# ab209885 Human MIF ELISA Kit Multi Sciences Cat# EK1158 Mouse Tumor Necrosis Factor a (TNF-a) ELISA Kit Cusabio Cat# CSB-E04741m Mouse Interleukin 1b (IL-1b) ELISA Kit Cusabio Cat# CSB-E08054m Mouse Interleukin 6 (IL-6) ELISA KIT Cusabio Cat# CSB-E04639m BCA protein assay kit Thermo Fisher Scientific Cat# 23227 NF-kB activation-nuclear translocation assay kit Beyotime Cat# SN371 Deposited data Source data This paper Data S1 Source Data Data files for sequencing data for cachexia mouse model (raw data) This paper GSA: CRA009162 Data files for sequencing data for human adipose tissue (raw data) This paper GSA: HRA003574 scRNA-seq dataset of human and mice white adipose tissue Emont et al.8 SCP: SCP1376 scRNA-seq dataset of mice white adipose tissue Burl et al.9 SRA: SRP145475 scRNA-seq dataset of mice white adipose tissue Hepler et al.10 GEO: GSE111588 scRNA-seq dataset of mice white adipose tissue Merrick et al.11 GEO: dGSE128889 snRNA-seq dataset of mice white adipose tissue Sárvári et al.12 SCP: SCP1179 scRNA-seq dataset of mice white adipose tissue Schwalie et al.13 ArrayExpress: E-MTAB-5785, E-MTAB-5818, E-MTAB-5802, E-MTAB-5787 and E-MTAB-6677 (Continued on next page) Cell Metabolism 37, 1–17.e1–e8, April 1, 2025 e2

    CCK-8 Assay:

    Article Title: A combined "eat me/don't eat me" strategy based on exosome for acute liver injury treatment.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TSG101 Proteintech Cat# 28283-1-AP; RRID:AB_2881104 Anti-VDAC1 Proteintech Cat# 55259-1-AP; RRID:AB_10837225 Anti-Flotillin 1 Proteintech Cat# 15571-1-AP; RRID:AB_2106746 Anti-Wnt2 ABclonal Cat# A23997; RRID:AB_3677320 Anti-CD47 ABclonal Cat# A21904; RRID:AB_3677321 Anti-LYVE1 Invitrogen Cat# 14-0443-82; RRID:AB_1633414 Anti-CLEC4F Invitrogen Cat# PA5-47396; RRID:AB_2608299 Anti-F4/80 Servicebio Cat# GB113373-100; RRID: AB_3677324 Anti-LY6G Proteintech Cat# 65078-1-Ig; RRID:AB_2918382 Anti-Ki67 Servicebio Cat# GB111141-100; RRID: AB_3677325 PE anti-mouse CD31 BioLegend Cat# 102407; RRID:AB_312902 APC anti-mouse F4/80 BioLegend Cat# 123115; RRID:AB_893493 Anti-Rabbit IgG H&L (HRP Conjugated) ZENBIO Cat# 511203; RRID:AB_2927753 Anti-Mouse IgG H&L (HRP Conjugated) ZENBIO Cat# 511103; RRID:AB_2893489 Donkey anti-Rat IgG H&L (Alexa Fluor 594) Invitrogen Cat# A21209; RRID:AB_2535795 Donkey anti-Rat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A48269; RRID:AB_2893137 Donkey anti-Goat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A32814; RRID:AB_2762838 Donkey anti-Rabbit IgG H&L (CY3) Servicebio Cat# GB21403; RRID:AB_2818951 Bacterial and virus strains CD47 overexpressing lentiviral vector Hanbio JY20230330ZY-LP01 Wnt2 overexpressing lentiviral vector Hanbio HH20230916ZY-LV01 Biological samples Liver Serum Primary liver sinusoidal endothelial cell Primary hepatocyte Mice in this study N/A Chemicals, peptides, and recombinant proteins DMPE-PEG2000-CRLTRKRGLK Ruixibio R-DMK-0125 Acetaminophen MCE HY-66005 Dimethylnitrosamine TCI D0761 Puromycin, Sterile MCE HY-K1057 Blasticidin S, Sterile MCE HY-K1054 TRizolTM Invitrogen 15596026 Fetal bovine serum BioInd 1706126 Dulbecco’s Modified Eagle’s Medium Gibco C11995500 DiI Yeasen 40726ES10 DiO Yeasen 40725ES10 TRITC Phalloidin Yeasen 40734ES75 Cell Counting Kit-8 TargetMol C0005 Critical commercial assays SYBR Green Pro Taq HS qPCR kit Accurate Biology 11701 Mouse Protein Wnt-2 (WNT2) ELISA kit CUSABIO CSB-EL026133MO One Step TUNEL Apoptosis Assay Kit Beyotime C1089 Mouse cluster of differentiation 47 (CD47) ELISA Kit Jonlnbio JL49445 (Continued on next page) Cell Reports Medicine 6, 102033, April 15, 2025 e1 OPEN ACCESS .. Experimental mouse models and exosomes injection 8- to 10-week-old C57BL/6 mice (male) were purchased from Charles River Laboratories.

    SYBR Green Assay:

    Article Title: A combined "eat me/don't eat me" strategy based on exosome for acute liver injury treatment.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TSG101 Proteintech Cat# 28283-1-AP; RRID:AB_2881104 Anti-VDAC1 Proteintech Cat# 55259-1-AP; RRID:AB_10837225 Anti-Flotillin 1 Proteintech Cat# 15571-1-AP; RRID:AB_2106746 Anti-Wnt2 ABclonal Cat# A23997; RRID:AB_3677320 Anti-CD47 ABclonal Cat# A21904; RRID:AB_3677321 Anti-LYVE1 Invitrogen Cat# 14-0443-82; RRID:AB_1633414 Anti-CLEC4F Invitrogen Cat# PA5-47396; RRID:AB_2608299 Anti-F4/80 Servicebio Cat# GB113373-100; RRID: AB_3677324 Anti-LY6G Proteintech Cat# 65078-1-Ig; RRID:AB_2918382 Anti-Ki67 Servicebio Cat# GB111141-100; RRID: AB_3677325 PE anti-mouse CD31 BioLegend Cat# 102407; RRID:AB_312902 APC anti-mouse F4/80 BioLegend Cat# 123115; RRID:AB_893493 Anti-Rabbit IgG H&L (HRP Conjugated) ZENBIO Cat# 511203; RRID:AB_2927753 Anti-Mouse IgG H&L (HRP Conjugated) ZENBIO Cat# 511103; RRID:AB_2893489 Donkey anti-Rat IgG H&L (Alexa Fluor 594) Invitrogen Cat# A21209; RRID:AB_2535795 Donkey anti-Rat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A48269; RRID:AB_2893137 Donkey anti-Goat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A32814; RRID:AB_2762838 Donkey anti-Rabbit IgG H&L (CY3) Servicebio Cat# GB21403; RRID:AB_2818951 Bacterial and virus strains CD47 overexpressing lentiviral vector Hanbio JY20230330ZY-LP01 Wnt2 overexpressing lentiviral vector Hanbio HH20230916ZY-LV01 Biological samples Liver Serum Primary liver sinusoidal endothelial cell Primary hepatocyte Mice in this study N/A Chemicals, peptides, and recombinant proteins DMPE-PEG2000-CRLTRKRGLK Ruixibio R-DMK-0125 Acetaminophen MCE HY-66005 Dimethylnitrosamine TCI D0761 Puromycin, Sterile MCE HY-K1057 Blasticidin S, Sterile MCE HY-K1054 TRizolTM Invitrogen 15596026 Fetal bovine serum BioInd 1706126 Dulbecco’s Modified Eagle’s Medium Gibco C11995500 DiI Yeasen 40726ES10 DiO Yeasen 40725ES10 TRITC Phalloidin Yeasen 40734ES75 Cell Counting Kit-8 TargetMol C0005 Critical commercial assays SYBR Green Pro Taq HS qPCR kit Accurate Biology 11701 Mouse Protein Wnt-2 (WNT2) ELISA kit CUSABIO CSB-EL026133MO One Step TUNEL Apoptosis Assay Kit Beyotime C1089 Mouse cluster of differentiation 47 (CD47) ELISA Kit Jonlnbio JL49445 (Continued on next page) Cell Reports Medicine 6, 102033, April 15, 2025 e1 OPEN ACCESS .. Experimental mouse models and exosomes injection 8- to 10-week-old C57BL/6 mice (male) were purchased from Charles River Laboratories.

    Real-time Polymerase Chain Reaction:

    Article Title: A combined "eat me/don't eat me" strategy based on exosome for acute liver injury treatment.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TSG101 Proteintech Cat# 28283-1-AP; RRID:AB_2881104 Anti-VDAC1 Proteintech Cat# 55259-1-AP; RRID:AB_10837225 Anti-Flotillin 1 Proteintech Cat# 15571-1-AP; RRID:AB_2106746 Anti-Wnt2 ABclonal Cat# A23997; RRID:AB_3677320 Anti-CD47 ABclonal Cat# A21904; RRID:AB_3677321 Anti-LYVE1 Invitrogen Cat# 14-0443-82; RRID:AB_1633414 Anti-CLEC4F Invitrogen Cat# PA5-47396; RRID:AB_2608299 Anti-F4/80 Servicebio Cat# GB113373-100; RRID: AB_3677324 Anti-LY6G Proteintech Cat# 65078-1-Ig; RRID:AB_2918382 Anti-Ki67 Servicebio Cat# GB111141-100; RRID: AB_3677325 PE anti-mouse CD31 BioLegend Cat# 102407; RRID:AB_312902 APC anti-mouse F4/80 BioLegend Cat# 123115; RRID:AB_893493 Anti-Rabbit IgG H&L (HRP Conjugated) ZENBIO Cat# 511203; RRID:AB_2927753 Anti-Mouse IgG H&L (HRP Conjugated) ZENBIO Cat# 511103; RRID:AB_2893489 Donkey anti-Rat IgG H&L (Alexa Fluor 594) Invitrogen Cat# A21209; RRID:AB_2535795 Donkey anti-Rat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A48269; RRID:AB_2893137 Donkey anti-Goat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A32814; RRID:AB_2762838 Donkey anti-Rabbit IgG H&L (CY3) Servicebio Cat# GB21403; RRID:AB_2818951 Bacterial and virus strains CD47 overexpressing lentiviral vector Hanbio JY20230330ZY-LP01 Wnt2 overexpressing lentiviral vector Hanbio HH20230916ZY-LV01 Biological samples Liver Serum Primary liver sinusoidal endothelial cell Primary hepatocyte Mice in this study N/A Chemicals, peptides, and recombinant proteins DMPE-PEG2000-CRLTRKRGLK Ruixibio R-DMK-0125 Acetaminophen MCE HY-66005 Dimethylnitrosamine TCI D0761 Puromycin, Sterile MCE HY-K1057 Blasticidin S, Sterile MCE HY-K1054 TRizolTM Invitrogen 15596026 Fetal bovine serum BioInd 1706126 Dulbecco’s Modified Eagle’s Medium Gibco C11995500 DiI Yeasen 40726ES10 DiO Yeasen 40725ES10 TRITC Phalloidin Yeasen 40734ES75 Cell Counting Kit-8 TargetMol C0005 Critical commercial assays SYBR Green Pro Taq HS qPCR kit Accurate Biology 11701 Mouse Protein Wnt-2 (WNT2) ELISA kit CUSABIO CSB-EL026133MO One Step TUNEL Apoptosis Assay Kit Beyotime C1089 Mouse cluster of differentiation 47 (CD47) ELISA Kit Jonlnbio JL49445 (Continued on next page) Cell Reports Medicine 6, 102033, April 15, 2025 e1 OPEN ACCESS .. Experimental mouse models and exosomes injection 8- to 10-week-old C57BL/6 mice (male) were purchased from Charles River Laboratories.

    Enzyme-linked Immunosorbent Assay:

    Article Title: A combined "eat me/don't eat me" strategy based on exosome for acute liver injury treatment.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TSG101 Proteintech Cat# 28283-1-AP; RRID:AB_2881104 Anti-VDAC1 Proteintech Cat# 55259-1-AP; RRID:AB_10837225 Anti-Flotillin 1 Proteintech Cat# 15571-1-AP; RRID:AB_2106746 Anti-Wnt2 ABclonal Cat# A23997; RRID:AB_3677320 Anti-CD47 ABclonal Cat# A21904; RRID:AB_3677321 Anti-LYVE1 Invitrogen Cat# 14-0443-82; RRID:AB_1633414 Anti-CLEC4F Invitrogen Cat# PA5-47396; RRID:AB_2608299 Anti-F4/80 Servicebio Cat# GB113373-100; RRID: AB_3677324 Anti-LY6G Proteintech Cat# 65078-1-Ig; RRID:AB_2918382 Anti-Ki67 Servicebio Cat# GB111141-100; RRID: AB_3677325 PE anti-mouse CD31 BioLegend Cat# 102407; RRID:AB_312902 APC anti-mouse F4/80 BioLegend Cat# 123115; RRID:AB_893493 Anti-Rabbit IgG H&L (HRP Conjugated) ZENBIO Cat# 511203; RRID:AB_2927753 Anti-Mouse IgG H&L (HRP Conjugated) ZENBIO Cat# 511103; RRID:AB_2893489 Donkey anti-Rat IgG H&L (Alexa Fluor 594) Invitrogen Cat# A21209; RRID:AB_2535795 Donkey anti-Rat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A48269; RRID:AB_2893137 Donkey anti-Goat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A32814; RRID:AB_2762838 Donkey anti-Rabbit IgG H&L (CY3) Servicebio Cat# GB21403; RRID:AB_2818951 Bacterial and virus strains CD47 overexpressing lentiviral vector Hanbio JY20230330ZY-LP01 Wnt2 overexpressing lentiviral vector Hanbio HH20230916ZY-LV01 Biological samples Liver Serum Primary liver sinusoidal endothelial cell Primary hepatocyte Mice in this study N/A Chemicals, peptides, and recombinant proteins DMPE-PEG2000-CRLTRKRGLK Ruixibio R-DMK-0125 Acetaminophen MCE HY-66005 Dimethylnitrosamine TCI D0761 Puromycin, Sterile MCE HY-K1057 Blasticidin S, Sterile MCE HY-K1054 TRizolTM Invitrogen 15596026 Fetal bovine serum BioInd 1706126 Dulbecco’s Modified Eagle’s Medium Gibco C11995500 DiI Yeasen 40726ES10 DiO Yeasen 40725ES10 TRITC Phalloidin Yeasen 40734ES75 Cell Counting Kit-8 TargetMol C0005 Critical commercial assays SYBR Green Pro Taq HS qPCR kit Accurate Biology 11701 Mouse Protein Wnt-2 (WNT2) ELISA kit CUSABIO CSB-EL026133MO One Step TUNEL Apoptosis Assay Kit Beyotime C1089 Mouse cluster of differentiation 47 (CD47) ELISA Kit Jonlnbio JL49445 (Continued on next page) Cell Reports Medicine 6, 102033, April 15, 2025 e1 OPEN ACCESS .. Experimental mouse models and exosomes injection 8- to 10-week-old C57BL/6 mice (male) were purchased from Charles River Laboratories.

    TUNEL Assay:

    Article Title: A combined "eat me/don't eat me" strategy based on exosome for acute liver injury treatment.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TSG101 Proteintech Cat# 28283-1-AP; RRID:AB_2881104 Anti-VDAC1 Proteintech Cat# 55259-1-AP; RRID:AB_10837225 Anti-Flotillin 1 Proteintech Cat# 15571-1-AP; RRID:AB_2106746 Anti-Wnt2 ABclonal Cat# A23997; RRID:AB_3677320 Anti-CD47 ABclonal Cat# A21904; RRID:AB_3677321 Anti-LYVE1 Invitrogen Cat# 14-0443-82; RRID:AB_1633414 Anti-CLEC4F Invitrogen Cat# PA5-47396; RRID:AB_2608299 Anti-F4/80 Servicebio Cat# GB113373-100; RRID: AB_3677324 Anti-LY6G Proteintech Cat# 65078-1-Ig; RRID:AB_2918382 Anti-Ki67 Servicebio Cat# GB111141-100; RRID: AB_3677325 PE anti-mouse CD31 BioLegend Cat# 102407; RRID:AB_312902 APC anti-mouse F4/80 BioLegend Cat# 123115; RRID:AB_893493 Anti-Rabbit IgG H&L (HRP Conjugated) ZENBIO Cat# 511203; RRID:AB_2927753 Anti-Mouse IgG H&L (HRP Conjugated) ZENBIO Cat# 511103; RRID:AB_2893489 Donkey anti-Rat IgG H&L (Alexa Fluor 594) Invitrogen Cat# A21209; RRID:AB_2535795 Donkey anti-Rat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A48269; RRID:AB_2893137 Donkey anti-Goat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A32814; RRID:AB_2762838 Donkey anti-Rabbit IgG H&L (CY3) Servicebio Cat# GB21403; RRID:AB_2818951 Bacterial and virus strains CD47 overexpressing lentiviral vector Hanbio JY20230330ZY-LP01 Wnt2 overexpressing lentiviral vector Hanbio HH20230916ZY-LV01 Biological samples Liver Serum Primary liver sinusoidal endothelial cell Primary hepatocyte Mice in this study N/A Chemicals, peptides, and recombinant proteins DMPE-PEG2000-CRLTRKRGLK Ruixibio R-DMK-0125 Acetaminophen MCE HY-66005 Dimethylnitrosamine TCI D0761 Puromycin, Sterile MCE HY-K1057 Blasticidin S, Sterile MCE HY-K1054 TRizolTM Invitrogen 15596026 Fetal bovine serum BioInd 1706126 Dulbecco’s Modified Eagle’s Medium Gibco C11995500 DiI Yeasen 40726ES10 DiO Yeasen 40725ES10 TRITC Phalloidin Yeasen 40734ES75 Cell Counting Kit-8 TargetMol C0005 Critical commercial assays SYBR Green Pro Taq HS qPCR kit Accurate Biology 11701 Mouse Protein Wnt-2 (WNT2) ELISA kit CUSABIO CSB-EL026133MO One Step TUNEL Apoptosis Assay Kit Beyotime C1089 Mouse cluster of differentiation 47 (CD47) ELISA Kit Jonlnbio JL49445 (Continued on next page) Cell Reports Medicine 6, 102033, April 15, 2025 e1 OPEN ACCESS .. Experimental mouse models and exosomes injection 8- to 10-week-old C57BL/6 mice (male) were purchased from Charles River Laboratories.

    Apoptosis Assay:

    Article Title: A combined "eat me/don't eat me" strategy based on exosome for acute liver injury treatment.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TSG101 Proteintech Cat# 28283-1-AP; RRID:AB_2881104 Anti-VDAC1 Proteintech Cat# 55259-1-AP; RRID:AB_10837225 Anti-Flotillin 1 Proteintech Cat# 15571-1-AP; RRID:AB_2106746 Anti-Wnt2 ABclonal Cat# A23997; RRID:AB_3677320 Anti-CD47 ABclonal Cat# A21904; RRID:AB_3677321 Anti-LYVE1 Invitrogen Cat# 14-0443-82; RRID:AB_1633414 Anti-CLEC4F Invitrogen Cat# PA5-47396; RRID:AB_2608299 Anti-F4/80 Servicebio Cat# GB113373-100; RRID: AB_3677324 Anti-LY6G Proteintech Cat# 65078-1-Ig; RRID:AB_2918382 Anti-Ki67 Servicebio Cat# GB111141-100; RRID: AB_3677325 PE anti-mouse CD31 BioLegend Cat# 102407; RRID:AB_312902 APC anti-mouse F4/80 BioLegend Cat# 123115; RRID:AB_893493 Anti-Rabbit IgG H&L (HRP Conjugated) ZENBIO Cat# 511203; RRID:AB_2927753 Anti-Mouse IgG H&L (HRP Conjugated) ZENBIO Cat# 511103; RRID:AB_2893489 Donkey anti-Rat IgG H&L (Alexa Fluor 594) Invitrogen Cat# A21209; RRID:AB_2535795 Donkey anti-Rat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A48269; RRID:AB_2893137 Donkey anti-Goat IgG H&L (Alexa Fluor 488) Invitrogen Cat# A32814; RRID:AB_2762838 Donkey anti-Rabbit IgG H&L (CY3) Servicebio Cat# GB21403; RRID:AB_2818951 Bacterial and virus strains CD47 overexpressing lentiviral vector Hanbio JY20230330ZY-LP01 Wnt2 overexpressing lentiviral vector Hanbio HH20230916ZY-LV01 Biological samples Liver Serum Primary liver sinusoidal endothelial cell Primary hepatocyte Mice in this study N/A Chemicals, peptides, and recombinant proteins DMPE-PEG2000-CRLTRKRGLK Ruixibio R-DMK-0125 Acetaminophen MCE HY-66005 Dimethylnitrosamine TCI D0761 Puromycin, Sterile MCE HY-K1057 Blasticidin S, Sterile MCE HY-K1054 TRizolTM Invitrogen 15596026 Fetal bovine serum BioInd 1706126 Dulbecco’s Modified Eagle’s Medium Gibco C11995500 DiI Yeasen 40726ES10 DiO Yeasen 40725ES10 TRITC Phalloidin Yeasen 40734ES75 Cell Counting Kit-8 TargetMol C0005 Critical commercial assays SYBR Green Pro Taq HS qPCR kit Accurate Biology 11701 Mouse Protein Wnt-2 (WNT2) ELISA kit CUSABIO CSB-EL026133MO One Step TUNEL Apoptosis Assay Kit Beyotime C1089 Mouse cluster of differentiation 47 (CD47) ELISA Kit Jonlnbio JL49445 (Continued on next page) Cell Reports Medicine 6, 102033, April 15, 2025 e1 OPEN ACCESS .. Experimental mouse models and exosomes injection 8- to 10-week-old C57BL/6 mice (male) were purchased from Charles River Laboratories.

    Single Cell:

    Article Title: Wnt activation and dual SMAD inhibition for induction and maintenance of hindbrain-like neural stem cell from hiPSCs.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SOX1 Cell Signaling 4194S SOX2 R&D systems MAB2018 NESTIN R&D systems MAB1259 NANOG R&D systems AF1997 POU5F1 Santa Cruz Biotechnology sc-5279 PAX6 Abcam EPR15858 TUBB3 GeneTex GTX85469 OLIG2 GeneTex GTX132732 GFAP Santa Cruz Biotechnology sc-33673 hNCAM Santa Cruz Biotechnology sc-106 Chemicals, peptides, and recombinant proteins A-83-01 Tocris 2939 CHIR9902 Axon 1386 LDN193189 MedChem Express HY-12071 Y-27632 WAKO 253–00513 iMatrix-511 Nippi 892021 NeurobasalTM ThermoFisher 21103049 DMEM/F-12 Gibco 11320–033 B27 ThermoFisher 17504044 N-2 ThermoFisher 17502048 GlutaMAXTM Gibco 35050 Ascorbic acid Nacalai Tesque 03420–52 Insulin WAKO 097–06474 BDNF BioLegend 788902 GDNF BioLegend 760402 Deposited data Single cell RNAseq data This paper GEO: GSE317025 RNAseq data This paper GEO: GSE317319 RNAseq datasets of human iPSCs Kamiya et al.18 GEO: GSE206128 Experimental models: Cell lines 1231A3 iPSC Obtained from the Yamanaka laboratory, CiRA, Japan https://cellbank.brc.riken.jp/cell_bank/CellInfo/ ?cellNo=HPS0381&lang=En RPChiPS771-2 ReproCELL, N/A Ff-XT28s05-Abo_To CiRA foundation, CiRA, Japan https://www.cira-foundation.or.jp/e/assets/file/ provision-of-ips-cells/E_Ff-XT28s05_ABo_To.pdf Experimental models: Organisms/strains NSG mice The Jackson Laboratory N/A Oligonucleotides RT-qPCR primers, see Table S1 This paper N/A Software and algorithms Python 3.11 https://www.python.org/downloads/ N/A RStudio https://posit.co/download/rstudio-desktop/ N/A Custom code for figure generation This paper https://doi.org/10.5281/zenodo.18653633 e1 Cell Reports Methods 6, 101372, April 20, 2026 Article ll OPEN ACCESS ..

    RNA sequencing:

    Article Title: Wnt activation and dual SMAD inhibition for induction and maintenance of hindbrain-like neural stem cell from hiPSCs.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SOX1 Cell Signaling 4194S SOX2 R&D systems MAB2018 NESTIN R&D systems MAB1259 NANOG R&D systems AF1997 POU5F1 Santa Cruz Biotechnology sc-5279 PAX6 Abcam EPR15858 TUBB3 GeneTex GTX85469 OLIG2 GeneTex GTX132732 GFAP Santa Cruz Biotechnology sc-33673 hNCAM Santa Cruz Biotechnology sc-106 Chemicals, peptides, and recombinant proteins A-83-01 Tocris 2939 CHIR9902 Axon 1386 LDN193189 MedChem Express HY-12071 Y-27632 WAKO 253–00513 iMatrix-511 Nippi 892021 NeurobasalTM ThermoFisher 21103049 DMEM/F-12 Gibco 11320–033 B27 ThermoFisher 17504044 N-2 ThermoFisher 17502048 GlutaMAXTM Gibco 35050 Ascorbic acid Nacalai Tesque 03420–52 Insulin WAKO 097–06474 BDNF BioLegend 788902 GDNF BioLegend 760402 Deposited data Single cell RNAseq data This paper GEO: GSE317025 RNAseq data This paper GEO: GSE317319 RNAseq datasets of human iPSCs Kamiya et al.18 GEO: GSE206128 Experimental models: Cell lines 1231A3 iPSC Obtained from the Yamanaka laboratory, CiRA, Japan https://cellbank.brc.riken.jp/cell_bank/CellInfo/ ?cellNo=HPS0381&lang=En RPChiPS771-2 ReproCELL, N/A Ff-XT28s05-Abo_To CiRA foundation, CiRA, Japan https://www.cira-foundation.or.jp/e/assets/file/ provision-of-ips-cells/E_Ff-XT28s05_ABo_To.pdf Experimental models: Organisms/strains NSG mice The Jackson Laboratory N/A Oligonucleotides RT-qPCR primers, see Table S1 This paper N/A Software and algorithms Python 3.11 https://www.python.org/downloads/ N/A RStudio https://posit.co/download/rstudio-desktop/ N/A Custom code for figure generation This paper https://doi.org/10.5281/zenodo.18653633 e1 Cell Reports Methods 6, 101372, April 20, 2026 Article ll OPEN ACCESS ..

    Quantitative RT-PCR:

    Article Title: Wnt activation and dual SMAD inhibition for induction and maintenance of hindbrain-like neural stem cell from hiPSCs.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SOX1 Cell Signaling 4194S SOX2 R&D systems MAB2018 NESTIN R&D systems MAB1259 NANOG R&D systems AF1997 POU5F1 Santa Cruz Biotechnology sc-5279 PAX6 Abcam EPR15858 TUBB3 GeneTex GTX85469 OLIG2 GeneTex GTX132732 GFAP Santa Cruz Biotechnology sc-33673 hNCAM Santa Cruz Biotechnology sc-106 Chemicals, peptides, and recombinant proteins A-83-01 Tocris 2939 CHIR9902 Axon 1386 LDN193189 MedChem Express HY-12071 Y-27632 WAKO 253–00513 iMatrix-511 Nippi 892021 NeurobasalTM ThermoFisher 21103049 DMEM/F-12 Gibco 11320–033 B27 ThermoFisher 17504044 N-2 ThermoFisher 17502048 GlutaMAXTM Gibco 35050 Ascorbic acid Nacalai Tesque 03420–52 Insulin WAKO 097–06474 BDNF BioLegend 788902 GDNF BioLegend 760402 Deposited data Single cell RNAseq data This paper GEO: GSE317025 RNAseq data This paper GEO: GSE317319 RNAseq datasets of human iPSCs Kamiya et al.18 GEO: GSE206128 Experimental models: Cell lines 1231A3 iPSC Obtained from the Yamanaka laboratory, CiRA, Japan https://cellbank.brc.riken.jp/cell_bank/CellInfo/ ?cellNo=HPS0381&lang=En RPChiPS771-2 ReproCELL, N/A Ff-XT28s05-Abo_To CiRA foundation, CiRA, Japan https://www.cira-foundation.or.jp/e/assets/file/ provision-of-ips-cells/E_Ff-XT28s05_ABo_To.pdf Experimental models: Organisms/strains NSG mice The Jackson Laboratory N/A Oligonucleotides RT-qPCR primers, see Table S1 This paper N/A Software and algorithms Python 3.11 https://www.python.org/downloads/ N/A RStudio https://posit.co/download/rstudio-desktop/ N/A Custom code for figure generation This paper https://doi.org/10.5281/zenodo.18653633 e1 Cell Reports Methods 6, 101372, April 20, 2026 Article ll OPEN ACCESS ..

    Software:

    Article Title: Wnt activation and dual SMAD inhibition for induction and maintenance of hindbrain-like neural stem cell from hiPSCs.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SOX1 Cell Signaling 4194S SOX2 R&D systems MAB2018 NESTIN R&D systems MAB1259 NANOG R&D systems AF1997 POU5F1 Santa Cruz Biotechnology sc-5279 PAX6 Abcam EPR15858 TUBB3 GeneTex GTX85469 OLIG2 GeneTex GTX132732 GFAP Santa Cruz Biotechnology sc-33673 hNCAM Santa Cruz Biotechnology sc-106 Chemicals, peptides, and recombinant proteins A-83-01 Tocris 2939 CHIR9902 Axon 1386 LDN193189 MedChem Express HY-12071 Y-27632 WAKO 253–00513 iMatrix-511 Nippi 892021 NeurobasalTM ThermoFisher 21103049 DMEM/F-12 Gibco 11320–033 B27 ThermoFisher 17504044 N-2 ThermoFisher 17502048 GlutaMAXTM Gibco 35050 Ascorbic acid Nacalai Tesque 03420–52 Insulin WAKO 097–06474 BDNF BioLegend 788902 GDNF BioLegend 760402 Deposited data Single cell RNAseq data This paper GEO: GSE317025 RNAseq data This paper GEO: GSE317319 RNAseq datasets of human iPSCs Kamiya et al.18 GEO: GSE206128 Experimental models: Cell lines 1231A3 iPSC Obtained from the Yamanaka laboratory, CiRA, Japan https://cellbank.brc.riken.jp/cell_bank/CellInfo/ ?cellNo=HPS0381&lang=En RPChiPS771-2 ReproCELL, N/A Ff-XT28s05-Abo_To CiRA foundation, CiRA, Japan https://www.cira-foundation.or.jp/e/assets/file/ provision-of-ips-cells/E_Ff-XT28s05_ABo_To.pdf Experimental models: Organisms/strains NSG mice The Jackson Laboratory N/A Oligonucleotides RT-qPCR primers, see Table S1 This paper N/A Software and algorithms Python 3.11 https://www.python.org/downloads/ N/A RStudio https://posit.co/download/rstudio-desktop/ N/A Custom code for figure generation This paper https://doi.org/10.5281/zenodo.18653633 e1 Cell Reports Methods 6, 101372, April 20, 2026 Article ll OPEN ACCESS ..

    RNA Sequencing:

    Article Title: Targeted degradation of CDK9 potently disrupts the MYC-regulated network.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-Vinculin (E1E9V) Cell Signaling Technology Cat#13901S; RRID: AB_2728768 Mouse monoclonal anti-Rpb1 CTD (4H8) Cell Signaling Technology Cat#2629S; RRID: AB_2167468 Rabbit monoclonal anti-cMYC (D84C12) Cell Signaling Technology Cat#5605S; RRID: AB_1903938 Rabbit monoclonal anti-P-Rpb1 S2 (E1Z3G) Cell Signaling Technology Cat#13499S; RRID: AB_2798238 Rabbit anti-Histone H3 Cell Signaling Technology Cat#9715L; RRID: AB_331563 Rabbit monoclonal anti-GAPDH (14C10) Cell Signaling Technology Cat#2118S; RRID: AB_561053 Mouse monoclonal anti-CDK7 (MO1) Cell Signaling Technology Cat#2916S; RRID: AB_2077142 Rabbit monoclonal anti-CDK9 (C12F7) Cell Signaling Technology Cat#2316S; RRID: AB_2291505 Rabbit monoclonal anti-CDK10 (D8Z7Z) Cell Signaling Technology Cat#36106S; RRID: AB_2799094 Ant-mouse IgG HRP-Linked Cell Signaling Technology Cat#7076S; RRID: AB_330924 Anti-rabbit IgG HRP-Linked Cell Signaling Technology Cat#7074S; RRID: AB_2099233 Rabbit polyclonal anti-DDX21 Novus Biologicals Cat#NB100-1718; RRID: AB_523207 Rabbit monoclonal anti-NPM1 Abcam Cat#ab180607 Alexa Fluor 488 Thermo Fisher Scientific Cat#A-11008; RRID: AB_143165 Alexa Fluor 647 Thermo Fisher Scientific Cat#A-27040; RRID: AB_2536101 Chemicals, peptides, and recombinant proteins KI-CDK9d-32 This manuscript N/A KI-CDK9d-32N This manuscript N/A KI-ARv-03 Koehler Lab Richters et al. KB-0742 dihydrochloride Medchem Express Cat#HY-137478A Protease inhibitors Thermo FIsher Scientific Cat#87786 Phosphatase inhibitors (PhosSTOP) Millipore SIGMA Cat#4906845001 Critical commercial assays HotSpot Wildtype Kinase Panel Reaction Biology N/A Nano-Glo HiBiT Lytic Detection System Promega Cat#N3030 PRISM Screen Broad Institute N/A Deposited data RNA Sequencing data of MOLT-4 Cells treated with KI-CDK9d-32 and KB-0742 This manuscript GEO: GSE263153 Mass Spectrometry Proteomics data of MOLT-4 Cells treated with KI-CDK9d-32 This manuscript ProteomeXchange: PXD052300; 10.6019/PXD052300 Experimental models: Cell lines Human: MOLT-4 ATCC cat#CRL-1582 Human: RH-4 Cellosaurus cat#CVL_5916 Human: PSN-1 ATCC cat#CRL-3211 Human: HeLa ATCC cat#CCL-2 Oligonucleotides MYC Forward: 50-tcctcggattctctgctctc-30 This manuscript N/A MYC Reverse: 50-tcttcctcatcttcttgttcctc-30 This manuscript N/A CDK9 Forward: 50-ctgaagaaggtgctgatggaa-30 This manuscript N/A CDK9 Reverse: 50-agttgaccacattctcgtgtt-30 This manuscript N/A POLR2A Forward: 50- ggatgatctggaatgctcag-30 This manuscript N/A POLR2A Reverse: 50- attccttgactccctccac-30 This manuscript N/A (Continued on next page) Cell Chemical Biology 32, 1–14.e1–e10, April 17, 2025 e1 .. Human acute lymphoblastic leukemia cells MOLT-4 (ATCC, CRL-1582, sex of cell: male), rhabdomyosarcoma cells RH-4 (Cellosaurus, CVL_5916, sex of cell: female), pancreatic adenocarcinoma cells PSN-1 (ATCC, CRL-3211, sex of cell: male), and adenocarcinoma HeLa cells (ATCC, CCL-2, sex of cell: female) were obtained from the Koch Institute’s Preclinical Modeling (ES Cell and Transgenics Facility) Core.

    Mass Spectrometry:

    Article Title: Targeted degradation of CDK9 potently disrupts the MYC-regulated network.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-Vinculin (E1E9V) Cell Signaling Technology Cat#13901S; RRID: AB_2728768 Mouse monoclonal anti-Rpb1 CTD (4H8) Cell Signaling Technology Cat#2629S; RRID: AB_2167468 Rabbit monoclonal anti-cMYC (D84C12) Cell Signaling Technology Cat#5605S; RRID: AB_1903938 Rabbit monoclonal anti-P-Rpb1 S2 (E1Z3G) Cell Signaling Technology Cat#13499S; RRID: AB_2798238 Rabbit anti-Histone H3 Cell Signaling Technology Cat#9715L; RRID: AB_331563 Rabbit monoclonal anti-GAPDH (14C10) Cell Signaling Technology Cat#2118S; RRID: AB_561053 Mouse monoclonal anti-CDK7 (MO1) Cell Signaling Technology Cat#2916S; RRID: AB_2077142 Rabbit monoclonal anti-CDK9 (C12F7) Cell Signaling Technology Cat#2316S; RRID: AB_2291505 Rabbit monoclonal anti-CDK10 (D8Z7Z) Cell Signaling Technology Cat#36106S; RRID: AB_2799094 Ant-mouse IgG HRP-Linked Cell Signaling Technology Cat#7076S; RRID: AB_330924 Anti-rabbit IgG HRP-Linked Cell Signaling Technology Cat#7074S; RRID: AB_2099233 Rabbit polyclonal anti-DDX21 Novus Biologicals Cat#NB100-1718; RRID: AB_523207 Rabbit monoclonal anti-NPM1 Abcam Cat#ab180607 Alexa Fluor 488 Thermo Fisher Scientific Cat#A-11008; RRID: AB_143165 Alexa Fluor 647 Thermo Fisher Scientific Cat#A-27040; RRID: AB_2536101 Chemicals, peptides, and recombinant proteins KI-CDK9d-32 This manuscript N/A KI-CDK9d-32N This manuscript N/A KI-ARv-03 Koehler Lab Richters et al. KB-0742 dihydrochloride Medchem Express Cat#HY-137478A Protease inhibitors Thermo FIsher Scientific Cat#87786 Phosphatase inhibitors (PhosSTOP) Millipore SIGMA Cat#4906845001 Critical commercial assays HotSpot Wildtype Kinase Panel Reaction Biology N/A Nano-Glo HiBiT Lytic Detection System Promega Cat#N3030 PRISM Screen Broad Institute N/A Deposited data RNA Sequencing data of MOLT-4 Cells treated with KI-CDK9d-32 and KB-0742 This manuscript GEO: GSE263153 Mass Spectrometry Proteomics data of MOLT-4 Cells treated with KI-CDK9d-32 This manuscript ProteomeXchange: PXD052300; 10.6019/PXD052300 Experimental models: Cell lines Human: MOLT-4 ATCC cat#CRL-1582 Human: RH-4 Cellosaurus cat#CVL_5916 Human: PSN-1 ATCC cat#CRL-3211 Human: HeLa ATCC cat#CCL-2 Oligonucleotides MYC Forward: 50-tcctcggattctctgctctc-30 This manuscript N/A MYC Reverse: 50-tcttcctcatcttcttgttcctc-30 This manuscript N/A CDK9 Forward: 50-ctgaagaaggtgctgatggaa-30 This manuscript N/A CDK9 Reverse: 50-agttgaccacattctcgtgtt-30 This manuscript N/A POLR2A Forward: 50- ggatgatctggaatgctcag-30 This manuscript N/A POLR2A Reverse: 50- attccttgactccctccac-30 This manuscript N/A (Continued on next page) Cell Chemical Biology 32, 1–14.e1–e10, April 17, 2025 e1 .. Human acute lymphoblastic leukemia cells MOLT-4 (ATCC, CRL-1582, sex of cell: male), rhabdomyosarcoma cells RH-4 (Cellosaurus, CVL_5916, sex of cell: female), pancreatic adenocarcinoma cells PSN-1 (ATCC, CRL-3211, sex of cell: male), and adenocarcinoma HeLa cells (ATCC, CCL-2, sex of cell: female) were obtained from the Koch Institute’s Preclinical Modeling (ES Cell and Transgenics Facility) Core.

    Histone Deacetylase Assay:

    Article Title: Inhibiting UPF1 methylation enhances tumor immunotherapy sensitivity by reducing nonsense-mediated mRNA decay.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies UPF1 Abclonal A5071 GAPDH Abclonal A19056 LC3B Abclonal A19665 mono-methyl arginine Cell Signaling Technology #8015 asymmetric di-methyl arginine Cell Signaling Technology #13522 FLAG tag Cell Signaling Technology #14793 HA-tag Cell Signaling Technology #3724 .. UPF1 Proteintech 66898-1-Ig ATG5 Proteintech 10181-2-AP BECN1 Proteintech 11306-1-AP NDP52 Proteintech 66401-1-Ig asymmetric di-methyl-histone H3 PTM BIO PTM-650RM Goat anti-rabbit (HRP) Abclonal AS062 Goat anti-mouse (HRP) Abclonal AS061 DyLight 488, goat anti-mouse Abbkine A23210 Dylight 649, goat anti-rabbit IgG Abbkine A23620 FITC-conjugated anti-mouse CD8 BioLegend 100804 Brilliant Violet 650 TM anti-mouse CD8 BioLegend 100741 Brilliant Violet 510 TM anti-mouse CD4 BioLegend 157219 Zombie NIR Fixable Viability Kit BioLegend 423106 Brilliant Violet 785 TM anti-mouse CD3 BioLegend 100232 Biological samples Human Colorectal Cancer Samples TongjiHospital (Wuhan) N/A Chemicals, peptides, and recombinant proteins EZM 2302 MedChemExpress HY-111109 NMDI14 MedChemExpress HY-111374 chloroquine phosphate MedChemExpress HY-17589 CHX MedChemExpress HY-12320 MG132 MedChemExpress HY-13259 adenosine dialdehyde MedChemExpress HY-123055 deacetylase inhibitor cocktail MedChemExpress HY-K0030 Benzyl-α-GalNAc MedChemExpress HY-129389 anti-HA magnetic beads MedChemExpress HY-K0201 anti-Flag magnetic beads MedChemExpress HY-K0207 protein A/G magnetic beads MedChemExpress HY-K0202 EBSS Beyotime C0213 Tunicamycin Beyotime SC0393 Experimental models: Cell lines SW480 ATCC CCL-228 .. (Continued on next page) Cell Reports 44, 115919, July 22, 2025 17 Continued REAGENT or RESOURCE SOURCE IDENTIFIER SW620 ATCC CCL-227 HCT116 ATCC CCL-247 RKO ATCC CRL-2577 LOVO ATCC CCL-229 SW48 ATCC CCL-231 HEK 293T ATCC CRL-3216 CT26 ATCC CRL-2638 MC38 Cell Resource Center, Peking Union Medical College 1101MOU-PUMC000523 Oligonucleotides mCherry-Forward Primer CACGAGTTCGAGATCGAGGG This paper N/A mCherry-Reverse Primer CAAGTAGTCGGGGATGTCGG This paper N/A EGFP-Forward Primer GGACGACGGCAACTACAAGA Thispaper N/A EGFP-Reverse Primer AAGTCGATGCCCTTCAGCTC This paper N/A Human shPRMT4 #1 CTATGGGAACTGGGACACTTT This paper N/A Human shPRMT4 #2 GCAGAACATGATGCAGGACTA This paper N/A Mouse shPRMT4 #1 CCCGACCAACACCATGCACTA This paper N/A Mouse shPRMT4 #2 GCCATGAAGATGTGTGTGTTT This paper N/A Human UPF1 sgRNAs GAGATATGCCTGCGGTACAA This paper N/A Human NDP52 sgRNAs CAATCCAATCCTTTCGACGA This paper N/A Human ATG5 sgRNAs GTGCTTCGAGATGTGTGGTT This paper N/A Human BECN1 sgRNAs ATTTATTGAAACTCCTCGCC This paper N/A Mouse UPF1 sgRNAs GCCGAGGAAATACTTCTGGC This paper N/A Recombinant DNA pEnCMV-UPF1(human)-FLAG MiaolingBiotech P19194 pLV3-CMV-HA-UPF1(mouse)-Puro MiaolingBiotech P42350 pCMV-PPRMT4(human)-FLAG-Neo MiaolingBiotech P51354 pLV3-CMV-PPRMT4(mouse)-HA-Puro MiaolingBiotech P46703 pCMV-NIX(human)-FLAG-Neo MiaolingBiotech P53425 pCMV-NDP52(human)-FLAG-Neo MiaolingBiotech P56753 pCMV-TOLLIP(human)-FLAG-SV40-Neo MiaolingBiotech P36596 pCMV-P62(human)-FLAG-Neo MiaolingBiotech P45981 pCMV-OPTN(human)-Myc-Neo MiaolingBiotech P66058 pCMV-TurboRFP-NBR1(human)-FLAG-Neo MiaolingBiotech P53428 Software and algorithms ImageJ NIH https://imagej.nih.gov/ij/ PRISM GraphPadSoftware Version 8 FlowJo FlowJo Version 10 (Continued on next page) 18 Cell Reports 44, 115919, July 22, 2025

    Magnetic Beads:

    Article Title: Inhibiting UPF1 methylation enhances tumor immunotherapy sensitivity by reducing nonsense-mediated mRNA decay.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies UPF1 Abclonal A5071 GAPDH Abclonal A19056 LC3B Abclonal A19665 mono-methyl arginine Cell Signaling Technology #8015 asymmetric di-methyl arginine Cell Signaling Technology #13522 FLAG tag Cell Signaling Technology #14793 HA-tag Cell Signaling Technology #3724 .. UPF1 Proteintech 66898-1-Ig ATG5 Proteintech 10181-2-AP BECN1 Proteintech 11306-1-AP NDP52 Proteintech 66401-1-Ig asymmetric di-methyl-histone H3 PTM BIO PTM-650RM Goat anti-rabbit (HRP) Abclonal AS062 Goat anti-mouse (HRP) Abclonal AS061 DyLight 488, goat anti-mouse Abbkine A23210 Dylight 649, goat anti-rabbit IgG Abbkine A23620 FITC-conjugated anti-mouse CD8 BioLegend 100804 Brilliant Violet 650 TM anti-mouse CD8 BioLegend 100741 Brilliant Violet 510 TM anti-mouse CD4 BioLegend 157219 Zombie NIR Fixable Viability Kit BioLegend 423106 Brilliant Violet 785 TM anti-mouse CD3 BioLegend 100232 Biological samples Human Colorectal Cancer Samples TongjiHospital (Wuhan) N/A Chemicals, peptides, and recombinant proteins EZM 2302 MedChemExpress HY-111109 NMDI14 MedChemExpress HY-111374 chloroquine phosphate MedChemExpress HY-17589 CHX MedChemExpress HY-12320 MG132 MedChemExpress HY-13259 adenosine dialdehyde MedChemExpress HY-123055 deacetylase inhibitor cocktail MedChemExpress HY-K0030 Benzyl-α-GalNAc MedChemExpress HY-129389 anti-HA magnetic beads MedChemExpress HY-K0201 anti-Flag magnetic beads MedChemExpress HY-K0207 protein A/G magnetic beads MedChemExpress HY-K0202 EBSS Beyotime C0213 Tunicamycin Beyotime SC0393 Experimental models: Cell lines SW480 ATCC CCL-228 .. (Continued on next page) Cell Reports 44, 115919, July 22, 2025 17 Continued REAGENT or RESOURCE SOURCE IDENTIFIER SW620 ATCC CCL-227 HCT116 ATCC CCL-247 RKO ATCC CRL-2577 LOVO ATCC CCL-229 SW48 ATCC CCL-231 HEK 293T ATCC CRL-3216 CT26 ATCC CRL-2638 MC38 Cell Resource Center, Peking Union Medical College 1101MOU-PUMC000523 Oligonucleotides mCherry-Forward Primer CACGAGTTCGAGATCGAGGG This paper N/A mCherry-Reverse Primer CAAGTAGTCGGGGATGTCGG This paper N/A EGFP-Forward Primer GGACGACGGCAACTACAAGA Thispaper N/A EGFP-Reverse Primer AAGTCGATGCCCTTCAGCTC This paper N/A Human shPRMT4 #1 CTATGGGAACTGGGACACTTT This paper N/A Human shPRMT4 #2 GCAGAACATGATGCAGGACTA This paper N/A Mouse shPRMT4 #1 CCCGACCAACACCATGCACTA This paper N/A Mouse shPRMT4 #2 GCCATGAAGATGTGTGTGTTT This paper N/A Human UPF1 sgRNAs GAGATATGCCTGCGGTACAA This paper N/A Human NDP52 sgRNAs CAATCCAATCCTTTCGACGA This paper N/A Human ATG5 sgRNAs GTGCTTCGAGATGTGTGGTT This paper N/A Human BECN1 sgRNAs ATTTATTGAAACTCCTCGCC This paper N/A Mouse UPF1 sgRNAs GCCGAGGAAATACTTCTGGC This paper N/A Recombinant DNA pEnCMV-UPF1(human)-FLAG MiaolingBiotech P19194 pLV3-CMV-HA-UPF1(mouse)-Puro MiaolingBiotech P42350 pCMV-PPRMT4(human)-FLAG-Neo MiaolingBiotech P51354 pLV3-CMV-PPRMT4(mouse)-HA-Puro MiaolingBiotech P46703 pCMV-NIX(human)-FLAG-Neo MiaolingBiotech P53425 pCMV-NDP52(human)-FLAG-Neo MiaolingBiotech P56753 pCMV-TOLLIP(human)-FLAG-SV40-Neo MiaolingBiotech P36596 pCMV-P62(human)-FLAG-Neo MiaolingBiotech P45981 pCMV-OPTN(human)-Myc-Neo MiaolingBiotech P66058 pCMV-TurboRFP-NBR1(human)-FLAG-Neo MiaolingBiotech P53428 Software and algorithms ImageJ NIH https://imagej.nih.gov/ij/ PRISM GraphPadSoftware Version 8 FlowJo FlowJo Version 10 (Continued on next page) 18 Cell Reports 44, 115919, July 22, 2025

    Staining:

    Article Title: NFE2-driven neutrophil polarization promotes pancreatic cancer liver metastasis progression.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat Anti-Rabbit IgG H&L (HRP) Abcam Cat# ab205718; RRID:AB_2819160 Recombinant Anti-S100A12/CGRP antibody Abcam Cat# ab272713; RRID:AB_2920851 Recombinant Anti-S100A8 + S100A9 antibody Abcam Cat# ab288715 PADI4 antibody Proteintech Cat# 17373-1-AP; RRID:AB_2878398 Recombinant Anti-MMP9 antibody Abcam Cat# ab283575; RRID:AB_2928971 TGM2 antibody Proteintech Cat# 15100-1-AP; RRID:AB_2202885 Galectin-3 Polyclonal antibody Proteintech Cat# 14979-1-AP; RRID:AB_2136768 Recombinant Anti-Ly6g antibody Abcam Cat# ab238132; RRID:AB_2923218 MPO antibody Proteintech Cat# 22225-1-AP; RRID:AB_2879037 Recombinant Anti-CD66b antibody Abcam Cat# ab300122; RRID:AB_3097803 Mouse Anti-CD68 Monoclonal Antibody, Unconjugated, Clone KP1 Abcam Cat# ab955; RRID:AB_307338 NFE2 antibody Proteintech Cat# 11089-1-AP; RRID:AB_2152928 Recombinant Anti-Histone H3 (citrulline R2 + R8 + R17) antibody Abcam Cat# ab281584 Recombinant Anti-Macrophage Inflammatory Protein 1 alpha/CCL3 + CCL3L1 antibody Abcam Cat# ab259372; RRID:AB_3094596 ISG15 antibody Proteintech Cat# 15981-1-AP; RRID:AB_2126302 GRO Alpha antibody Proteintech Cat# 12335-1-AP; RRID:AB_2087568 HSPA6 antibody Proteintech Cat# 13616-1-AP; RRID:AB_2120122 RPS19 antibody Proteintech Cat# 15085-1-AP; RRID:AB_2180202 Fixable Viability Stain 780 BD Biosciences Cat# 565388; RRID:AB_2869673 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc BlockTM) Clone 2.4G2 BD Biosciences Cat# 553141; RRID:AB_394656 FITC anti-mouse CD45 Recombinant BioLegend Cat# 157608; RRID:AB_2832554 Brilliant Violet 421(TM) anti-mouse/human CD11b BioLegend Cat# 101235; RRID:AB_10897942 PE anti-mouse Ly-6G BioLegend Cat# 127607; RRID:AB_1186104 Alexa Fluor(R) 700 anti-mouse CD3 BioLegend Cat# 100216; RRID:AB_493697 Brilliant Violet 510(TM) anti-mouse CD8a BioLegend Cat# 100752; RRID:AB_2563057 PerCP/Cyanine5.5 anti-mouse F4/80 BioLegend Cat# 123128; RRID:AB_893484 PE/Cyanine7 anti-mouse CD279 (PD-1) BioLegend Cat# 109110; RRID:AB_572017 HRP-conjugated goat anti-mouse secondary antibody Zsbio ZB-2305 HRP-conjugated goat anti-rabbit secondary antibody Zsbio ZB-2306 Bacterial and virus strains LV-Tgfb1-RNAi Genechem N/A LV-Luciferase Genechem N/A Biological samples Surgical excision samples Peking Union Medical College Hospital N/A Chemicals, peptides, and recombinant proteins SM16 MedChemExpress Cat# HY-111482 Cl-amidine Selleck Cat# S8141 (Continued on next page) 16 Cell Reports 44, 115226, February 25, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER anti-mouse Ly6G BioXcell Cat# BE0075-1 IgG2a isotype control BioXcell Cat# BE0085 SB431542 MedChemExpress Cat# HY-10431 HumanKine recombinant human TGF-b Proteintech Cat# HZ-1011 Collagenase IV Thermo Fisher SCIENTIFIC Cat# 17104019 DNase I Thermo Fisher SCIENTIFIC Cat# 90083 Dispase II Thermo Fisher SCIENTIFIC Cat# 17105041 Heparin sodium MedChemExpress Cat# HY-17567A EGTA Beyotime Biotechnology Ca# ST068 DMEM/F12 Gibco Cat# 11320033 DMEM Gibco Cat# 11965118 IMDM Procell Cat# PM150510 RPMI-1640 Procell Cat# PM150110 PBS Procell Cat# PB180327 FBS Thermo Fisher SCIENTIFIC Cat# A3160901 BSA Beyotime Biotechnology Cat# ST023 DPBS Thermo Fisher SCIENTIFIC Cat# 14190144 Percoll Cytiva Cat# 17089101 Penicillin-Streptomycin Solution Beyotime Biotechnology Cat# C0222 Puromycin MedChemExpress Cat# HY-B1743A DMSO Thermo Fisher SCIENTIFIC Cat# D12345 Lipofectamine 3000 Transfection Reagent Thermo Fisher SCIENTIFIC Cat# L3000001 RIPA Lysis Buffer APPLYGEN Cat# C1053-100 Protease inhibitor cocktail Aqlabtech Cat# AQ551 Phosphatase inhibitor APPLYGEN Cat# P1260 PMSF Beyotime Biotechnology Cat# ST505 Skim milk Aqlabtech Cat# AQ62321 SYBR Green Master Mix Thermo Fisher SCIENTIFIC Cat# A25742 Crystal violet Beyotime Biotechnology Cat# C0121 Red Blood Cell Lysis Buffer Beyotime Biotechnology Cat# C3702 G418 Beyotime Biotechnology Cat# ST081 Critical commercial assays Single Cell 30 GEM, Library & Gel Bead Kit V3.1 10x Genomics N/A Chromium Single Cell B Chip Kit 10x Genomics N/A PANO 7-plex IHC kit Panovue Cat# 0004100100 Dual Luciferase Reporter Assay Promega Cat# E1910 SF Cell Line 4D-NucleofectorTM X Kit S Lonza Bioscience Cat# V4XC-2024 Human Monocyte Nucleofector Kit Lonza Bioscience Cat# VPA-1007 Enhanced BCA Protein Assay Kit Beyotime Biotechnology Cat# P0010 Super ECL Reagent Aqlabtech Cat# AQ529 RNA-Quick Purification Kit ESScience Cat# RN001 PrimeScript RT reagent Kit Takara Cat# RR047A Mouse TGF-beta 1 ELISA Kit RayBiotech Cat# P04202 MycoBlue Mycoplasma Detector Kit Vazyme Cat# D101 Cell counting kit 8 Dojindo Cat# CK04-05 Deposited data scRNA-seq and ST data This paper GSE281288 JASPAR database https://jaspar.genereg.net/ TCGA data https://xenabrowser.net/ (Continued on next page) Cell Reports 44, 115226, February 25, 2025 17

    Purification:

    Article Title: NFE2-driven neutrophil polarization promotes pancreatic cancer liver metastasis progression.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat Anti-Rabbit IgG H&L (HRP) Abcam Cat# ab205718; RRID:AB_2819160 Recombinant Anti-S100A12/CGRP antibody Abcam Cat# ab272713; RRID:AB_2920851 Recombinant Anti-S100A8 + S100A9 antibody Abcam Cat# ab288715 PADI4 antibody Proteintech Cat# 17373-1-AP; RRID:AB_2878398 Recombinant Anti-MMP9 antibody Abcam Cat# ab283575; RRID:AB_2928971 TGM2 antibody Proteintech Cat# 15100-1-AP; RRID:AB_2202885 Galectin-3 Polyclonal antibody Proteintech Cat# 14979-1-AP; RRID:AB_2136768 Recombinant Anti-Ly6g antibody Abcam Cat# ab238132; RRID:AB_2923218 MPO antibody Proteintech Cat# 22225-1-AP; RRID:AB_2879037 Recombinant Anti-CD66b antibody Abcam Cat# ab300122; RRID:AB_3097803 Mouse Anti-CD68 Monoclonal Antibody, Unconjugated, Clone KP1 Abcam Cat# ab955; RRID:AB_307338 NFE2 antibody Proteintech Cat# 11089-1-AP; RRID:AB_2152928 Recombinant Anti-Histone H3 (citrulline R2 + R8 + R17) antibody Abcam Cat# ab281584 Recombinant Anti-Macrophage Inflammatory Protein 1 alpha/CCL3 + CCL3L1 antibody Abcam Cat# ab259372; RRID:AB_3094596 ISG15 antibody Proteintech Cat# 15981-1-AP; RRID:AB_2126302 GRO Alpha antibody Proteintech Cat# 12335-1-AP; RRID:AB_2087568 HSPA6 antibody Proteintech Cat# 13616-1-AP; RRID:AB_2120122 RPS19 antibody Proteintech Cat# 15085-1-AP; RRID:AB_2180202 Fixable Viability Stain 780 BD Biosciences Cat# 565388; RRID:AB_2869673 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc BlockTM) Clone 2.4G2 BD Biosciences Cat# 553141; RRID:AB_394656 FITC anti-mouse CD45 Recombinant BioLegend Cat# 157608; RRID:AB_2832554 Brilliant Violet 421(TM) anti-mouse/human CD11b BioLegend Cat# 101235; RRID:AB_10897942 PE anti-mouse Ly-6G BioLegend Cat# 127607; RRID:AB_1186104 Alexa Fluor(R) 700 anti-mouse CD3 BioLegend Cat# 100216; RRID:AB_493697 Brilliant Violet 510(TM) anti-mouse CD8a BioLegend Cat# 100752; RRID:AB_2563057 PerCP/Cyanine5.5 anti-mouse F4/80 BioLegend Cat# 123128; RRID:AB_893484 PE/Cyanine7 anti-mouse CD279 (PD-1) BioLegend Cat# 109110; RRID:AB_572017 HRP-conjugated goat anti-mouse secondary antibody Zsbio ZB-2305 HRP-conjugated goat anti-rabbit secondary antibody Zsbio ZB-2306 Bacterial and virus strains LV-Tgfb1-RNAi Genechem N/A LV-Luciferase Genechem N/A Biological samples Surgical excision samples Peking Union Medical College Hospital N/A Chemicals, peptides, and recombinant proteins SM16 MedChemExpress Cat# HY-111482 Cl-amidine Selleck Cat# S8141 (Continued on next page) 16 Cell Reports 44, 115226, February 25, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER anti-mouse Ly6G BioXcell Cat# BE0075-1 IgG2a isotype control BioXcell Cat# BE0085 SB431542 MedChemExpress Cat# HY-10431 HumanKine recombinant human TGF-b Proteintech Cat# HZ-1011 Collagenase IV Thermo Fisher SCIENTIFIC Cat# 17104019 DNase I Thermo Fisher SCIENTIFIC Cat# 90083 Dispase II Thermo Fisher SCIENTIFIC Cat# 17105041 Heparin sodium MedChemExpress Cat# HY-17567A EGTA Beyotime Biotechnology Ca# ST068 DMEM/F12 Gibco Cat# 11320033 DMEM Gibco Cat# 11965118 IMDM Procell Cat# PM150510 RPMI-1640 Procell Cat# PM150110 PBS Procell Cat# PB180327 FBS Thermo Fisher SCIENTIFIC Cat# A3160901 BSA Beyotime Biotechnology Cat# ST023 DPBS Thermo Fisher SCIENTIFIC Cat# 14190144 Percoll Cytiva Cat# 17089101 Penicillin-Streptomycin Solution Beyotime Biotechnology Cat# C0222 Puromycin MedChemExpress Cat# HY-B1743A DMSO Thermo Fisher SCIENTIFIC Cat# D12345 Lipofectamine 3000 Transfection Reagent Thermo Fisher SCIENTIFIC Cat# L3000001 RIPA Lysis Buffer APPLYGEN Cat# C1053-100 Protease inhibitor cocktail Aqlabtech Cat# AQ551 Phosphatase inhibitor APPLYGEN Cat# P1260 PMSF Beyotime Biotechnology Cat# ST505 Skim milk Aqlabtech Cat# AQ62321 SYBR Green Master Mix Thermo Fisher SCIENTIFIC Cat# A25742 Crystal violet Beyotime Biotechnology Cat# C0121 Red Blood Cell Lysis Buffer Beyotime Biotechnology Cat# C3702 G418 Beyotime Biotechnology Cat# ST081 Critical commercial assays Single Cell 30 GEM, Library & Gel Bead Kit V3.1 10x Genomics N/A Chromium Single Cell B Chip Kit 10x Genomics N/A PANO 7-plex IHC kit Panovue Cat# 0004100100 Dual Luciferase Reporter Assay Promega Cat# E1910 SF Cell Line 4D-NucleofectorTM X Kit S Lonza Bioscience Cat# V4XC-2024 Human Monocyte Nucleofector Kit Lonza Bioscience Cat# VPA-1007 Enhanced BCA Protein Assay Kit Beyotime Biotechnology Cat# P0010 Super ECL Reagent Aqlabtech Cat# AQ529 RNA-Quick Purification Kit ESScience Cat# RN001 PrimeScript RT reagent Kit Takara Cat# RR047A Mouse TGF-beta 1 ELISA Kit RayBiotech Cat# P04202 MycoBlue Mycoplasma Detector Kit Vazyme Cat# D101 Cell counting kit 8 Dojindo Cat# CK04-05 Deposited data scRNA-seq and ST data This paper GSE281288 JASPAR database https://jaspar.genereg.net/ TCGA data https://xenabrowser.net/ (Continued on next page) Cell Reports 44, 115226, February 25, 2025 17

    other:

    Article Title: Hypoxia-induced PRMT1 methylates HIF2β to promote breast tumorigenesis via enhancing glycolytic gene transcription.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER SureBeads G magnetic beads Bio-Rad Cat# 161-4023 Ni-NTA Resin Thermofisher Cat# 88221 DNase I Promega Cat# M6101 Critical commercial assays TRIzol Reagent Invitrogen Cat# 15596018 Dual-Luciferase Reporter Assay System Promega Cat# E1910 CellTiter 96 AQueous One Solution Cell Proliferation Assay kit Promega Cat# G3582 Lactic Acid assay kit Nanjing Jiancheng Bioengineering Institute Cat# A019-2-1 Deposited data RNA-seq This paper GEO: GSE250512 Experimental models: Cell lines Human cell line: HEK293 ATCC CRL-3216; RRID: CVCL_0045 Human cell line: MCF7 ATCC HTB-22; RRID: CVCL_0031 Human cell line: MDA-MB-231 ATCC HTB-26; RRID: CVCL_0062 Experimental models: Organisms/strains Female BALB/C nude mice Beijing Vital River Laboratory Animal Technology N/A Oligonucleotides siPRMT1-1: CCGTCAAGGTGGAAGACCT RiboBio siB151229093135 siPRMT1-2: CGACATGTCTTGCATCAAA RiboBio siB151229093135 siHIF2b-1: GGAACAAGATGACTCAGTA RiboBio stB0009257A siHIF2b-2: GGAGCACACTGTATGAACA RiboBio stB0009257B siHIF1a-1: GGCCTCTGTGATGAGGCTT RiboBio siB11913102435 siHIF1a-2: GGACACAGATTTAGACTTG RiboBio siB160505051827 siHIF1b: GACTCGTACTTCCCAGTTT Sangon Biotech 112912638 shPRMT1-1: GGCAGTACAAAGACTACAAGA This paper N/A shPRMT1-2: GGAAGCAGACGGTGTTCTACA This paper N/A shHIF2b-1: CAAGAGGAATCATAGTGAAA This paper N/A shHIF2b-2: CAGAGTTCTTATCCCGGCATA This paper N/A Primer for RT-PCR, see Table S4 This paper N/A Recombinant DNA Plasmid: pBoBi-FLAG-PRMT1-HA This paper N/A Plasmid: pBoBi-FLAG-PRMT1(E153Q)-HA This paper N/A Plasmid: pCMV-MYC-PRMT1 This paper N/A Plasmid: pCMV-MYC-PRMT1(E153Q) This paper N/A Plasmid: pCDH-FLAG-HIF2b-HA This paper N/A Plasmid: pCDH-FLAG-HIF2b(R42K)-HA This paper N/A Plasmid: pCDH-FLAG-HIF2b (1–118)-HA This paper N/A Plasmid: pCDH-FLAG-HIF2b (119–455)-HA This paper N/A Plasmid: pCDH-FLAG-HIF2b (456–717)-HA This paper N/A Plasmid: pGEX-6P-1-PRMT1 This paper N/A Plasmid: pET-28A-HIF2b (1–118) This paper N/A Plasmid: pCDH-CMV-HA-HIF1a BRICS N/A Plasmid: PGL2-TA-promotor-HIF-luc BRICS N/A (Continued on next page) Cell Reports 44, 115487, April 22, 2025 19

    Marker:

    Article Title: IRE1α regulates macrophage phagocytosis in immune thrombocytopenia through NR1D1 mRNA decay and lysosomal biogenesis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies for Platelet Depletion in Mice Emfret Cat#R300 RRID:AB_2721041 Phosphorylated IRE1α at Ser724 (p-IRE1α) Novus Biologicals Cat#NB100-2323 RRID:AB_3151655 NR1D1 Recombinant Rabbit Monoclonal Antibody HUABIO Cat#ET7106-92 RRID:AB_3070710 ATF4 Recombinant Rabbit Monoclonal Antibody HUABIO Cat#ET1612-37 RRID:AB_3070110 Anti-eIF2 alpha Antibody HUABIO Cat#ET7111-34 RRID:AB_3071091 Anti-XBP1 Antibody Abcam Cat#ab220783 RRID:AB_2920809 Anti-GAPDH Antibody Abcam Cat#ab181602 RRID:AB_2630358 IRE1 alpha (14C10) Rabbit Monoclonal Antibody Cell Signaling Technology Cat#3294T RRID:AB_823545 Phospho-eIF2 alpha (Ser51) Antibody Cell Signaling Technology Cat#9721S RRID:AB_330951 beta-Tubulin Antibody Cell Signaling Technology Cat#2146S RRID:AB_2210545 BiP (C50B12) Rabbit Monoclonal Antibody Cell Signaling Technology Cat#3177T RRID:AB_2119845 HRP Conjugated Goat anti-Rabbit IgG polyclonal Antibody HUABIO Cat#HA1001 RRID:AB_2819166 HRP Conjugated Goat anti-Mouse IgG polyclonal Antibody HUABIO Cat#HA1006 RRID:AB_2819167 Anti-F4/80 antibody [CI:A3-1] - Macrophage Marker Abcam Cat#ab6640 RRID:AB_1140040 Biological samples Peripheral blood mononuclear cells were isolated from heparinized blood provided by patients with ITP and healthy control The First Affiliated Hospital, Zhejiang University School of Medicine https://www.zy91.com/ Chemicals, peptides, and recombinant proteins 4μ8C Selleck Chemicals Cat#S7272; CAS: 14003-96-4 SR8278 MedChemExpress Cat#HY-14415; CAS No. : 1254944-66-5 CellTracker Green 5-Chloromethylfluorescein Diacetate (CMFDA) Invitrogen Cat#C2925 Hoechst 33342 Solarbio Cat#C0031 prostaglandin E1 Sigma Cat#P5515; CAS: 745-65-3 Catrite-dextrose solution(ACD) Sigma Cat#C3821; CAS: 8013-89-6 RPMI 1640 medium Gibco Cat#C11875500BT DMEM (High Glucose) Gibco Cat#C11995500BT Fetal Bovine Serum Gibco Cat#110099141C Molecular Probes TM Dextran Invitrogen Cat#D1818 pHrodo TM Red Zymosan BioParticles Invitrogen Cat#P35364 Eltrombopag MedChemExpress Cat#HY-15306; CAS No. : 496775-61-2 Thapsigargin MedChemExpress Cat#HY-13433; CAS No. : 67526-95-8 Tauroursodeoxycholate MedChemExpress Cat#HY-19696; CAS No. : 14605-22-2 SR9009 MedChemExpress Cat#HY-16989; CAS No. : 1379686-30-2 Phorbol 12-myristate 13-acetate MedChemExpress Cat#HY-18739; CAS No. : 16561-29-8 Recombinant Murine M-CSF PeproTech Cat#Cat # 315-02-50UG Critical commercial assays BCA assay Bestbio Cat#BB-3401 Advanced DNA RNA Transfection Reagent ZETA LIFE Inc. AD600025 (Continued on next page) 18 Cell Reports 45, 117083, March 24, 2026 ..

    Isolation:

    Article Title: IRE1α regulates macrophage phagocytosis in immune thrombocytopenia through NR1D1 mRNA decay and lysosomal biogenesis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies for Platelet Depletion in Mice Emfret Cat#R300 RRID:AB_2721041 Phosphorylated IRE1α at Ser724 (p-IRE1α) Novus Biologicals Cat#NB100-2323 RRID:AB_3151655 NR1D1 Recombinant Rabbit Monoclonal Antibody HUABIO Cat#ET7106-92 RRID:AB_3070710 ATF4 Recombinant Rabbit Monoclonal Antibody HUABIO Cat#ET1612-37 RRID:AB_3070110 Anti-eIF2 alpha Antibody HUABIO Cat#ET7111-34 RRID:AB_3071091 Anti-XBP1 Antibody Abcam Cat#ab220783 RRID:AB_2920809 Anti-GAPDH Antibody Abcam Cat#ab181602 RRID:AB_2630358 IRE1 alpha (14C10) Rabbit Monoclonal Antibody Cell Signaling Technology Cat#3294T RRID:AB_823545 Phospho-eIF2 alpha (Ser51) Antibody Cell Signaling Technology Cat#9721S RRID:AB_330951 beta-Tubulin Antibody Cell Signaling Technology Cat#2146S RRID:AB_2210545 BiP (C50B12) Rabbit Monoclonal Antibody Cell Signaling Technology Cat#3177T RRID:AB_2119845 HRP Conjugated Goat anti-Rabbit IgG polyclonal Antibody HUABIO Cat#HA1001 RRID:AB_2819166 HRP Conjugated Goat anti-Mouse IgG polyclonal Antibody HUABIO Cat#HA1006 RRID:AB_2819167 Anti-F4/80 antibody [CI:A3-1] - Macrophage Marker Abcam Cat#ab6640 RRID:AB_1140040 Biological samples Peripheral blood mononuclear cells were isolated from heparinized blood provided by patients with ITP and healthy control The First Affiliated Hospital, Zhejiang University School of Medicine https://www.zy91.com/ Chemicals, peptides, and recombinant proteins 4μ8C Selleck Chemicals Cat#S7272; CAS: 14003-96-4 SR8278 MedChemExpress Cat#HY-14415; CAS No. : 1254944-66-5 CellTracker Green 5-Chloromethylfluorescein Diacetate (CMFDA) Invitrogen Cat#C2925 Hoechst 33342 Solarbio Cat#C0031 prostaglandin E1 Sigma Cat#P5515; CAS: 745-65-3 Catrite-dextrose solution(ACD) Sigma Cat#C3821; CAS: 8013-89-6 RPMI 1640 medium Gibco Cat#C11875500BT DMEM (High Glucose) Gibco Cat#C11995500BT Fetal Bovine Serum Gibco Cat#110099141C Molecular Probes TM Dextran Invitrogen Cat#D1818 pHrodo TM Red Zymosan BioParticles Invitrogen Cat#P35364 Eltrombopag MedChemExpress Cat#HY-15306; CAS No. : 496775-61-2 Thapsigargin MedChemExpress Cat#HY-13433; CAS No. : 67526-95-8 Tauroursodeoxycholate MedChemExpress Cat#HY-19696; CAS No. : 14605-22-2 SR9009 MedChemExpress Cat#HY-16989; CAS No. : 1379686-30-2 Phorbol 12-myristate 13-acetate MedChemExpress Cat#HY-18739; CAS No. : 16561-29-8 Recombinant Murine M-CSF PeproTech Cat#Cat # 315-02-50UG Critical commercial assays BCA assay Bestbio Cat#BB-3401 Advanced DNA RNA Transfection Reagent ZETA LIFE Inc. AD600025 (Continued on next page) 18 Cell Reports 45, 117083, March 24, 2026 ..

    Control:

    Article Title: IRE1α regulates macrophage phagocytosis in immune thrombocytopenia through NR1D1 mRNA decay and lysosomal biogenesis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies for Platelet Depletion in Mice Emfret Cat#R300 RRID:AB_2721041 Phosphorylated IRE1α at Ser724 (p-IRE1α) Novus Biologicals Cat#NB100-2323 RRID:AB_3151655 NR1D1 Recombinant Rabbit Monoclonal Antibody HUABIO Cat#ET7106-92 RRID:AB_3070710 ATF4 Recombinant Rabbit Monoclonal Antibody HUABIO Cat#ET1612-37 RRID:AB_3070110 Anti-eIF2 alpha Antibody HUABIO Cat#ET7111-34 RRID:AB_3071091 Anti-XBP1 Antibody Abcam Cat#ab220783 RRID:AB_2920809 Anti-GAPDH Antibody Abcam Cat#ab181602 RRID:AB_2630358 IRE1 alpha (14C10) Rabbit Monoclonal Antibody Cell Signaling Technology Cat#3294T RRID:AB_823545 Phospho-eIF2 alpha (Ser51) Antibody Cell Signaling Technology Cat#9721S RRID:AB_330951 beta-Tubulin Antibody Cell Signaling Technology Cat#2146S RRID:AB_2210545 BiP (C50B12) Rabbit Monoclonal Antibody Cell Signaling Technology Cat#3177T RRID:AB_2119845 HRP Conjugated Goat anti-Rabbit IgG polyclonal Antibody HUABIO Cat#HA1001 RRID:AB_2819166 HRP Conjugated Goat anti-Mouse IgG polyclonal Antibody HUABIO Cat#HA1006 RRID:AB_2819167 Anti-F4/80 antibody [CI:A3-1] - Macrophage Marker Abcam Cat#ab6640 RRID:AB_1140040 Biological samples Peripheral blood mononuclear cells were isolated from heparinized blood provided by patients with ITP and healthy control The First Affiliated Hospital, Zhejiang University School of Medicine https://www.zy91.com/ Chemicals, peptides, and recombinant proteins 4μ8C Selleck Chemicals Cat#S7272; CAS: 14003-96-4 SR8278 MedChemExpress Cat#HY-14415; CAS No. : 1254944-66-5 CellTracker Green 5-Chloromethylfluorescein Diacetate (CMFDA) Invitrogen Cat#C2925 Hoechst 33342 Solarbio Cat#C0031 prostaglandin E1 Sigma Cat#P5515; CAS: 745-65-3 Catrite-dextrose solution(ACD) Sigma Cat#C3821; CAS: 8013-89-6 RPMI 1640 medium Gibco Cat#C11875500BT DMEM (High Glucose) Gibco Cat#C11995500BT Fetal Bovine Serum Gibco Cat#110099141C Molecular Probes TM Dextran Invitrogen Cat#D1818 pHrodo TM Red Zymosan BioParticles Invitrogen Cat#P35364 Eltrombopag MedChemExpress Cat#HY-15306; CAS No. : 496775-61-2 Thapsigargin MedChemExpress Cat#HY-13433; CAS No. : 67526-95-8 Tauroursodeoxycholate MedChemExpress Cat#HY-19696; CAS No. : 14605-22-2 SR9009 MedChemExpress Cat#HY-16989; CAS No. : 1379686-30-2 Phorbol 12-myristate 13-acetate MedChemExpress Cat#HY-18739; CAS No. : 16561-29-8 Recombinant Murine M-CSF PeproTech Cat#Cat # 315-02-50UG Critical commercial assays BCA assay Bestbio Cat#BB-3401 Advanced DNA RNA Transfection Reagent ZETA LIFE Inc. AD600025 (Continued on next page) 18 Cell Reports 45, 117083, March 24, 2026 ..

    BIA-KA:

    Article Title: IRE1α regulates macrophage phagocytosis in immune thrombocytopenia through NR1D1 mRNA decay and lysosomal biogenesis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies for Platelet Depletion in Mice Emfret Cat#R300 RRID:AB_2721041 Phosphorylated IRE1α at Ser724 (p-IRE1α) Novus Biologicals Cat#NB100-2323 RRID:AB_3151655 NR1D1 Recombinant Rabbit Monoclonal Antibody HUABIO Cat#ET7106-92 RRID:AB_3070710 ATF4 Recombinant Rabbit Monoclonal Antibody HUABIO Cat#ET1612-37 RRID:AB_3070110 Anti-eIF2 alpha Antibody HUABIO Cat#ET7111-34 RRID:AB_3071091 Anti-XBP1 Antibody Abcam Cat#ab220783 RRID:AB_2920809 Anti-GAPDH Antibody Abcam Cat#ab181602 RRID:AB_2630358 IRE1 alpha (14C10) Rabbit Monoclonal Antibody Cell Signaling Technology Cat#3294T RRID:AB_823545 Phospho-eIF2 alpha (Ser51) Antibody Cell Signaling Technology Cat#9721S RRID:AB_330951 beta-Tubulin Antibody Cell Signaling Technology Cat#2146S RRID:AB_2210545 BiP (C50B12) Rabbit Monoclonal Antibody Cell Signaling Technology Cat#3177T RRID:AB_2119845 HRP Conjugated Goat anti-Rabbit IgG polyclonal Antibody HUABIO Cat#HA1001 RRID:AB_2819166 HRP Conjugated Goat anti-Mouse IgG polyclonal Antibody HUABIO Cat#HA1006 RRID:AB_2819167 Anti-F4/80 antibody [CI:A3-1] - Macrophage Marker Abcam Cat#ab6640 RRID:AB_1140040 Biological samples Peripheral blood mononuclear cells were isolated from heparinized blood provided by patients with ITP and healthy control The First Affiliated Hospital, Zhejiang University School of Medicine https://www.zy91.com/ Chemicals, peptides, and recombinant proteins 4μ8C Selleck Chemicals Cat#S7272; CAS: 14003-96-4 SR8278 MedChemExpress Cat#HY-14415; CAS No. : 1254944-66-5 CellTracker Green 5-Chloromethylfluorescein Diacetate (CMFDA) Invitrogen Cat#C2925 Hoechst 33342 Solarbio Cat#C0031 prostaglandin E1 Sigma Cat#P5515; CAS: 745-65-3 Catrite-dextrose solution(ACD) Sigma Cat#C3821; CAS: 8013-89-6 RPMI 1640 medium Gibco Cat#C11875500BT DMEM (High Glucose) Gibco Cat#C11995500BT Fetal Bovine Serum Gibco Cat#110099141C Molecular Probes TM Dextran Invitrogen Cat#D1818 pHrodo TM Red Zymosan BioParticles Invitrogen Cat#P35364 Eltrombopag MedChemExpress Cat#HY-15306; CAS No. : 496775-61-2 Thapsigargin MedChemExpress Cat#HY-13433; CAS No. : 67526-95-8 Tauroursodeoxycholate MedChemExpress Cat#HY-19696; CAS No. : 14605-22-2 SR9009 MedChemExpress Cat#HY-16989; CAS No. : 1379686-30-2 Phorbol 12-myristate 13-acetate MedChemExpress Cat#HY-18739; CAS No. : 16561-29-8 Recombinant Murine M-CSF PeproTech Cat#Cat # 315-02-50UG Critical commercial assays BCA assay Bestbio Cat#BB-3401 Advanced DNA RNA Transfection Reagent ZETA LIFE Inc. AD600025 (Continued on next page) 18 Cell Reports 45, 117083, March 24, 2026 ..

    Transfection:

    Article Title: IRE1α regulates macrophage phagocytosis in immune thrombocytopenia through NR1D1 mRNA decay and lysosomal biogenesis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies for Platelet Depletion in Mice Emfret Cat#R300 RRID:AB_2721041 Phosphorylated IRE1α at Ser724 (p-IRE1α) Novus Biologicals Cat#NB100-2323 RRID:AB_3151655 NR1D1 Recombinant Rabbit Monoclonal Antibody HUABIO Cat#ET7106-92 RRID:AB_3070710 ATF4 Recombinant Rabbit Monoclonal Antibody HUABIO Cat#ET1612-37 RRID:AB_3070110 Anti-eIF2 alpha Antibody HUABIO Cat#ET7111-34 RRID:AB_3071091 Anti-XBP1 Antibody Abcam Cat#ab220783 RRID:AB_2920809 Anti-GAPDH Antibody Abcam Cat#ab181602 RRID:AB_2630358 IRE1 alpha (14C10) Rabbit Monoclonal Antibody Cell Signaling Technology Cat#3294T RRID:AB_823545 Phospho-eIF2 alpha (Ser51) Antibody Cell Signaling Technology Cat#9721S RRID:AB_330951 beta-Tubulin Antibody Cell Signaling Technology Cat#2146S RRID:AB_2210545 BiP (C50B12) Rabbit Monoclonal Antibody Cell Signaling Technology Cat#3177T RRID:AB_2119845 HRP Conjugated Goat anti-Rabbit IgG polyclonal Antibody HUABIO Cat#HA1001 RRID:AB_2819166 HRP Conjugated Goat anti-Mouse IgG polyclonal Antibody HUABIO Cat#HA1006 RRID:AB_2819167 Anti-F4/80 antibody [CI:A3-1] - Macrophage Marker Abcam Cat#ab6640 RRID:AB_1140040 Biological samples Peripheral blood mononuclear cells were isolated from heparinized blood provided by patients with ITP and healthy control The First Affiliated Hospital, Zhejiang University School of Medicine https://www.zy91.com/ Chemicals, peptides, and recombinant proteins 4μ8C Selleck Chemicals Cat#S7272; CAS: 14003-96-4 SR8278 MedChemExpress Cat#HY-14415; CAS No. : 1254944-66-5 CellTracker Green 5-Chloromethylfluorescein Diacetate (CMFDA) Invitrogen Cat#C2925 Hoechst 33342 Solarbio Cat#C0031 prostaglandin E1 Sigma Cat#P5515; CAS: 745-65-3 Catrite-dextrose solution(ACD) Sigma Cat#C3821; CAS: 8013-89-6 RPMI 1640 medium Gibco Cat#C11875500BT DMEM (High Glucose) Gibco Cat#C11995500BT Fetal Bovine Serum Gibco Cat#110099141C Molecular Probes TM Dextran Invitrogen Cat#D1818 pHrodo TM Red Zymosan BioParticles Invitrogen Cat#P35364 Eltrombopag MedChemExpress Cat#HY-15306; CAS No. : 496775-61-2 Thapsigargin MedChemExpress Cat#HY-13433; CAS No. : 67526-95-8 Tauroursodeoxycholate MedChemExpress Cat#HY-19696; CAS No. : 14605-22-2 SR9009 MedChemExpress Cat#HY-16989; CAS No. : 1379686-30-2 Phorbol 12-myristate 13-acetate MedChemExpress Cat#HY-18739; CAS No. : 16561-29-8 Recombinant Murine M-CSF PeproTech Cat#Cat # 315-02-50UG Critical commercial assays BCA assay Bestbio Cat#BB-3401 Advanced DNA RNA Transfection Reagent ZETA LIFE Inc. AD600025 (Continued on next page) 18 Cell Reports 45, 117083, March 24, 2026 ..

    Red Blood Cell Lysis:

    Article Title: MIF-ACKR3 causes irreversible fat loss by impairing adipogenesis in cancer cachexia.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (clone D13.14.4E; 1:1000 dilution) Cell Signaling Technology Cat# 4370; RRID: AB_2315112 Rabbit monoclonal anti-p44/42 MAPK (Erk1/2) (clone 137F5; 1:1000 dilution) Cell Signaling Technology Cat# 4695; RRID: AB_390779 Rabbit monoclonal anti-phospho-IkBa (Ser32) (clone 14D4; 1:1000 dilution) Cell Signaling Technology Cat# 2859; RRID: AB_561111 Mouse monoclonal anti-IkBa (clone L35A5; 1:1000 dilution) Cell Signaling Technology Cat# 4814; RRID: AB_390781 Rabbit polyclonal anti-GPCR RDC1/CXCR-7 (1:100 dilution) Abcam Cat# ab117836; RRID: AB_10903623 Rabbit monoclonal anti-GRK2 (clone HL1562; 1:1000 dilution) GeneTex Cat# GTX637038 Mouse Monoclonal anti-b-Tubulin (HRP Conjugated; 1:3000 dilution) Beyotime Cat# AF2839 Anti-Mouse CD45 FITC (clone 30-F11; 1:100 dilution) BD Biosciences Cat# 561088 Rabbit monoclonal anti-Collagen VI (clone EPR17072; 1:250) Abcam Cat# ab182744; RRID: AB_2847919 Rabbit monoclonal anti- Fibronectin (clone EPR23110-46; 1:2000) Abcam Cat# ab268020; RRID: AB_2941028 HRP-conjugated goat anti-rabbit/mouse secondary antibody GeneTech Cat# GK500705 Goat Anti-Rabbit IgG (H&L)-HRP Conjugated EASYBIO Cat# BE0101-100 Goat Anti-Mouse IgG (H&L)-HRP Conjugated EASYBIO Cat# BE0102-100 Bacterial and virus strains HBAD-Cre HanBio Cat#HH20230208GX-AP01 Biological samples Human peripheral blood from healthy donors Dazhou Central Hospital See Table S5 for details Human peripheral blood from LUAD patients Dazhou Central Hospital See Table S5 for details Human abdominal subcutaneous adipose tissue samples from LUAD patients Dazhou Central Hospital See Table S5 for details Chemicals, peptides, and recombinant proteins ISO-1 MedChemExpress Cat# HY-16692 Dulbecco’s Modified Eagle Medium (DMEM) Solarbio Cat# 11965 Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F-12) Solarbio Cat# D6570 RPMI-1640 medium Invitrogen Cat# 11875093 Tissue storage solution Miltenyi Biotec Cat# 130-100-008 Fetal bovine serum (FBS) Vistech Cat# SE100-B Goat serum Beyotime Cat# C0256 Penicillin-streptomycin Gibco Cat# 15070063 Collagenase Type II Gibco Cat# 17101015 Red Blood Cell Lysis Buffer Beyotime Cat# C3702-500 mL Insulin (10 mg/mL) Sigma–Aldrich Cat# I9278 (Continued on next page) e1 Cell Metabolism 37, 1–17.e1–e8, April 1, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER 3-isobutyl-1-methylxantine (0.5mM) MedChemExpress Cat# HY-dd12318 Dexamethasone (1 mM) MedChemExpress Cat# HY-14648 Rosiglitazone (2.5 mM) MedChemExpress Cat# HY-17386 Mouse recombinant MIF MedChemExpress Cat# HY-P7388 Gallein (10 mM) MedChemExpress Cat# HY-D0254 PTX (100 ng/mL) List Biological Laboratories Cat# 180 TRIzol Invitrogen Cat# 15596026 Hifair III 1st Strand cDNA Synthesis SuperMix Yeasen Cat# 11141ES60 ChamQ SYBR qPCR Master Mix Vazyme Cat# Q321-02 Lipofectamine RNAiMAX Thermo Fisher Scientific Cat# 13778030 4% paraformaldehyde fix solution Beyotime Cat# P0099-500mL RIPA lysis buffer Solarbio Cat# R0010 Critical commercial assays Glycerol Assay Kit Nanjing Jiancheng Bioengineering Institute Cat# F005-1-1 NEB Next Ultra RNA Library Prep Kit for Illumina NEB Cat# E7530S Chromium Next GEM Single Cell 30 GEM, Library & Gel Bead Kit 10x Genomics Cat# PN-1000121 Chromium Next GEM Chip G Single Cell Kit 10x Genomics Cat# PN-1000120 Oil Red O Staining Kit Beyotime Cat# C0158M Masson’s Trichrome Staining Kit Solarbio Cat# G1340 DAB Horseradish Peroxidase Color Development Kit Beyotime Cat# P0203 Mouse MIF SimpleStep ELISA Kit Abcam Cat# ab209885 Human MIF ELISA Kit Multi Sciences Cat# EK1158 Mouse Tumor Necrosis Factor a (TNF-a) ELISA Kit Cusabio Cat# CSB-E04741m Mouse Interleukin 1b (IL-1b) ELISA Kit Cusabio Cat# CSB-E08054m Mouse Interleukin 6 (IL-6) ELISA KIT Cusabio Cat# CSB-E04639m BCA protein assay kit Thermo Fisher Scientific Cat# 23227 NF-kB activation-nuclear translocation assay kit Beyotime Cat# SN371 Deposited data Source data This paper Data S1 Source Data Data files for sequencing data for cachexia mouse model (raw data) This paper GSA: CRA009162 Data files for sequencing data for human adipose tissue (raw data) This paper GSA: HRA003574 scRNA-seq dataset of human and mice white adipose tissue Emont et al.8 SCP: SCP1376 scRNA-seq dataset of mice white adipose tissue Burl et al.9 SRA: SRP145475 scRNA-seq dataset of mice white adipose tissue Hepler et al.10 GEO: GSE111588 scRNA-seq dataset of mice white adipose tissue Merrick et al.11 GEO: dGSE128889 snRNA-seq dataset of mice white adipose tissue Sárvári et al.12 SCP: SCP1179 scRNA-seq dataset of mice white adipose tissue Schwalie et al.13 ArrayExpress: E-MTAB-5785, E-MTAB-5818, E-MTAB-5802, E-MTAB-5787 and E-MTAB-6677 (Continued on next page) Cell Metabolism 37, 1–17.e1–e8, April 1, 2025 e2



    Similar Products

    glun1  (Alomone Labs)
    94
    Alomone Labs glun1
    Glun1, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peptides/NMDAR1%2FGluN1+(extracellular)+Blocking+Peptide/pmc13670132-89-8-39
    Average 94 stars, based on 1 article reviews
    glun1 - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    e0022hu human glp  (Shanghai Korain Biotech Co Ltd)
    94
    Shanghai Korain Biotech Co Ltd e0022hu human glp
    E0022hu Human Glp, supplied by Shanghai Korain Biotech Co Ltd, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peptides/Human+Glucagon-like+Peptide+1/10__1097_slash_md__0000000000050917-53-23--1
    Average 94 stars, based on 1 article reviews
    e0022hu human glp - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    i-factor peptide enhanced bone graft  (Cerapedics)
    90
    Cerapedics i-factor peptide enhanced bone graft
    I Factor Peptide Enhanced Bone Graft, supplied by Cerapedics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peptides/i+factor+peptide+enhanced+bone+graft/nct05038527-110-10-18
    Average 90 stars, based on 1 article reviews
    i-factor peptide enhanced bone graft - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    c peptide elisa  (ALPCO)
    94
    ALPCO c peptide elisa
    C Peptide Elisa, supplied by ALPCO, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peptides/C-Peptide+ELISA/pm42860432-40-12-14
    Average 94 stars, based on 1 article reviews
    c peptide elisa - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    crgdyk peptide  (MedChemExpress)
    97
    MedChemExpress crgdyk peptide
    The construction and characterization of OE‐ACAD11@R‐PLT. (A) Schematic representation of the construction of OE‐ACAD11@R‐PLT. (B) The size distribution of PLT, OE‐ACAD11, <t>cRGDyk,</t> and OE‐ACAD11@R‐PLT. (C) The zeta potential of PLT, cRGDyk, OE‐ACAD11, and OE‐ACAD11@R‐PLT. (D) SEM images of raw PLT and OE‐ACAD11@R‐PLT. (E) The marker protein (CD62P, CD61, CD41, and GAPDH) in raw PLT and OE‐ACAD11@R‐PLT. (F) CLSM results of OE‐ACAD11@R‐PLT. Green, FITC‐labeled PLTs. <t>Red,</t> <t>Cy5‐labeled</t> cRGDyk. (G) Drug loading efficiency and encapsulation rate of OE‐ACAD11@R‐PLT.
    Crgdyk Peptide, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peptides/CY5/pmc13650033-67-2-8
    Average 97 stars, based on 1 article reviews
    crgdyk peptide - by Bioz Stars, 2026-10
    97/100 stars
    		  Buy from Supplier
    inhibitory peptide 10panx  (Tocris)
    93
    Tocris inhibitory peptide 10panx
    The construction and characterization of OE‐ACAD11@R‐PLT. (A) Schematic representation of the construction of OE‐ACAD11@R‐PLT. (B) The size distribution of PLT, OE‐ACAD11, <t>cRGDyk,</t> and OE‐ACAD11@R‐PLT. (C) The zeta potential of PLT, cRGDyk, OE‐ACAD11, and OE‐ACAD11@R‐PLT. (D) SEM images of raw PLT and OE‐ACAD11@R‐PLT. (E) The marker protein (CD62P, CD61, CD41, and GAPDH) in raw PLT and OE‐ACAD11@R‐PLT. (F) CLSM results of OE‐ACAD11@R‐PLT. Green, FITC‐labeled PLTs. <t>Red,</t> <t>Cy5‐labeled</t> cRGDyk. (G) Drug loading efficiency and encapsulation rate of OE‐ACAD11@R‐PLT.
    Inhibitory Peptide 10panx, supplied by Tocris, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peptides/10Panx/pm42835090-129-20-23
    Average 93 stars, based on 1 article reviews
    inhibitory peptide 10panx - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    peptide  (Miltenyi Biotec)
    95
    Miltenyi Biotec peptide
    The construction and characterization of OE‐ACAD11@R‐PLT. (A) Schematic representation of the construction of OE‐ACAD11@R‐PLT. (B) The size distribution of PLT, OE‐ACAD11, <t>cRGDyk,</t> and OE‐ACAD11@R‐PLT. (C) The zeta potential of PLT, cRGDyk, OE‐ACAD11, and OE‐ACAD11@R‐PLT. (D) SEM images of raw PLT and OE‐ACAD11@R‐PLT. (E) The marker protein (CD62P, CD61, CD41, and GAPDH) in raw PLT and OE‐ACAD11@R‐PLT. (F) CLSM results of OE‐ACAD11@R‐PLT. Green, FITC‐labeled PLTs. <t>Red,</t> <t>Cy5‐labeled</t> cRGDyk. (G) Drug loading efficiency and encapsulation rate of OE‐ACAD11@R‐PLT.
    Peptide, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peptides/PepTivator+CMV+pp65%2C+premium+grade/pmc13664011-102-86-90
    Average 95 stars, based on 1 article reviews
    peptide - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    b type natriuretic peptide  (Elabscience Biotechnology)
    93
    Elabscience Biotechnology b type natriuretic peptide
    The construction and characterization of OE‐ACAD11@R‐PLT. (A) Schematic representation of the construction of OE‐ACAD11@R‐PLT. (B) The size distribution of PLT, OE‐ACAD11, <t>cRGDyk,</t> and OE‐ACAD11@R‐PLT. (C) The zeta potential of PLT, cRGDyk, OE‐ACAD11, and OE‐ACAD11@R‐PLT. (D) SEM images of raw PLT and OE‐ACAD11@R‐PLT. (E) The marker protein (CD62P, CD61, CD41, and GAPDH) in raw PLT and OE‐ACAD11@R‐PLT. (F) CLSM results of OE‐ACAD11@R‐PLT. Green, FITC‐labeled PLTs. <t>Red,</t> <t>Cy5‐labeled</t> cRGDyk. (G) Drug loading efficiency and encapsulation rate of OE‐ACAD11@R‐PLT.
    B Type Natriuretic Peptide, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peptides/Rat+BNP+(Brain+Natriuretic+Peptide)+ELISA+Kit/10__3390_slash_jcdd13100494-83-12-16
    Average 93 stars, based on 1 article reviews
    b type natriuretic peptide - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    procollagen type i c peptide pip eia kit  (TaKaRa)
    96
    TaKaRa procollagen type i c peptide pip eia kit
    The construction and characterization of OE‐ACAD11@R‐PLT. (A) Schematic representation of the construction of OE‐ACAD11@R‐PLT. (B) The size distribution of PLT, OE‐ACAD11, <t>cRGDyk,</t> and OE‐ACAD11@R‐PLT. (C) The zeta potential of PLT, cRGDyk, OE‐ACAD11, and OE‐ACAD11@R‐PLT. (D) SEM images of raw PLT and OE‐ACAD11@R‐PLT. (E) The marker protein (CD62P, CD61, CD41, and GAPDH) in raw PLT and OE‐ACAD11@R‐PLT. (F) CLSM results of OE‐ACAD11@R‐PLT. Green, FITC‐labeled PLTs. <t>Red,</t> <t>Cy5‐labeled</t> cRGDyk. (G) Drug loading efficiency and encapsulation rate of OE‐ACAD11@R‐PLT.
    Procollagen Type I C Peptide Pip Eia Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/peptides/Procollagen+Type+I+C-Peptide+(PIP)+EIA+Kit/10__1038_slash_s41598___026___72377___2-88-19-29
    Average 96 stars, based on 1 article reviews
    procollagen type i c peptide pip eia kit - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    The construction and characterization of OE‐ACAD11@R‐PLT. (A) Schematic representation of the construction of OE‐ACAD11@R‐PLT. (B) The size distribution of PLT, OE‐ACAD11, cRGDyk, and OE‐ACAD11@R‐PLT. (C) The zeta potential of PLT, cRGDyk, OE‐ACAD11, and OE‐ACAD11@R‐PLT. (D) SEM images of raw PLT and OE‐ACAD11@R‐PLT. (E) The marker protein (CD62P, CD61, CD41, and GAPDH) in raw PLT and OE‐ACAD11@R‐PLT. (F) CLSM results of OE‐ACAD11@R‐PLT. Green, FITC‐labeled PLTs. Red, Cy5‐labeled cRGDyk. (G) Drug loading efficiency and encapsulation rate of OE‐ACAD11@R‐PLT.

    Journal: Advanced Science

    Article Title: A Biomimetic cRGDyk‐Engineered Platelet Nanoplatform for ACAD11 Delivery to Trigger Pyroptosis in Hepatocellular Carcinoma

    doi: 10.1002/advs.78219

    Figure Lengend Snippet: The construction and characterization of OE‐ACAD11@R‐PLT. (A) Schematic representation of the construction of OE‐ACAD11@R‐PLT. (B) The size distribution of PLT, OE‐ACAD11, cRGDyk, and OE‐ACAD11@R‐PLT. (C) The zeta potential of PLT, cRGDyk, OE‐ACAD11, and OE‐ACAD11@R‐PLT. (D) SEM images of raw PLT and OE‐ACAD11@R‐PLT. (E) The marker protein (CD62P, CD61, CD41, and GAPDH) in raw PLT and OE‐ACAD11@R‐PLT. (F) CLSM results of OE‐ACAD11@R‐PLT. Green, FITC‐labeled PLTs. Red, Cy5‐labeled cRGDyk. (G) Drug loading efficiency and encapsulation rate of OE‐ACAD11@R‐PLT.

    Article Snippet: First, the cRGDyk peptide was labeled with CY5 (MCE, USA) via amino‐carboxyl coupling.

    Techniques: Zeta Potential Analyzer, Marker, Labeling, Encapsulation