Review

pdha1 (Proteintech)

Proteintech is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Proteintech pdha1

A Venn diagram of copper-induced cell death-related gene sets from Enz-resistant prostate cancer datasets ( GSE150809 , GSE163240 , GSE169305 ). B <t>PDHA1</t> expression levels in Enz-resistant prostate cancer datasets ( GSE150809 , GSE163240 , GSE169305 ). C Representative IHC images of PDHA1 in Enz-resistant and Enz-sensitive PCa tissues (scale bar: 100 μm). D Kaplan-Meier survival curves showing overall survival (OS) and recurrence-free survival (RFS) of prostate cancer patients with high versus low PDHA1 expression in the TCGA cohort. E Images showing PDHA1 expression levels in a prostate cancer tissue microarray (TMA). F H-score of PDHA1 expression in cancerous versus adjacent normal tissues from the prostate cancer TMA. G Kaplan-Meier survival curves showing overall survival (OS) and disease-free survival (DFS) in prostate cancer patients with high versus low PDHA1 expression in the TMA cohort. H H-score of PDHA1 expression in prostate cancer tissues with different Gleason scores from the TMA. I , J PDHA1 mRNA ( I ) and protein ( J ) levels in normal prostate cells and PCa cell lines. K–N Changes in PDHA1 mRNA ( K , L ) and protein ( M , N ) levels in PCa cells after treatment with varying concentrations of Enz. Statistical significance was determined by two-tailed unpaired t-test ( B , C , F ) and one-way ANOVA followed by Tukey’s multiple comparison test ( H–L , N ). B , C , F , H – L , N Data are presented as mean ± SD. Representative data of triplicate experiments are shown. (* P < 0.05, ** P < 0.01, *** P < 0.001).

Pdha1, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 230 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdha1/DLAT+Antibody/pmc12966467-251-31-32
Average 96 stars, based on 230 article reviews

pdha1 - by Bioz Stars, 2026-09

96/100 stars

Images

1) Product Images from "PDHA1–acetylation signaling suppresses cuproptosis to attenuate anti-androgen effect in prostate cancer"

Article Title: PDHA1–acetylation signaling suppresses cuproptosis to attenuate anti-androgen effect in prostate cancer

Journal: Cell Death & Disease

doi: 10.1038/s41419-026-08462-1

A Venn diagram of copper-induced cell death-related gene sets from Enz-resistant prostate cancer datasets ( GSE150809 , GSE163240 , GSE169305 ). B PDHA1 expression levels in Enz-resistant prostate cancer datasets ( GSE150809 , GSE163240 , GSE169305 ). C Representative IHC images of PDHA1 in Enz-resistant and Enz-sensitive PCa tissues (scale bar: 100 μm). D Kaplan-Meier survival curves showing overall survival (OS) and recurrence-free survival (RFS) of prostate cancer patients with high versus low PDHA1 expression in the TCGA cohort. E Images showing PDHA1 expression levels in a prostate cancer tissue microarray (TMA). F H-score of PDHA1 expression in cancerous versus adjacent normal tissues from the prostate cancer TMA. G Kaplan-Meier survival curves showing overall survival (OS) and disease-free survival (DFS) in prostate cancer patients with high versus low PDHA1 expression in the TMA cohort. H H-score of PDHA1 expression in prostate cancer tissues with different Gleason scores from the TMA. I , J PDHA1 mRNA ( I ) and protein ( J ) levels in normal prostate cells and PCa cell lines. K–N Changes in PDHA1 mRNA ( K , L ) and protein ( M , N ) levels in PCa cells after treatment with varying concentrations of Enz. Statistical significance was determined by two-tailed unpaired t-test ( B , C , F ) and one-way ANOVA followed by Tukey’s multiple comparison test ( H–L , N ). B , C , F , H – L , N Data are presented as mean ± SD. Representative data of triplicate experiments are shown. (* P < 0.05, ** P < 0.01, *** P < 0.001).

Figure Legend Snippet: A Venn diagram of copper-induced cell death-related gene sets from Enz-resistant prostate cancer datasets ( GSE150809 , GSE163240 , GSE169305 ). B PDHA1 expression levels in Enz-resistant prostate cancer datasets ( GSE150809 , GSE163240 , GSE169305 ). C Representative IHC images of PDHA1 in Enz-resistant and Enz-sensitive PCa tissues (scale bar: 100 μm). D Kaplan-Meier survival curves showing overall survival (OS) and recurrence-free survival (RFS) of prostate cancer patients with high versus low PDHA1 expression in the TCGA cohort. E Images showing PDHA1 expression levels in a prostate cancer tissue microarray (TMA). F H-score of PDHA1 expression in cancerous versus adjacent normal tissues from the prostate cancer TMA. G Kaplan-Meier survival curves showing overall survival (OS) and disease-free survival (DFS) in prostate cancer patients with high versus low PDHA1 expression in the TMA cohort. H H-score of PDHA1 expression in prostate cancer tissues with different Gleason scores from the TMA. I , J PDHA1 mRNA ( I ) and protein ( J ) levels in normal prostate cells and PCa cell lines. K–N Changes in PDHA1 mRNA ( K , L ) and protein ( M , N ) levels in PCa cells after treatment with varying concentrations of Enz. Statistical significance was determined by two-tailed unpaired t-test ( B , C , F ) and one-way ANOVA followed by Tukey’s multiple comparison test ( H–L , N ). B , C , F , H – L , N Data are presented as mean ± SD. Representative data of triplicate experiments are shown. (* P < 0.05, ** P < 0.01, *** P < 0.001).

Techniques Used: Expressing, Microarray, Two Tailed Test, Comparison

A , B CCK8 assay was used to assess cell viability in control and PDHA1 knockdown PCa cells ( A ), as well as wild-type (WT) and PDHA1 overexpression PCa cells ( B ) after treatment with Enz at the specified concentrations. C , D CCK8 assay was used to assess cell viability in control and PDHA1 knockdown PCa cells ( C ), as well as WT and PDHA1 overexpression PCa cells ( D ) after treatment with ES at the specified concentrations. E CCK8 assay was used to assess cell viability in control and PDHA1 knockdown PCa cells after treatment with TTM (5 μM) and Enz (20 μM), either alone or in combination. F CCK8 assay was used to assess cell viability in control and PDHA1 knockdown PCa cells after treatment with TTM (5 μM) and ES (2 nM), either alone or in combination. G The intracellular copper (II) ion concentration was measured after PCa cells were treated with TTM (5 μM) and Enz (20 μM), either alone or in combination. H The intracellular copper (II) ion concentration was measured after PCa cells were treated with TTM (5 μM) and ES (2 nM), either alone or in combination. I , J Protein levels of HSP70, LIAS, and FDX1 were evaluated in WT and PDHA1 overexpression PCa cells after treatment with Enz (20 μM) ( I ) or ES (2 nM) ( J ). Tubulin was used as a loading control. Statistical significance was determined by two-tailed unpaired t-test ( A–D ) and one-way ANOVA followed by Tukey’s multiple comparison test ( E–H ). A–D , E–H Data are presented as mean ± SD. Representative data of triplicate experiments are shown. (* P < 0.05, ** P < 0.01, *** P < 0.001).

Figure Legend Snippet: A , B CCK8 assay was used to assess cell viability in control and PDHA1 knockdown PCa cells ( A ), as well as wild-type (WT) and PDHA1 overexpression PCa cells ( B ) after treatment with Enz at the specified concentrations. C , D CCK8 assay was used to assess cell viability in control and PDHA1 knockdown PCa cells ( C ), as well as WT and PDHA1 overexpression PCa cells ( D ) after treatment with ES at the specified concentrations. E CCK8 assay was used to assess cell viability in control and PDHA1 knockdown PCa cells after treatment with TTM (5 μM) and Enz (20 μM), either alone or in combination. F CCK8 assay was used to assess cell viability in control and PDHA1 knockdown PCa cells after treatment with TTM (5 μM) and ES (2 nM), either alone or in combination. G The intracellular copper (II) ion concentration was measured after PCa cells were treated with TTM (5 μM) and Enz (20 μM), either alone or in combination. H The intracellular copper (II) ion concentration was measured after PCa cells were treated with TTM (5 μM) and ES (2 nM), either alone or in combination. I , J Protein levels of HSP70, LIAS, and FDX1 were evaluated in WT and PDHA1 overexpression PCa cells after treatment with Enz (20 μM) ( I ) or ES (2 nM) ( J ). Tubulin was used as a loading control. Statistical significance was determined by two-tailed unpaired t-test ( A–D ) and one-way ANOVA followed by Tukey’s multiple comparison test ( E–H ). A–D , E–H Data are presented as mean ± SD. Representative data of triplicate experiments are shown. (* P < 0.05, ** P < 0.01, *** P < 0.001).

Techniques Used: CCK-8 Assay, Control, Knockdown, Over Expression, Concentration Assay, Two Tailed Test, Comparison

A Schematic illustration of the 22Rv1 xenograft model with control and PDHA1 knockdown groups treated with Enz (20 mg/kg, intraperitoneally, every 3 days), created using Biorender. B PDHA1 knockdown in nude mice sensitized PCa cells to Enz, as shown by the representative tumor images. C Tumor growth curves were recorded every three days (mean ± SD, n = 5 per group). D Tumor tissues were weighed, and data were summarized. E Representative H&E and IHC staining of indicated proteins in tumor tissues from each group. Scale bar, 100 μm. H-score for PDHA1 ( F ), Ki67 ( G ), and LIAS ( H ) in the specified groups. Statistical significance was determined by one-way ANOVA followed by Tukey’s multiple comparison test ( D , F–H ). D , F–H Data are presented as mean ± SD. Representative data of five replicate experiments are shown. (* P < 0.05, ** P < 0.01, *** P < 0.001).

Figure Legend Snippet: A Schematic illustration of the 22Rv1 xenograft model with control and PDHA1 knockdown groups treated with Enz (20 mg/kg, intraperitoneally, every 3 days), created using Biorender. B PDHA1 knockdown in nude mice sensitized PCa cells to Enz, as shown by the representative tumor images. C Tumor growth curves were recorded every three days (mean ± SD, n = 5 per group). D Tumor tissues were weighed, and data were summarized. E Representative H&E and IHC staining of indicated proteins in tumor tissues from each group. Scale bar, 100 μm. H-score for PDHA1 ( F ), Ki67 ( G ), and LIAS ( H ) in the specified groups. Statistical significance was determined by one-way ANOVA followed by Tukey’s multiple comparison test ( D , F–H ). D , F–H Data are presented as mean ± SD. Representative data of five replicate experiments are shown. (* P < 0.05, ** P < 0.01, *** P < 0.001).

Techniques Used: Control, Knockdown, Immunohistochemistry, Comparison

A Heatmap showing Z-score normalized analysis of metabolites, highlighting shared changes in glutamine and cysteine metabolism intermediates. B Cysteine levels in control and PDHA1 knockdown cells were measured using a cysteine detection kit. C , D Intracellular GSH levels in control and PDHA1 knockdown cells were analyzed using flow cytometry. E Intracellular copper (II) ion levels in control and PDHA1 knockdown cells were measured with or without the presence of GSH (10 μM). F Changes in HSP70, LIAS, and FDX1 protein levels in control and PDHA1 knockdown cells were evaluated with or without GSH (10 μM). Tubulin was used as a loading control. G qRT-PCR analysis of mRNA expression of cysteine transporters (SLC1A1, SLC1A5, SLC7A5, SLC7A11) in control and PDHA1 knockdown cells. H Western blot analysis of SLC7A11 protein expression in control and PDHA1 knockdown cells. I Changes in HSP70, LIAS, and FDX1 protein levels in wild-type (WT) and SLC7A11-overexpressing cells, with or without Enz (20 μM). Tubulin was used as a loading control. J Cell viability after 48 h treatment with Enz (40 μM) with or without GSH (10 μM). Statistical significance was determined by one-way ANOVA followed by Tukey’s multiple comparison test ( B–E , G , J ). B–E , G , J Data are presented as mean ± SD. Representative data of triplicate experiments are shown. (* P < 0.05, ** P < 0.01, *** P < 0.001).

Figure Legend Snippet: A Heatmap showing Z-score normalized analysis of metabolites, highlighting shared changes in glutamine and cysteine metabolism intermediates. B Cysteine levels in control and PDHA1 knockdown cells were measured using a cysteine detection kit. C , D Intracellular GSH levels in control and PDHA1 knockdown cells were analyzed using flow cytometry. E Intracellular copper (II) ion levels in control and PDHA1 knockdown cells were measured with or without the presence of GSH (10 μM). F Changes in HSP70, LIAS, and FDX1 protein levels in control and PDHA1 knockdown cells were evaluated with or without GSH (10 μM). Tubulin was used as a loading control. G qRT-PCR analysis of mRNA expression of cysteine transporters (SLC1A1, SLC1A5, SLC7A5, SLC7A11) in control and PDHA1 knockdown cells. H Western blot analysis of SLC7A11 protein expression in control and PDHA1 knockdown cells. I Changes in HSP70, LIAS, and FDX1 protein levels in wild-type (WT) and SLC7A11-overexpressing cells, with or without Enz (20 μM). Tubulin was used as a loading control. J Cell viability after 48 h treatment with Enz (40 μM) with or without GSH (10 μM). Statistical significance was determined by one-way ANOVA followed by Tukey’s multiple comparison test ( B–E , G , J ). B–E , G , J Data are presented as mean ± SD. Representative data of triplicate experiments are shown. (* P < 0.05, ** P < 0.01, *** P < 0.001).

Techniques Used: Control, Knockdown, Flow Cytometry, Quantitative RT-PCR, Expressing, Western Blot, Comparison

A Measurement of acetyl-CoA levels in control and PDHA1 knockdown cells using an acetyl-CoA detection kit. B Measurement of acetyl-CoA levels in wild-type and PDHA1-overexpressing cells using the same detection kit. C Analysis of global acetylation levels in wild-type and PDHA1-overexpressing cells using a pan-acetylation antibody. D Western blot analysis of target protein levels in wild-type and PDHA1-overexpressing cells after treatment with or without JQAD1 (1 μM) for 24 h. E ChIP-seq analysis using H3K27ac antibody to assess acetylation at transcription start sites in wild-type and PDHA1-overexpressing cells. The plot shows normalized ChIP H3K27ac signal enrichment. F Analysis of enhancers and super-enhancers in wild-type and PDHA1-overexpressing cells using the modified ROSE algorithm. G UCSC Genome Browser screenshot showing H3K27ac ChIP-seq peaks at the SLC7A11 locus in wild-type and PDHA1-overexpressing cells. H ChIP-qPCR analysis of wild-type and PDHA1-overexpressing cells using IgG and H3K27ac antibodies. Statistical significance was determined by two-tailed unpaired t-test ( B ) and one-way ANOVA followed by Tukey’s multiple comparison test ( A , H ). B , A , H Data are presented as mean ± SD. Representative data of triplicate experiments are shown. (* P < 0.05, ** P < 0.01, *** P < 0.001).

Figure Legend Snippet: A Measurement of acetyl-CoA levels in control and PDHA1 knockdown cells using an acetyl-CoA detection kit. B Measurement of acetyl-CoA levels in wild-type and PDHA1-overexpressing cells using the same detection kit. C Analysis of global acetylation levels in wild-type and PDHA1-overexpressing cells using a pan-acetylation antibody. D Western blot analysis of target protein levels in wild-type and PDHA1-overexpressing cells after treatment with or without JQAD1 (1 μM) for 24 h. E ChIP-seq analysis using H3K27ac antibody to assess acetylation at transcription start sites in wild-type and PDHA1-overexpressing cells. The plot shows normalized ChIP H3K27ac signal enrichment. F Analysis of enhancers and super-enhancers in wild-type and PDHA1-overexpressing cells using the modified ROSE algorithm. G UCSC Genome Browser screenshot showing H3K27ac ChIP-seq peaks at the SLC7A11 locus in wild-type and PDHA1-overexpressing cells. H ChIP-qPCR analysis of wild-type and PDHA1-overexpressing cells using IgG and H3K27ac antibodies. Statistical significance was determined by two-tailed unpaired t-test ( B ) and one-way ANOVA followed by Tukey’s multiple comparison test ( A , H ). B , A , H Data are presented as mean ± SD. Representative data of triplicate experiments are shown. (* P < 0.05, ** P < 0.01, *** P < 0.001).

Techniques Used: Control, Knockdown, Western Blot, ChIP-sequencing, Modification, ChIP-qPCR, Two Tailed Test, Comparison

Western Blot:

Article Title: Mitochondrial NADPH fuels mitochondrial fatty acid synthesis and lipoylation to power oxidative metabolism
Article Snippet: The cells or tumours were lysed in ice-cold 1% Triton lysis buffer (40 mM HEPES buffer pH 7.4, 120 mM NaCl, 1 mM EDTA, 1% Triton X-100, 10 mM sodium pyrophosphate, 10 mM glycerol 2-phosphate and 50 mM NaF) with protease inhibitor cocktail (Sigma, P8340) and 1 μM Microcystin-LR (Enzo life sciences, ALX-350-012-C500) as previously described 49 , 50 . .. A total of 15 μg of proteins were subjected to SDS–PAGE and immunoblotting using the following antibodies: lipoic acid (Millipore Sigma, 437695, 1:3,000), DLAT (Proteintech, 13426-1-AP, 1:5,000), NADK2 (Abcam, AB181028 , 1:1,000), Vinculin (CST, 13901S, 1:2,000), PDHA1 (Proteintech, 18068-1-AP, 1:10,000), DLD (Proteintech, 16431-1-AP, 1:10,000), β-actin (CST, 4970S, 1:5,000), HA (CST, 3724S, 1:10,000), p-PDH (Ser293) (CST, 37115S, 1:3,000), ACP (CST, 71814S, 1:1,000), NADK (CST, 55948S, 1:1,000), NNT (Proteintech, 13442-2-AP, 1:3,000), IDH2 (Proteintech, 15932-1-AP, 1:3,000), GLUD1 (Proteintech, 14299-1-AP, 1:5,000), MECR (Proteintech, 51027-2-AP, 1:3,000), HSP60 (CST, 12165S, 1:5,000) and HRP-conjugated anti-rabbit secondary antibody (CST, 7074, 1:5,000). ..

other:

Article Title: The function and mechanism of clinical trial agent CPI-613 in multiple myeloma.
Article Snippet: Multiple myeloma (MM) is an incurable malignant hematological neoplasm characterized by clonal proliferation of plasma cells accumulating in the bone marrow.. Currently, the treatment of MM is usually based on a multidrug combination strategy, and the remission rates of MM patients have been greatly improved.. However, MM is still not immune to drug resistance and recurrence and is an incurable tumor.

Article Title: PDHA1–acetylation signaling suppresses cuproptosis to attenuate anti-androgen effect in prostate cancer
Article Snippet: The following antibodies were used: Lipoic Acid (Abcam, catalog no. ab58724), HSP70 (Proteintech, catalog no. 10995-1-AP), LIAS (Proteintech, catalog no. 11577-1-AP), FDX1 (Proteintech, catalog no. 12592-1-AP), DLAT (Proteintech, catalog no. 13426-1-AP), PDHA1 (Proteintech, catalog no. 18068-1-AP), p-PDHA1 (Proteintech, catalog no. 29582-1-AP), α-Tubulin (Proteintech, catalog no. 11224-1-AP), H3 (Proteintech, catalog no. 17168-1-AP), and H3K27ac (Abclonal, catalog no. A7253).

Article Title: PDHA1-acetylation signaling suppresses cuproptosis to attenuate anti-androgen effect in prostate cancer.
Article Snippet: The following antibodies were used: Lipoic Acid (Abcam, catalog no. ab58724), HSP70 (Proteintech, catalog no. 10995-1-AP), LIAS (Proteintech, catalog no. 11577-1-AP), FDX1 (Proteintech, catalog no. 12592-1-AP), DLAT (Proteintech, catalog no. 13426-1-AP), PDHA1 (Proteintech, catalog no. 18068-1-AP), p-PDHA1 (Proteintech, catalog no. 29582-1-AP), αTubulin (Proteintech, catalog no. 11224-1-AP), H3 (Proteintech, catalog no. 17168-1-AP), and H3K27ac (Abclonal, catalog no. A7253).

Incubation:

Article Title: Nitric oxide-primed engineered extracellular vesicles restore bioenergetics in acute kidney injury via mitochondrial transfer
Article Snippet: .. Next, the sections were incubated with 5% BSA containing 0.1% Triton X-100 at room temperature for 15 min and then incubated with primary antibodies against KIM1 (1:200; AF1817, R&D), Active-Caspase3 (1:200; WL02117, Wanleibio), mtTFA (1:100, ab30702, Abcam), COX IV (1:100; 66110-1-Ig, Proteintech), TSG101 (1:1000, ab125011, Abcam), NDUFA13 (1:1000; ab110240, Abcam), PDHA1 (1:1000; 10986-1-AP, Proteintech), LC3 (1:100; ab192890, Abcam), and P62 (1:100; ab109012, Abcam) overnight at 4°C. .. The following secondary antibodies were used: Cy3-or fluorescein isothiocyanate (FITC)-labeled donkey anti-rabbit, anti-mouse, or anti-goat antibodies (1:400; Invitrogen).

Article Title: Nitric oxide-primed engineered extracellular vesicles restore bioenergetics in acute kidney injury via mitochondrial transfer
Article Snippet: After denaturation, the proteins were transferred onto nitrocellulose membranes (Roche, Switzerland). .. The membranes were then blocked with 5% bovine serum albumin in Tris-buffered saline with 0.1% Tween® 20 detergent at room temperature, followed by incubation with antibodies against Alix (1:1000, WL03063, Wanleibio), CD9 (1:1000, ab92726, Abcam), TSG101 (1:1000, ab125011, Abcam), GM130 (1:1000, ab52649, Abcam), KIM1 (1:1000; ab302932, Abcam), NGAL (1:1000; PA5-79590, ThermoFisher), BAX (1:1000; ab110333, Abcam), BAX (1:1000; ab7977, Abcam), BCL-2 (1:1000; ab182858, Abcam), Active-caspase3 (1:1000; AC033, Bryotime biotechnology), NRF1 (1:1000; 46743S, Cell signaling technology), TFAM (1:1000; 23996-1-AP, Proteintech), ATPB (1:1000; 17247-1-AP, Proteintech), NDUFA13 (1:1000; ab110240, Abcam), PDHA1 (1:1000; 10986-1-AP, Proteintech), LETM1 (1:1000; 16024-1-AP, Proteintech), SDHB (1:1000; 10620-1-AP, Proteintech), COX IV (1:1000; 66110-1-Ig, Proteintech), PDH (1:1000; ab110333, Abcam), p-AMPK (1:1000; 2535, Cell signaling technology), DRP1 (1:1000; ab184247, Abcam), MFN2 (1:1000; ab124773, Abcam), OPA1 (1:1000; 80471S, Cell signaling), PINK1 (1:1000; ab23707, Abcam), PARKIN (1:1000; ab77924, Abcam), LC3 (1:1000; ab192890, Abcam), P62 (1:1000; ab109012, Abcam) and GAPDH (1:10000, 60004-1-Ig, Proteintech) overnight at 4 °C. ..

Saline:

Image Search Results

Overview of the study revealing PDHA1 as a key regulator of sarcoma progression and immune evasion.

Journal: NPJ Precision Oncology

Article Title: Cuproptosis-associated PDHA1 promotes sarcoma progression and immunotherapy responsiveness via the E2F1–PD-L1 axis: a multi-omics and clinical validation study

doi: 10.1038/s41698-026-01298-0

Figure Lengend Snippet: Overview of the study revealing PDHA1 as a key regulator of sarcoma progression and immune evasion.

Article Snippet: To modulate cuproptosis, MG63 cells with stable PDHA1 knockdown or control (sh-PDHA1 and sh-NC) were treated with the copper chelator ammonium tetrathiomolybdate (TTM; MedChemExpress, HY-100276).

Techniques:

A Cumulative distribution function (CDF) plots for consensus clustering with k = 2–6. B Relative change in the area under the CDF curve for different k-values. C Consensus matrix for clustering at k = 2. D Heatmap of CRG expression across subtypes. E Differential expression of CRGs between C1 and C2 in TCGA-SARC. F Protein-protein interaction network of 12 CRGs, highlighting PDHA1 as a hub. G Pearson correlation matrix of CRG expression. H Friends similarity analysis showing PDHA1 as the most central gene.

Journal: NPJ Precision Oncology

Article Title: Cuproptosis-associated PDHA1 promotes sarcoma progression and immunotherapy responsiveness via the E2F1–PD-L1 axis: a multi-omics and clinical validation study

doi: 10.1038/s41698-026-01298-0

Figure Lengend Snippet: A Cumulative distribution function (CDF) plots for consensus clustering with k = 2–6. B Relative change in the area under the CDF curve for different k-values. C Consensus matrix for clustering at k = 2. D Heatmap of CRG expression across subtypes. E Differential expression of CRGs between C1 and C2 in TCGA-SARC. F Protein-protein interaction network of 12 CRGs, highlighting PDHA1 as a hub. G Pearson correlation matrix of CRG expression. H Friends similarity analysis showing PDHA1 as the most central gene.

Techniques: Expressing, Quantitative Proteomics

A PDHA1 expression across GEO, TARGET, and ICGC. B ROC curves for PDHA1 diagnostic value. C Distribution of risk score, survival status, and expression in TCGA. D Kaplan-Meier curve of OS. E Time-dependent ROC curves for 1-, 3-, and 5-year OS. F DSS curve of PDHA1 high and low groups. G OS curve in GSE21257 . H OS curve in GSE17674 .

Journal: NPJ Precision Oncology

Article Title: Cuproptosis-associated PDHA1 promotes sarcoma progression and immunotherapy responsiveness via the E2F1–PD-L1 axis: a multi-omics and clinical validation study

doi: 10.1038/s41698-026-01298-0

Figure Lengend Snippet: A PDHA1 expression across GEO, TARGET, and ICGC. B ROC curves for PDHA1 diagnostic value. C Distribution of risk score, survival status, and expression in TCGA. D Kaplan-Meier curve of OS. E Time-dependent ROC curves for 1-, 3-, and 5-year OS. F DSS curve of PDHA1 high and low groups. G OS curve in GSE21257 . H OS curve in GSE17674 .

Techniques: Expressing, Diagnostic Assay

A Nomogram integrating PDHA1 and clinical variables. B Calibration curves for 1-, 3-, and 5-year OS. C ROC curves for OS prediction. D Time-dependent AUC curves. E DCA showing clinical benefit of the nomogram.

Journal: NPJ Precision Oncology

Article Title: Cuproptosis-associated PDHA1 promotes sarcoma progression and immunotherapy responsiveness via the E2F1–PD-L1 axis: a multi-omics and clinical validation study

doi: 10.1038/s41698-026-01298-0

Figure Lengend Snippet: A Nomogram integrating PDHA1 and clinical variables. B Calibration curves for 1-, 3-, and 5-year OS. C ROC curves for OS prediction. D Time-dependent AUC curves. E DCA showing clinical benefit of the nomogram.

Techniques:

A Correlation between PDHA1 expression levels and infiltration of various immune cells across 33 different tumor types, analyzed using CIBERSORT and ssGSEA algorithms (* P < 0.05). B Differences in immune infiltration between high and low PDHA1 expression groups based on the CIBERSORT algorithm. C Correlation analysis between PDHA1 expression and immune infiltration based on the CIBERSORT algorithm. D Differences in immune infiltration between high and low PDHA1 expression groups based on the ssGSEA algorithm. E Correlation analysis between PDHA1 expression and immune infiltration based on the ssGSEA algorithm. F Differences in ESTIMATE scores between high and low PDHA1 expression groups.

Journal: NPJ Precision Oncology

Article Title: Cuproptosis-associated PDHA1 promotes sarcoma progression and immunotherapy responsiveness via the E2F1–PD-L1 axis: a multi-omics and clinical validation study

doi: 10.1038/s41698-026-01298-0

Figure Lengend Snippet: A Correlation between PDHA1 expression levels and infiltration of various immune cells across 33 different tumor types, analyzed using CIBERSORT and ssGSEA algorithms (* P < 0.05). B Differences in immune infiltration between high and low PDHA1 expression groups based on the CIBERSORT algorithm. C Correlation analysis between PDHA1 expression and immune infiltration based on the CIBERSORT algorithm. D Differences in immune infiltration between high and low PDHA1 expression groups based on the ssGSEA algorithm. E Correlation analysis between PDHA1 expression and immune infiltration based on the ssGSEA algorithm. F Differences in ESTIMATE scores between high and low PDHA1 expression groups.

Techniques: Expressing

A scRNA-seq clustering of SARC immune cells. B Cell lineage annotations. C Heatmap of gene expression aggregated by cell type. D Dot plot of canonical marker genes. E PDHA1 distribution across cell types. F Cell–cell communication network. G Ligand–receptor interaction bubble plot.

Journal: NPJ Precision Oncology

Article Title: Cuproptosis-associated PDHA1 promotes sarcoma progression and immunotherapy responsiveness via the E2F1–PD-L1 axis: a multi-omics and clinical validation study

doi: 10.1038/s41698-026-01298-0

Figure Lengend Snippet: A scRNA-seq clustering of SARC immune cells. B Cell lineage annotations. C Heatmap of gene expression aggregated by cell type. D Dot plot of canonical marker genes. E PDHA1 distribution across cell types. F Cell–cell communication network. G Ligand–receptor interaction bubble plot.

Techniques: Gene Expression, Marker

A PDHA1 mRNA levels are significantly higher in sarcoma tissues than in matched adjacent normal tissues ( n = 60). B , C Western blot and quantitative analysis showing increased protein expression of PDHA1, PD-L1 and E2F1 in tumor versus normal tissues. D , E Representative IHC staining and semiquantitative analysis in liposarcoma and synovial sarcoma samples demonstrating upregulation of PDHA1, PD-L1, E2F1 and Ki-67 in tumor tissues. Scale bar: 50 μm. F Nomogram incorporating PDHA1 expression, age, gender and metastasis status to predict 1-, 3- and 5-year overall survival (OS) in sarcoma patients. G Kaplan–Meier analysis indicating that high PDHA1 expression is associated with poor OS. H Time-dependent ROC curves showing the predictive performance of the PDHA1-based model for 1-, 3- and 5-year OS. I Dynamic AUC plot evaluating the discrimination ability of the nomogram over time. J Decision curve analysis (DCA) demonstrating the net clinical benefit of the PDHA1-based nomogram. K – M qPCR and Western blot analyses showing that PDHA1 expression is significantly elevated in human sarcoma cell lines (MG63, SW982, SW872) compared with normal control cells (hFOB1.19, HFLS, HPA-V). Data are presented as mean ± SEM. *** P < 0.001.

Journal: NPJ Precision Oncology

Article Title: Cuproptosis-associated PDHA1 promotes sarcoma progression and immunotherapy responsiveness via the E2F1–PD-L1 axis: a multi-omics and clinical validation study

doi: 10.1038/s41698-026-01298-0

Figure Lengend Snippet: A PDHA1 mRNA levels are significantly higher in sarcoma tissues than in matched adjacent normal tissues ( n = 60). B , C Western blot and quantitative analysis showing increased protein expression of PDHA1, PD-L1 and E2F1 in tumor versus normal tissues. D , E Representative IHC staining and semiquantitative analysis in liposarcoma and synovial sarcoma samples demonstrating upregulation of PDHA1, PD-L1, E2F1 and Ki-67 in tumor tissues. Scale bar: 50 μm. F Nomogram incorporating PDHA1 expression, age, gender and metastasis status to predict 1-, 3- and 5-year overall survival (OS) in sarcoma patients. G Kaplan–Meier analysis indicating that high PDHA1 expression is associated with poor OS. H Time-dependent ROC curves showing the predictive performance of the PDHA1-based model for 1-, 3- and 5-year OS. I Dynamic AUC plot evaluating the discrimination ability of the nomogram over time. J Decision curve analysis (DCA) demonstrating the net clinical benefit of the PDHA1-based nomogram. K – M qPCR and Western blot analyses showing that PDHA1 expression is significantly elevated in human sarcoma cell lines (MG63, SW982, SW872) compared with normal control cells (hFOB1.19, HFLS, HPA-V). Data are presented as mean ± SEM. *** P < 0.001.

Techniques: Western Blot, Expressing, Immunohistochemistry, Control

A qRT-PCR analysis showing efficient knockdown of PDHA1 by three independent shRNAs and corresponding downregulation of PD-L1 and E2F1 in MG63 and SW982 cells. B Western blot confirms reduced protein levels of PDHA1, E2F1, and PD-L1 in both cell lines. C , D CCK-8 assays demonstrate significantly impaired proliferation after PDHA1 silencing at 24–72 h. E , F EdU immunofluorescence staining and quantification show decreased DNA synthesis in PDHA1-deficient cells. G , H Wound healing assays reveal reduced migration capacity after PDHA1 knockdown. I , J Transwell migration and invasion assays indicate markedly decreased motility and invasiveness in both MG63 and SW982 cells. K , L Colony formation assays demonstrate a substantial reduction in clonogenic potential upon PDHA1 depletion.

Journal: NPJ Precision Oncology

Article Title: Cuproptosis-associated PDHA1 promotes sarcoma progression and immunotherapy responsiveness via the E2F1–PD-L1 axis: a multi-omics and clinical validation study

doi: 10.1038/s41698-026-01298-0

Figure Lengend Snippet: A qRT-PCR analysis showing efficient knockdown of PDHA1 by three independent shRNAs and corresponding downregulation of PD-L1 and E2F1 in MG63 and SW982 cells. B Western blot confirms reduced protein levels of PDHA1, E2F1, and PD-L1 in both cell lines. C , D CCK-8 assays demonstrate significantly impaired proliferation after PDHA1 silencing at 24–72 h. E , F EdU immunofluorescence staining and quantification show decreased DNA synthesis in PDHA1-deficient cells. G , H Wound healing assays reveal reduced migration capacity after PDHA1 knockdown. I , J Transwell migration and invasion assays indicate markedly decreased motility and invasiveness in both MG63 and SW982 cells. K , L Colony formation assays demonstrate a substantial reduction in clonogenic potential upon PDHA1 depletion.

Techniques: Quantitative RT-PCR, Knockdown, Western Blot, CCK-8 Assay, Immunofluorescence, Staining, DNA Synthesis, Migration

A – C 3D spheroid assays in MG63 cells show significantly reduced spheroid volume and Matrigel invasion area following PDHA1 knockdown over 7 days. D – F In vivo xenograft models demonstrate markedly suppressed tumor growth and decreased tumor weight in the sh-PDHA1 group. G Representative H&E, TUNEL, and IHC staining of xenograft tumors show decreased expression of PDHA1, Ki-67, Cyclin D1, PD-L1, E2F1, Bcl-2, and MMP-9, and increased cleaved Caspase-3 and apoptosis in the sh-PDHA1 group. H Quantification of TUNEL and IHC staining. I , J Western blot and densitometric analysis confirm significant downregulation of PDHA1, PD-L1, E2F1, Bcl-2, and MMP-9, and upregulation of cleaved Caspase-3 in tumor lysates upon PDHA1 knockdown.

Journal: NPJ Precision Oncology

Article Title: Cuproptosis-associated PDHA1 promotes sarcoma progression and immunotherapy responsiveness via the E2F1–PD-L1 axis: a multi-omics and clinical validation study

doi: 10.1038/s41698-026-01298-0

Figure Lengend Snippet: A – C 3D spheroid assays in MG63 cells show significantly reduced spheroid volume and Matrigel invasion area following PDHA1 knockdown over 7 days. D – F In vivo xenograft models demonstrate markedly suppressed tumor growth and decreased tumor weight in the sh-PDHA1 group. G Representative H&E, TUNEL, and IHC staining of xenograft tumors show decreased expression of PDHA1, Ki-67, Cyclin D1, PD-L1, E2F1, Bcl-2, and MMP-9, and increased cleaved Caspase-3 and apoptosis in the sh-PDHA1 group. H Quantification of TUNEL and IHC staining. I , J Western blot and densitometric analysis confirm significant downregulation of PDHA1, PD-L1, E2F1, Bcl-2, and MMP-9, and upregulation of cleaved Caspase-3 in tumor lysates upon PDHA1 knockdown.

Techniques: Knockdown, In Vivo, TUNEL Assay, Immunohistochemistry, Expressing, Western Blot

A ChIP-qPCR analysis showing enrichment of E2F1 at the predicted response elements (RE1, RE2) in the PD-L1 promoter in MG63 and SW982 cells; enrichment is further increased upon E2F1 overexpression (Ac-H3, positive control; IgG, negative control). B , C Luciferase assays indicating that E2F1 enhances the activity of wild-type (WT) PD-L1 promoter constructs but not mutant (Mut) constructs lacking E2F1-binding sites. D , E Western blot and quantification of PDHA1, E2F1, and PD-L1 in sh-NC, sh-PDHA1, sh-PDHA1 + E2F1-OE, and E2F1-OE groups, showing that E2F1 rescues PD-L1 downregulation induced by PDHA1 knockdown. F , G Flow cytometry and statistical analysis of apoptosis demonstrating that PDHA1 knockdown increases apoptosis, which is partially reversed by E2F1 overexpression. H , I Western blot and quantification showing that PDHA1 knockdown and/or TTM treatment reduce Lip-DLAT, E2F1, and PD-L1 expression, with the strongest inhibition in the combination group. J , K Multiplex immunofluorescence and quantification in sarcoma tissues showing that high PDHA1 expression is associated with higher PD-L1 and reduced CD8⁺ T-cell infiltration. Scale bars: 50 μm. L Schematic model of the PDHA1–E2F1–PD-L1 axis in mediating CD8⁺ T-cell exclusion and immune evasion. Data are shown as mean ± SEM. * P < 0.05, ** P < 0.01, *** P < 0.001.

Journal: NPJ Precision Oncology

Article Title: Cuproptosis-associated PDHA1 promotes sarcoma progression and immunotherapy responsiveness via the E2F1–PD-L1 axis: a multi-omics and clinical validation study

doi: 10.1038/s41698-026-01298-0

Figure Lengend Snippet: A ChIP-qPCR analysis showing enrichment of E2F1 at the predicted response elements (RE1, RE2) in the PD-L1 promoter in MG63 and SW982 cells; enrichment is further increased upon E2F1 overexpression (Ac-H3, positive control; IgG, negative control). B , C Luciferase assays indicating that E2F1 enhances the activity of wild-type (WT) PD-L1 promoter constructs but not mutant (Mut) constructs lacking E2F1-binding sites. D , E Western blot and quantification of PDHA1, E2F1, and PD-L1 in sh-NC, sh-PDHA1, sh-PDHA1 + E2F1-OE, and E2F1-OE groups, showing that E2F1 rescues PD-L1 downregulation induced by PDHA1 knockdown. F , G Flow cytometry and statistical analysis of apoptosis demonstrating that PDHA1 knockdown increases apoptosis, which is partially reversed by E2F1 overexpression. H , I Western blot and quantification showing that PDHA1 knockdown and/or TTM treatment reduce Lip-DLAT, E2F1, and PD-L1 expression, with the strongest inhibition in the combination group. J , K Multiplex immunofluorescence and quantification in sarcoma tissues showing that high PDHA1 expression is associated with higher PD-L1 and reduced CD8⁺ T-cell infiltration. Scale bars: 50 μm. L Schematic model of the PDHA1–E2F1–PD-L1 axis in mediating CD8⁺ T-cell exclusion and immune evasion. Data are shown as mean ± SEM. * P < 0.05, ** P < 0.01, *** P < 0.001.

Techniques: ChIP-qPCR, Over Expression, Positive Control, Negative Control, Luciferase, Activity Assay, Construct, Mutagenesis, Binding Assay, Western Blot, Knockdown, Flow Cytometry, Expressing, Inhibition, Multiplex Assay, Immunofluorescence

Rod and cone degeneration in Pdha1 deletion mice . Pdha1 fl/+ / LMOP Cre , Pdha1 fl/fl / LMOP Cre , Pdha1 fl/+ / Hrgp Cre , Pdha1 fl/fl / Hrgp Cre , and WT mice were evaluated for retinal integrity by morphometric analysis. A-B. Shown are representative microscopic images of H&E-stained retinal sections and corresponding quantitative analysis of ONL thickness in mice at 3 months. C–F. Shown are representative confocal images of PNA labeling on retinal whole mounts and corresponding quantitative analysis of PNA-positive cells in mice at 3 ( C-D ) and 5 ( E-F ) months. ONL, outer nuclear layer; INL, Inner nuclear layer; GCL, ganglion cell layer. Data are represented as the mean ± SD for 3–13 mice per group. Data were analyzed by one-way ANOVA, followed by Dunnett's multiple-comparisons test for D and F , and unpaired Student's t -test for B (∗ p < 0.05, ∗∗∗ p < 0.001).

Journal: Molecular Metabolism

Article Title: Photoreceptor deletion of pyruvate dehydrogenase E1 subunit α1 induces retinal degeneration and reprograms retinal metabolism

doi: 10.1016/j.molmet.2026.102343

Figure Lengend Snippet: Rod and cone degeneration in Pdha1 deletion mice . Pdha1 fl/+ / LMOP Cre , Pdha1 fl/fl / LMOP Cre , Pdha1 fl/+ / Hrgp Cre , Pdha1 fl/fl / Hrgp Cre , and WT mice were evaluated for retinal integrity by morphometric analysis. A-B. Shown are representative microscopic images of H&E-stained retinal sections and corresponding quantitative analysis of ONL thickness in mice at 3 months. C–F. Shown are representative confocal images of PNA labeling on retinal whole mounts and corresponding quantitative analysis of PNA-positive cells in mice at 3 ( C-D ) and 5 ( E-F ) months. ONL, outer nuclear layer; INL, Inner nuclear layer; GCL, ganglion cell layer. Data are represented as the mean ± SD for 3–13 mice per group. Data were analyzed by one-way ANOVA, followed by Dunnett's multiple-comparisons test for D and F , and unpaired Student's t -test for B (∗ p < 0.05, ∗∗∗ p < 0.001).

Article Snippet: The Pdha1 fl/fl line was purchased from Jackson Laboratory ( https://www.jax.org/strain/017443 ) [ ], the cone-specific Cre ( Hrgp Cre ) and the rod-specific Cre ( LMOP Cre ) lines were generated as reported previously [ , ].

Techniques: Staining, Labeling

Reduced retinal light response in Pdha1 deletion mice. Pdha1 fl/+ / LMOP Cre , Pdha1 fl/fl / LMOP Cre , Pdha1 fl/+ / Hrgp Cre , Pdha1 fl/fl / Hrgp Cre , and WT mice were evaluated for retinal function using ERG. A-B. Shown are quantitative results of scotopic and photopic amplitudes in rod-specific Pdha1 deletion mice at 2 and 4 months. C-D. Shown are quantitative results of scotopic and photopic amplitudes in cone-specific Pdha1 deletion mice at 2 and 4 months. Data are represented as the mean ± SD for 4–15 mice per group. Data were analyzed by one-way ANOVA, followed by Dunnett's multiple-comparisons test for B-D , and unpaired Student's t -test for A (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001).

Journal: Molecular Metabolism

Article Title: Photoreceptor deletion of pyruvate dehydrogenase E1 subunit α1 induces retinal degeneration and reprograms retinal metabolism

doi: 10.1016/j.molmet.2026.102343

Figure Lengend Snippet: Reduced retinal light response in Pdha1 deletion mice. Pdha1 fl/+ / LMOP Cre , Pdha1 fl/fl / LMOP Cre , Pdha1 fl/+ / Hrgp Cre , Pdha1 fl/fl / Hrgp Cre , and WT mice were evaluated for retinal function using ERG. A-B. Shown are quantitative results of scotopic and photopic amplitudes in rod-specific Pdha1 deletion mice at 2 and 4 months. C-D. Shown are quantitative results of scotopic and photopic amplitudes in cone-specific Pdha1 deletion mice at 2 and 4 months. Data are represented as the mean ± SD for 4–15 mice per group. Data were analyzed by one-way ANOVA, followed by Dunnett's multiple-comparisons test for B-D , and unpaired Student's t -test for A (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001).

Techniques:

Altered retinal metabolomic profiles in Pdha1 deletion mice. Female rod-specific Pdha1 deletion ( Pdha1 fl/+ / LMOP Cre and Pdha1 fl/fl / LMOP Cre ) and WT mice at 3 months were evaluated for metabolomic profiles using LC MS and GC MS. A-E. Altered retinal metabolomic profiles in heterozygous Pdha1 deletion mice. F-J. Altered retinal metabolomic profiles in homozygous Pdha1 deletion mice. A, F. PLS-DA plots of retinal metabolomic profiles in heterozygous ( A ) and homozygous ( F ) Pdha1 deletion mice, relative to WT controls. B, G. Volcano plot of retinal metabolites altered in heterozygous ( B ) and homozygous ( G ) Pdha1 deletion mice, relative to WT controls. C, H. Heatmap of differentially expressed metabolites in heterozygous ( C ) and homozygous ( H ) Pdha1 deletion mice, relative to WT controls. D, I. Fold change of retinal metabolites of glycolysis and TCA cycle in heterozygous ( D ) and homozygous ( I ) Pdha1 deletion mice, relative to WT controls. E, J. Fold change of retinal metabolites of amino acids and their derivatives, carbohydrates and their derivatives, cofactors/vitamins, nucleotides and nucleosides, and organic acids and their derivatives in heterozygous ( E ) and homozygous ( J ) Pdha1 deletion mice, relative to WT controls.

Journal: Molecular Metabolism

Article Title: Photoreceptor deletion of pyruvate dehydrogenase E1 subunit α1 induces retinal degeneration and reprograms retinal metabolism

doi: 10.1016/j.molmet.2026.102343

Figure Lengend Snippet: Altered retinal metabolomic profiles in Pdha1 deletion mice. Female rod-specific Pdha1 deletion ( Pdha1 fl/+ / LMOP Cre and Pdha1 fl/fl / LMOP Cre ) and WT mice at 3 months were evaluated for metabolomic profiles using LC MS and GC MS. A-E. Altered retinal metabolomic profiles in heterozygous Pdha1 deletion mice. F-J. Altered retinal metabolomic profiles in homozygous Pdha1 deletion mice. A, F. PLS-DA plots of retinal metabolomic profiles in heterozygous ( A ) and homozygous ( F ) Pdha1 deletion mice, relative to WT controls. B, G. Volcano plot of retinal metabolites altered in heterozygous ( B ) and homozygous ( G ) Pdha1 deletion mice, relative to WT controls. C, H. Heatmap of differentially expressed metabolites in heterozygous ( C ) and homozygous ( H ) Pdha1 deletion mice, relative to WT controls. D, I. Fold change of retinal metabolites of glycolysis and TCA cycle in heterozygous ( D ) and homozygous ( I ) Pdha1 deletion mice, relative to WT controls. E, J. Fold change of retinal metabolites of amino acids and their derivatives, carbohydrates and their derivatives, cofactors/vitamins, nucleotides and nucleosides, and organic acids and their derivatives in heterozygous ( E ) and homozygous ( J ) Pdha1 deletion mice, relative to WT controls.

Techniques: Metabolomic, Liquid Chromatography with Mass Spectroscopy, Gas Chromatography-Mass Spectrometry

Altered expression of glucose metabolic genes in Pdha1 deletion mice. Female rod-specific Pdha1 deletion ( Pdha1 fl/+ / LMOP Cre and Pdha1 fl/fl / LMOP Cre ) and WT mice at 3 months were evaluated for expression of glucose metabolism genes using the mouse glucose metabolism RT 2 Profiler™ Array. A. Heatmap of differentially expressed genes in heterozygous and homozygous mice relative to WT controls. B–C. Volcano plot of glucose metabolism gene expression in heterozygous ( B) and homozygous ( C ) mice relative to WT controls. Significantly differentially expressed glycolysis and TCA genes are highlighted. D. Comparison of significantly differentially expressed genes in heterozygous and homozygous mice relative to WT controls.

Journal: Molecular Metabolism

Article Title: Photoreceptor deletion of pyruvate dehydrogenase E1 subunit α1 induces retinal degeneration and reprograms retinal metabolism

doi: 10.1016/j.molmet.2026.102343

Figure Lengend Snippet: Altered expression of glucose metabolic genes in Pdha1 deletion mice. Female rod-specific Pdha1 deletion ( Pdha1 fl/+ / LMOP Cre and Pdha1 fl/fl / LMOP Cre ) and WT mice at 3 months were evaluated for expression of glucose metabolism genes using the mouse glucose metabolism RT 2 Profiler™ Array. A. Heatmap of differentially expressed genes in heterozygous and homozygous mice relative to WT controls. B–C. Volcano plot of glucose metabolism gene expression in heterozygous ( B) and homozygous ( C ) mice relative to WT controls. Significantly differentially expressed glycolysis and TCA genes are highlighted. D. Comparison of significantly differentially expressed genes in heterozygous and homozygous mice relative to WT controls.

Techniques: Expressing, Gene Expression, Comparison

Impaired photoreceptor mitochondrial morphology in Pdha1 deletion mice. Pdha1 fl/fl / LMOP Cre , Pdha1 fl/+ / LMOP Cre (male), and WT mice at 3 months were evaluated for photoreceptor ultrastructure using transmission EM. A-B. EM images of photoreceptor mitochondria in WT and Pdha1 mutant mice. Images in A and B are shown at different scales. Scale bars: 0.5 μm. C. Quantification of mitochondrial diameter and diameter variation. Left: Individual mitochondrial diameters are significantly increased in Pdha1 mutant photoreceptors ( p < 0.0001). Middle: Mouse-averaged mitochondrial diameters are significantly higher in Pdha1 mutant mice ( p = 0.0424). Right: Diameter variation is not significantly different between genotypes ( p = 0.7633). Data are presented as individual mitochondria (dots, n = 120 per group), individual mice (color, n = 4 per group), mean, and standard deviation. Blue and purple indicate female mice; orange and green indicate male mice. Two-tailed Student's t -tests were performed for both individual and mouse-level comparisons.

Journal: Molecular Metabolism

Article Title: Photoreceptor deletion of pyruvate dehydrogenase E1 subunit α1 induces retinal degeneration and reprograms retinal metabolism

doi: 10.1016/j.molmet.2026.102343

Figure Lengend Snippet: Impaired photoreceptor mitochondrial morphology in Pdha1 deletion mice. Pdha1 fl/fl / LMOP Cre , Pdha1 fl/+ / LMOP Cre (male), and WT mice at 3 months were evaluated for photoreceptor ultrastructure using transmission EM. A-B. EM images of photoreceptor mitochondria in WT and Pdha1 mutant mice. Images in A and B are shown at different scales. Scale bars: 0.5 μm. C. Quantification of mitochondrial diameter and diameter variation. Left: Individual mitochondrial diameters are significantly increased in Pdha1 mutant photoreceptors ( p < 0.0001). Middle: Mouse-averaged mitochondrial diameters are significantly higher in Pdha1 mutant mice ( p = 0.0424). Right: Diameter variation is not significantly different between genotypes ( p = 0.7633). Data are presented as individual mitochondria (dots, n = 120 per group), individual mice (color, n = 4 per group), mean, and standard deviation. Blue and purple indicate female mice; orange and green indicate male mice. Two-tailed Student's t -tests were performed for both individual and mouse-level comparisons.

Techniques: Transmission Assay, Mutagenesis, Standard Deviation, Two Tailed Test

Retinal glial activation in Pdha1 deletion mice. Pdha1 fl/+ / LMOP Cre , Pdha1 fl/fl / LMOP Cre , Pdha1 fl/fl / Hrgp Cre , and WT mice at 3 months were evaluated for retinal glial cell activation by GFAP staining. A-B. Shown are representative confocal images of GFAP labeling on retinal sections and corresponding quantitative analysis in rod-specific Pdha1 deletion mice. C-D. Shown are representative confocal images of GFAP labeling on retinal sections and corresponding quantitative analysis in cone-specific Pdha1 deletion mice. ONL, outer nuclear layer; INL, Inner nuclear layer; GCL, ganglion cell layer. Data are represented as the mean ± SD for 5–10 mice per group. Data were analyzed by one-way ANOVA, followed by Dunnett's multiple-comparisons test for B , and by unpaired Student's t -test for D (∗∗ p < 0.01, ∗∗∗ p < 0.001).

Journal: Molecular Metabolism

Article Title: Photoreceptor deletion of pyruvate dehydrogenase E1 subunit α1 induces retinal degeneration and reprograms retinal metabolism

doi: 10.1016/j.molmet.2026.102343

Figure Lengend Snippet: Retinal glial activation in Pdha1 deletion mice. Pdha1 fl/+ / LMOP Cre , Pdha1 fl/fl / LMOP Cre , Pdha1 fl/fl / Hrgp Cre , and WT mice at 3 months were evaluated for retinal glial cell activation by GFAP staining. A-B. Shown are representative confocal images of GFAP labeling on retinal sections and corresponding quantitative analysis in rod-specific Pdha1 deletion mice. C-D. Shown are representative confocal images of GFAP labeling on retinal sections and corresponding quantitative analysis in cone-specific Pdha1 deletion mice. ONL, outer nuclear layer; INL, Inner nuclear layer; GCL, ganglion cell layer. Data are represented as the mean ± SD for 5–10 mice per group. Data were analyzed by one-way ANOVA, followed by Dunnett's multiple-comparisons test for B , and by unpaired Student's t -test for D (∗∗ p < 0.01, ∗∗∗ p < 0.001).

Techniques: Activation Assay, Staining, Labeling

A, Schematic of glycolysis termination illustrating LDHA and PDH deletion with Mx1Cre;Ldha Δ/Δ ;Pdha1 Δ mice. B-D, Peripheral blood counts. E, Bone marrow cellularity. F–I, Numbers of neutrophils, monocytes, B, and T cells. J–L, Numbers of bone marrow erythroid progenitors. M-N, Images and quantification of methylcellulose colonies from single sorted Mx1Cre;Ldha Δ/Δ ;Pdha1 Δ/Δ HSCs or controls. O-X, HSC and progenitor number in the bone marrow of Mx1Cre;Ldha Δ/Δ ;Pdha1 Δ mice. N = 6-10 mice/genotype per time point for b-l and 7-15 mice/genotype for o-x. All data represent mean ± s.d. Statistical significance was assessed with a Welch’s test ( C ) or a t-test (rest).

Journal: bioRxiv

Article Title: Stem cell function in vivo is supported by an alternative glycolysis endpoint

doi: 10.64898/2026.03.30.715412

Figure Lengend Snippet: A, Schematic of glycolysis termination illustrating LDHA and PDH deletion with Mx1Cre;Ldha Δ/Δ ;Pdha1 Δ mice. B-D, Peripheral blood counts. E, Bone marrow cellularity. F–I, Numbers of neutrophils, monocytes, B, and T cells. J–L, Numbers of bone marrow erythroid progenitors. M-N, Images and quantification of methylcellulose colonies from single sorted Mx1Cre;Ldha Δ/Δ ;Pdha1 Δ/Δ HSCs or controls. O-X, HSC and progenitor number in the bone marrow of Mx1Cre;Ldha Δ/Δ ;Pdha1 Δ mice. N = 6-10 mice/genotype per time point for b-l and 7-15 mice/genotype for o-x. All data represent mean ± s.d. Statistical significance was assessed with a Welch’s test ( C ) or a t-test (rest).

Article Snippet: Ldha fl/fl (Jackson Laboratory #030112) , Pdha1 fll (Jackson Laboratory #017443) , Slc16a1 fl (a gift from B. Morrison, Johns Hopkins) and Mx1cre (Jackson Laboratory #003556) mice were previously described.

Techniques:

$A, Schematic of combined LDH and PDH deletion. B, Immunoblot of LDHA, LDHB, and PDH in bone marrow cells following ACK lysis of red blood cells 3 weeks after deletion. C, HSC bone marrow frequency and number per two legs of mice from the indicated genotypes. D-F, Metabolomics of bone marrow cells from Mx1Cre;Ldha Δ/Δ ; Ldhb Δ/Δ ; Pdha1 τι mice and littermate controls 3 weeks after deletion. D, PCA scores plot of the hematopoietic cell metabolome E, Volcano plot of metabolite changes in hematopoietic cells. Fold change represents metabolite levels in Mx1Cre;Ldha Δ/Δ ; Ldhb Δ/Δ ; Pdha1 τι cells relative to controls. F, Levels of metabolites in central carbon metabolism. G-J, Levels of glycolytic, redox, and TCA cycle metabolites in HSC+MPP populations measured by in vivo metabolomics analysis. K-M, Results of in vivo U 13 C-glucose tracing in the indicated HSC and progenitor populations showing isotopologue abundance or fractional enrichment of the indicated metabolites. N, Respiratory ATP-linked O 2 consumption of sorted Lin - kit + HSPCs or total CD45 + bone marrow cells calculated as the difference in O 2 consumption before and after oligomycin treatment, relative to control. Each point represents a biological replicate. All data represent mean ± s.d. Statistical significance was assessed with a Mann Whitney test ( G , K-L ) or a t-test ( C , F , N ). Statistical significance for the NAD + /NADH ratio was assessed by log transformation of data followed by a t test. Statistical significance for metabolomics experiments was assessed with multiple t-tests controlling the false discovery rate at 5% with the Benjamini, Krieger, and Yekutieli method. All figures show * p<0.05, ** p<0.01, ***p<0.001.$

Journal: bioRxiv

Article Title: Stem cell function in vivo is supported by an alternative glycolysis endpoint

doi: 10.64898/2026.03.30.715412

Figure Lengend Snippet: A, Schematic of combined LDH and PDH deletion. B, Immunoblot of LDHA, LDHB, and PDH in bone marrow cells following ACK lysis of red blood cells 3 weeks after deletion. C, HSC bone marrow frequency and number per two legs of mice from the indicated genotypes. D-F, Metabolomics of bone marrow cells from Mx1Cre;Ldha Δ/Δ ; Ldhb Δ/Δ ; Pdha1 τι mice and littermate controls 3 weeks after deletion. D, PCA scores plot of the hematopoietic cell metabolome E, Volcano plot of metabolite changes in hematopoietic cells. Fold change represents metabolite levels in Mx1Cre;Ldha Δ/Δ ; Ldhb Δ/Δ ; Pdha1 τι cells relative to controls. F, Levels of metabolites in central carbon metabolism. G-J, Levels of glycolytic, redox, and TCA cycle metabolites in HSC+MPP populations measured by in vivo metabolomics analysis. K-M, Results of in vivo U 13 C-glucose tracing in the indicated HSC and progenitor populations showing isotopologue abundance or fractional enrichment of the indicated metabolites. N, Respiratory ATP-linked O 2 consumption of sorted Lin - kit + HSPCs or total CD45 + bone marrow cells calculated as the difference in O 2 consumption before and after oligomycin treatment, relative to control. Each point represents a biological replicate. All data represent mean ± s.d. Statistical significance was assessed with a Mann Whitney test ( G , K-L ) or a t-test ( C , F , N ). Statistical significance for the NAD + /NADH ratio was assessed by log transformation of data followed by a t test. Statistical significance for metabolomics experiments was assessed with multiple t-tests controlling the false discovery rate at 5% with the Benjamini, Krieger, and Yekutieli method. All figures show * p<0.05, ** p<0.01, ***p<0.001.

Techniques: Western Blot, Lysis, In Vivo, Control, MANN-WHITNEY, Transformation Assay

A–I, Numbers of multipotent and restricted myeloid progenitors in the bone marrow of Mx1Cre;Ldha Δ/Δ ;Ldhb Δ/Δ ;Pdha1 Δ mice at 3 and 6 weeks after deletion. J, Images and quantification of methylcellulose colonies from single sorted Mx1Cre;Ldha Δ/Δ ; Ldhb Δ/Δ ;Pdha1 τι HSCs or controls. K, Bone marrow cellularity. L-N, Peripheral blood counts. O–Q, Numbers of erythroid progenitors. R-U, Numbers of neutrophils, monocytes, B, and T cells in Mx1Cre;Ldha Δ/Δ ;Ldhb Δ/Δ ;Pdha1 Δ mice. N = 7 mice/genotype at 3 weeks and 10-13 mice/genotype at 6 weeks after deletion. All data represent mean ± s.d. Statistical significance was assessed with a Mann-Whitney test ( O ) or a t-test (rest). All figures show * p<0.05, ** p<0.01, ***p<0.001.

Journal: bioRxiv

Article Title: Stem cell function in vivo is supported by an alternative glycolysis endpoint

doi: 10.64898/2026.03.30.715412

Figure Lengend Snippet: A–I, Numbers of multipotent and restricted myeloid progenitors in the bone marrow of Mx1Cre;Ldha Δ/Δ ;Ldhb Δ/Δ ;Pdha1 Δ mice at 3 and 6 weeks after deletion. J, Images and quantification of methylcellulose colonies from single sorted Mx1Cre;Ldha Δ/Δ ; Ldhb Δ/Δ ;Pdha1 τι HSCs or controls. K, Bone marrow cellularity. L-N, Peripheral blood counts. O–Q, Numbers of erythroid progenitors. R-U, Numbers of neutrophils, monocytes, B, and T cells in Mx1Cre;Ldha Δ/Δ ;Ldhb Δ/Δ ;Pdha1 Δ mice. N = 7 mice/genotype at 3 weeks and 10-13 mice/genotype at 6 weeks after deletion. All data represent mean ± s.d. Statistical significance was assessed with a Mann-Whitney test ( O ) or a t-test (rest). All figures show * p<0.05, ** p<0.01, ***p<0.001.

Techniques: MANN-WHITNEY

Transplantation of Mx1Cre;Ldha Δ/Δ ; Ldhb Δ/Δ ;Pdha1 τι , Mx1Cre;Ldha Δ/Δ ;Pdha1 τι , or littermate control CD45.2 + donor bone marrow cells with wild type CD45.1 + CD45.2 + competitor cells into lethally irradiated CD45.1 + recipients. A, Schematic of primary and secondary transplantation experiments. B, Schematic of transplantation of undeleted donor cells followed by deletion at 6 weeks post-transplant. C–D, Donor chimerism in C blood and D bone marrow HSPCs in primary recipients (n = 12-13 for blood; n = 9-12 for BM from 3 independent experiments) from the transplant outlined in A . E–F, Donor contribution in E blood and F bone marrow HSPCs in secondary recipients (n = 8-11 for blood; n = 4-8 for BM from 3 independent experiments) from the transplant outlined in A . G–H, Peripheral blood ( G ) and BM HSPC ( H ) chimerism (n = 20–29 for blood; n = 13–24 for BM from 6 independent experiments) from the transplant outlined in B. All data represent mean ± s.d. Statistical significance was assessed with a 1-way ANOVA followed by Dunnett’s test. All figures show * p<0.05, ** p<0.01, ***p<0.001.

Journal: bioRxiv

Article Title: Stem cell function in vivo is supported by an alternative glycolysis endpoint

doi: 10.64898/2026.03.30.715412

Figure Lengend Snippet: Transplantation of Mx1Cre;Ldha Δ/Δ ; Ldhb Δ/Δ ;Pdha1 τι , Mx1Cre;Ldha Δ/Δ ;Pdha1 τι , or littermate control CD45.2 + donor bone marrow cells with wild type CD45.1 + CD45.2 + competitor cells into lethally irradiated CD45.1 + recipients. A, Schematic of primary and secondary transplantation experiments. B, Schematic of transplantation of undeleted donor cells followed by deletion at 6 weeks post-transplant. C–D, Donor chimerism in C blood and D bone marrow HSPCs in primary recipients (n = 12-13 for blood; n = 9-12 for BM from 3 independent experiments) from the transplant outlined in A . E–F, Donor contribution in E blood and F bone marrow HSPCs in secondary recipients (n = 8-11 for blood; n = 4-8 for BM from 3 independent experiments) from the transplant outlined in A . G–H, Peripheral blood ( G ) and BM HSPC ( H ) chimerism (n = 20–29 for blood; n = 13–24 for BM from 6 independent experiments) from the transplant outlined in B. All data represent mean ± s.d. Statistical significance was assessed with a 1-way ANOVA followed by Dunnett’s test. All figures show * p<0.05, ** p<0.01, ***p<0.001.

Techniques: Transplantation Assay, Control, Irradiation

A, Schematic of glucose-consumption and metabolite-production assays. B-C, Glucose consumption and pyruvate and lactate production in sorted Lin - Kit + HSPCs or CD45 + bone marrow cells after LDH deletion. Cells were cultured ex vivo with 0.5 mM glucose for 12 hours. depleted metabolite in sorted Mx1Cre;Ldha Δ/Δ ;Ldhb Δ/Δ Lin - Kit + HSPCs and CD45 + bone marrow cells. The x-axis shows fold change (FC) in Ldha Δ/Δ ;Ldhb Δ/Δ relative to Ldha fl/fl ;Ldhb fl/fl samples. D-E, Volcano plots showing pyruvate as the major elevated metabolite, and lactate as the major depleted metabolite in sorted Mx1Cre;Ldha D / D ;Ldhb D / D Lin-Kit+ HSPCs and CD45+ bone marrow cells. The x-axis shows fold change (FC) in Ldha D / D ;Ldhb D / D relative to Ldhafl/fl;Ldhbfl/fl samples. F–G, Glucose-derived pyruvate and lactate production in sorted HSPCs or CD45 + BM cells cultured for 12 hours with 0.5 mM U 13 C-glucose (n = 3–4 experiments). H, Pyruvate and lactate production in sorted Lin - Kit + HSPCs or CD45 + bone marrow cells after LDH/PDH deletion. Cells were cultured ex vivo with 0.2 mM glucose for 12 hours. I–J, PCA plot ( I ) and volcano plot ( J ) of metabolites in BM interstitial fluid (BM-ISF). The x-axis in J shows fold change (FC) in Ldha Δ/Δ ;Ldhb Δ/Δ ;Pdha1 Δ relative to Ldha fl/fl ;Ldhb fl/fl ;Pdha1 fl samples. K, Pyruvate is highly enriched in the BM-ISF after triple deletion and lactate is highly depleted. L, Pyruvate production in sorted Lin - Kit + HSPCs bone marrow cells cultured ex vivo with 1 mM glucose with or without 200 μM palmitate and 5 mM lactate for 12 hours. M, Schematic of BM-ISF metabolomics experiments in mice fed with high fat diet or normal chow for 1 week. N–O, Levels of pyruvate and lactate in N , BM-ISF and O serum after high fat diet or normal chow feeding. All data represent mean ± s.d. Statistical significance was assessed with a Mann-Whitney test ( C -lactate), Welch’s test ( H , K ), or a t-test (rest). All figures show * p<0.05, ** p<0.01, ***p<0.001.

Journal: bioRxiv

Article Title: Stem cell function in vivo is supported by an alternative glycolysis endpoint

doi: 10.64898/2026.03.30.715412

Figure Lengend Snippet: A, Schematic of glucose-consumption and metabolite-production assays. B-C, Glucose consumption and pyruvate and lactate production in sorted Lin - Kit + HSPCs or CD45 + bone marrow cells after LDH deletion. Cells were cultured ex vivo with 0.5 mM glucose for 12 hours. depleted metabolite in sorted Mx1Cre;Ldha Δ/Δ ;Ldhb Δ/Δ Lin - Kit + HSPCs and CD45 + bone marrow cells. The x-axis shows fold change (FC) in Ldha Δ/Δ ;Ldhb Δ/Δ relative to Ldha fl/fl ;Ldhb fl/fl samples. D-E, Volcano plots showing pyruvate as the major elevated metabolite, and lactate as the major depleted metabolite in sorted Mx1Cre;Ldha D / D ;Ldhb D / D Lin-Kit+ HSPCs and CD45+ bone marrow cells. The x-axis shows fold change (FC) in Ldha D / D ;Ldhb D / D relative to Ldhafl/fl;Ldhbfl/fl samples. F–G, Glucose-derived pyruvate and lactate production in sorted HSPCs or CD45 + BM cells cultured for 12 hours with 0.5 mM U 13 C-glucose (n = 3–4 experiments). H, Pyruvate and lactate production in sorted Lin - Kit + HSPCs or CD45 + bone marrow cells after LDH/PDH deletion. Cells were cultured ex vivo with 0.2 mM glucose for 12 hours. I–J, PCA plot ( I ) and volcano plot ( J ) of metabolites in BM interstitial fluid (BM-ISF). The x-axis in J shows fold change (FC) in Ldha Δ/Δ ;Ldhb Δ/Δ ;Pdha1 Δ relative to Ldha fl/fl ;Ldhb fl/fl ;Pdha1 fl samples. K, Pyruvate is highly enriched in the BM-ISF after triple deletion and lactate is highly depleted. L, Pyruvate production in sorted Lin - Kit + HSPCs bone marrow cells cultured ex vivo with 1 mM glucose with or without 200 μM palmitate and 5 mM lactate for 12 hours. M, Schematic of BM-ISF metabolomics experiments in mice fed with high fat diet or normal chow for 1 week. N–O, Levels of pyruvate and lactate in N , BM-ISF and O serum after high fat diet or normal chow feeding. All data represent mean ± s.d. Statistical significance was assessed with a Mann-Whitney test ( C -lactate), Welch’s test ( H , K ), or a t-test (rest). All figures show * p<0.05, ** p<0.01, ***p<0.001.

Techniques: Cell Culture, Ex Vivo, Derivative Assay, MANN-WHITNEY

$A, Schematic of glycolysis termination illustrating conditional Ldha:Ldhb:Pdha1:Slc16a1 deletion with Mx1Cre . B–C, MCT1 inhibition with AZD3965 in chimeric transplant recipients reduces the fraction of donor Ldha Δ/Δ ;Ldhb Δ/Δ ;Pdha1 Δ HSCs, progenitors, and mature cells: paired donor chimerism of B myeloid, B cells and C BM HSPCs (n = 10 mice from 3 independent experiments). D–E, Competitive bone marrow transplantation of donor CD45.2 + Mx1Cre;Slc16a1 Δ/Δ , Mx1Cre;Ldha Δ/Δ ;Ldhb Δ/Δ ; Slc16a1 Δ/Δ , or Ldha fl/fl ;Ldhb fl/fl ; Slc16a1 fl/fl littermate control bone marrow cells with wild-type CD45.1;CD45.2 competitor cells to lethally irradiated CD45.1 recipient mice. Shown are donor chimerism in D peripheral blood at weeks 4-16 and E BM HSPCs at week 16 (n = 11–15 mice per genotype for blood; n = 12–15 for BM; three independent experiments). F–G, Competitive transplantation of Mx1Cre;Ldha Δ/Δ ;Ldhb Δ/Δ ; Pdha1 Δ ; Slc16a1 Δ/Δ or littermate control BM cells. Donor contribution to F peripheral blood at weeks 4-16 and G BM HSPCs at week 16 (n = 13 for blood; n = 12–13 for BM; three independent experiments). Data represent mean ± s.d. Statistical significance was assessed with a paired t-test ( B ), one-way ANOVA ( C, D - CD45 + , Myeloid, B cells, E ), a Brown-Forsythe ANOVA test ( D : T cells), t-test ( F – Myeloid cells), Mann-Whitney test ( F- CD45 + , B, T cells) and Welch’s test ( G ). All figures show * p<0.05, ** p<0.01, ***p<0.001.$

Journal: bioRxiv

Article Title: Stem cell function in vivo is supported by an alternative glycolysis endpoint

doi: 10.64898/2026.03.30.715412

Figure Lengend Snippet: A, Schematic of glycolysis termination illustrating conditional Ldha:Ldhb:Pdha1:Slc16a1 deletion with Mx1Cre . B–C, MCT1 inhibition with AZD3965 in chimeric transplant recipients reduces the fraction of donor Ldha Δ/Δ ;Ldhb Δ/Δ ;Pdha1 Δ HSCs, progenitors, and mature cells: paired donor chimerism of B myeloid, B cells and C BM HSPCs (n = 10 mice from 3 independent experiments). D–E, Competitive bone marrow transplantation of donor CD45.2 + Mx1Cre;Slc16a1 Δ/Δ , Mx1Cre;Ldha Δ/Δ ;Ldhb Δ/Δ ; Slc16a1 Δ/Δ , or Ldha fl/fl ;Ldhb fl/fl ; Slc16a1 fl/fl littermate control bone marrow cells with wild-type CD45.1;CD45.2 competitor cells to lethally irradiated CD45.1 recipient mice. Shown are donor chimerism in D peripheral blood at weeks 4-16 and E BM HSPCs at week 16 (n = 11–15 mice per genotype for blood; n = 12–15 for BM; three independent experiments). F–G, Competitive transplantation of Mx1Cre;Ldha Δ/Δ ;Ldhb Δ/Δ ; Pdha1 Δ ; Slc16a1 Δ/Δ or littermate control BM cells. Donor contribution to F peripheral blood at weeks 4-16 and G BM HSPCs at week 16 (n = 13 for blood; n = 12–13 for BM; three independent experiments). Data represent mean ± s.d. Statistical significance was assessed with a paired t-test ( B ), one-way ANOVA ( C, D - CD45 + , Myeloid, B cells, E ), a Brown-Forsythe ANOVA test ( D : T cells), t-test ( F – Myeloid cells), Mann-Whitney test ( F- CD45 + , B, T cells) and Welch’s test ( G ). All figures show * p<0.05, ** p<0.01, ***p<0.001.

Techniques: Inhibition, Transplantation Assay, Control, Irradiation, MANN-WHITNEY

Journal: Cell Reports Medicine

Article Title: SIRT1 mediates brain metabolic and developmental consequences of methionine synthase deficiency in inborn errors of cobalamin metabolism

doi: 10.1016/j.xcrm.2026.102643

Figure Lengend Snippet: Genome-wide DNA methylation alterations in the hippocampus of Mtr -cKO mice (A) Circos plot showing CpG methylation differences between Mtr -cKO and WT hippocampi ( N = 6/group). Red and green dots indicate hyper- and hypomethylated sites; the inner track shows density across the genome. (B) Volcano plot of CpG methylation changes with highlighted significant genes; boxplots display distribution of methylation differences and q values. Threshold: |Δmethylation| ≥ 25%, false discovery rate (FDR) <0.05. (C and D) Pathway enrichment of genes associated with differentially methylated CpGs: (C) GO Biological Process; (D) PANTHER pathways. Dot size indicates gene count, color scale reflects −log 10 (FDR). (E) Volcano plot of DMRs with labeled genes at significant loci. Threshold: |Δmethylation| ≥ 15%, FDR <0.05. (F) GO Biological Process enrichment of genes linked to DMRs. (G) CpG methylation profile of the Pdha1 promoter on chromosome X; red asterisks denote significant CpGs.

Article Snippet: Pdha1 R/F: GTCGGTTCCCAGTCCATCAG/GCACATGACATTTCTGTTGCG , Eurogentec , Angers, France.

Techniques: Genome Wide, DNA Methylation Assay, CpG Methylation Assay, Methylation, Labeling

Pharmacological activation of SIRT1 improves metabolism, epigenetic regulation, and cognition in Mtr -cKO mice (A) Quantification of hippocampal metabolites altered by SRT2104. Statistical significance was assessed using unpaired two-tailed Student’s t test. Data are presented as mean ± SEM. (B) PCA of hippocampal metabolite profiles across WT-vehicle, WT-SRT2104, Mtr -cKO-vehicle, and Mtr -cKO-SRT2104 groups. (C) Quantitative reverse-transcription PCR of metabolic enzymes (Mdh1, Mdh2, Cs, and Pdha1) in hippocampal tissue. (D) Quantification of β-catenin and Rictor protein levels in hippocampal lysates; α-tubulin as loading control. (E) Quantification of NeuN, Olig2, and GFAP proteins in cortical lysates; α-tubulin for NeuN/Olig2 and β-actin for GFAP. (F) Water maze escape success rates across five sessions in WT and Mtr -cKO mice with vehicle or SRT2104 (9–14/group); significance assessed by chi-square test with Yates’ correction. (G) Western blot of H3K4me3 levels in hippocampal lysates; total H3 as loading control. (H) PCA of genome-wide H3K4me3 ChIP-seq profiles across groups. (I) Genome browser tracks of H3K4me3 enrichment at neurogenic gene promoters ( Runx2 , Wnt3 , Wnt10a , and Pax6 ). (J) Quantification of normalized H3K4me3 ChIP-seq signal at selected promoters. Data are presented as mean ± SEM, with individual values shown. Sample sizes correspond to the number of points displayed in each graph. Statistical significance was determined by two-way ANOVA with Tukey’s post hoc test, unless otherwise indicated.

Journal: Cell Reports Medicine

Article Title: SIRT1 mediates brain metabolic and developmental consequences of methionine synthase deficiency in inborn errors of cobalamin metabolism

doi: 10.1016/j.xcrm.2026.102643

Figure Lengend Snippet: Pharmacological activation of SIRT1 improves metabolism, epigenetic regulation, and cognition in Mtr -cKO mice (A) Quantification of hippocampal metabolites altered by SRT2104. Statistical significance was assessed using unpaired two-tailed Student’s t test. Data are presented as mean ± SEM. (B) PCA of hippocampal metabolite profiles across WT-vehicle, WT-SRT2104, Mtr -cKO-vehicle, and Mtr -cKO-SRT2104 groups. (C) Quantitative reverse-transcription PCR of metabolic enzymes (Mdh1, Mdh2, Cs, and Pdha1) in hippocampal tissue. (D) Quantification of β-catenin and Rictor protein levels in hippocampal lysates; α-tubulin as loading control. (E) Quantification of NeuN, Olig2, and GFAP proteins in cortical lysates; α-tubulin for NeuN/Olig2 and β-actin for GFAP. (F) Water maze escape success rates across five sessions in WT and Mtr -cKO mice with vehicle or SRT2104 (9–14/group); significance assessed by chi-square test with Yates’ correction. (G) Western blot of H3K4me3 levels in hippocampal lysates; total H3 as loading control. (H) PCA of genome-wide H3K4me3 ChIP-seq profiles across groups. (I) Genome browser tracks of H3K4me3 enrichment at neurogenic gene promoters ( Runx2 , Wnt3 , Wnt10a , and Pax6 ). (J) Quantification of normalized H3K4me3 ChIP-seq signal at selected promoters. Data are presented as mean ± SEM, with individual values shown. Sample sizes correspond to the number of points displayed in each graph. Statistical significance was determined by two-way ANOVA with Tukey’s post hoc test, unless otherwise indicated.

Article Snippet: Pdha1 R/F: GTCGGTTCCCAGTCCATCAG/GCACATGACATTTCTGTTGCG , Eurogentec , Angers, France.

Techniques: Activation Assay, Two Tailed Test, Reverse Transcription, Control, Western Blot, Genome Wide, ChIP-sequencing

Metabolic Dysfunction-Associated Impairment of Mitochondrial Anaplerotic Capacity in ACLF. (A) Hepatic ATP levels in LC/fibrosis and ACLF samples. (B) Western blot analysis reveals protein levels of COX IV in liver tissues from human LC and ACLF patients and from mouse fibrosis and ACLF models. (C) RNA sequencing analysis of key metabolic genes ( CPT1A/Cpt1a , GLUD1/Glud1 , PDHA1/Pdha1 ) in human (HC, LC, ACLF) and mouse (HC, fibrosis, ACLF) liver samples. (D) Western blot of CPT1A, GLUD1, and PDHA1 protein expression in human and mouse liver tissues. (E) Kaplan-Meier survival curves of ACLF mice treated with PBS or the mitochondrial antioxidant MitoQ. (F) Serum ALT and TBIL levels in ACLF mice following treatment with PBS or MitoQ. Bars represent mean ± SD; ****P < 0.0001, ***P < 0.001, **P < 0.01, *P < 0. 05, n.s., no significance; ALT, alanine aminotransferase; TBIL, total bilirubin.

Journal: Frontiers in Immunology

Article Title: Cross-species hepatic transcriptomics identify conserved immune-metabolic reprogramming in acute-on-chronic liver failure progression

doi: 10.3389/fimmu.2026.1702689

Figure Lengend Snippet: Metabolic Dysfunction-Associated Impairment of Mitochondrial Anaplerotic Capacity in ACLF. (A) Hepatic ATP levels in LC/fibrosis and ACLF samples. (B) Western blot analysis reveals protein levels of COX IV in liver tissues from human LC and ACLF patients and from mouse fibrosis and ACLF models. (C) RNA sequencing analysis of key metabolic genes ( CPT1A/Cpt1a , GLUD1/Glud1 , PDHA1/Pdha1 ) in human (HC, LC, ACLF) and mouse (HC, fibrosis, ACLF) liver samples. (D) Western blot of CPT1A, GLUD1, and PDHA1 protein expression in human and mouse liver tissues. (E) Kaplan-Meier survival curves of ACLF mice treated with PBS or the mitochondrial antioxidant MitoQ. (F) Serum ALT and TBIL levels in ACLF mice following treatment with PBS or MitoQ. Bars represent mean ± SD; ****P < 0.0001, ***P < 0.001, **P < 0.01, *P < 0. 05, n.s., no significance; ALT, alanine aminotransferase; TBIL, total bilirubin.

Article Snippet: Primary antibodies used are listed in antibodies section of . Primary antibodies used included: COX IV (Cell Signaling Technology, #4850), CPT1A (Abcam, #ab128568), GLUD1 (Cell Signaling Technology, #12793), PDHA1 (Cell Signaling Technology, #3205), TREM2 (Cell Signaling Technology, #55739), and CCR2 (Affinity Biosciences, #DF2711).

Techniques: Western Blot, RNA Sequencing, Expressing

Journal: Cell Death & Disease

Article Title: PDHA1–acetylation signaling suppresses cuproptosis to attenuate anti-androgen effect in prostate cancer

doi: 10.1038/s41419-026-08462-1

Figure Lengend Snippet: A Venn diagram of copper-induced cell death-related gene sets from Enz-resistant prostate cancer datasets ( GSE150809 , GSE163240 , GSE169305 ). B PDHA1 expression levels in Enz-resistant prostate cancer datasets ( GSE150809 , GSE163240 , GSE169305 ). C Representative IHC images of PDHA1 in Enz-resistant and Enz-sensitive PCa tissues (scale bar: 100 μm). D Kaplan-Meier survival curves showing overall survival (OS) and recurrence-free survival (RFS) of prostate cancer patients with high versus low PDHA1 expression in the TCGA cohort. E Images showing PDHA1 expression levels in a prostate cancer tissue microarray (TMA). F H-score of PDHA1 expression in cancerous versus adjacent normal tissues from the prostate cancer TMA. G Kaplan-Meier survival curves showing overall survival (OS) and disease-free survival (DFS) in prostate cancer patients with high versus low PDHA1 expression in the TMA cohort. H H-score of PDHA1 expression in prostate cancer tissues with different Gleason scores from the TMA. I , J PDHA1 mRNA ( I ) and protein ( J ) levels in normal prostate cells and PCa cell lines. K–N Changes in PDHA1 mRNA ( K , L ) and protein ( M , N ) levels in PCa cells after treatment with varying concentrations of Enz. Statistical significance was determined by two-tailed unpaired t-test ( B , C , F ) and one-way ANOVA followed by Tukey’s multiple comparison test ( H–L , N ). B , C , F , H – L , N Data are presented as mean ± SD. Representative data of triplicate experiments are shown. (* P < 0.05, ** P < 0.01, *** P < 0.001).

Article Snippet: The following antibodies were used: Lipoic Acid (Abcam, catalog no. ab58724), HSP70 (Proteintech, catalog no. 10995-1-AP), LIAS (Proteintech, catalog no. 11577-1-AP), FDX1 (Proteintech, catalog no. 12592-1-AP), DLAT (Proteintech, catalog no. 13426-1-AP), PDHA1 (Proteintech, catalog no. 18068-1-AP), p-PDHA1 (Proteintech, catalog no. 29582-1-AP), α-Tubulin (Proteintech, catalog no. 11224-1-AP), H3 (Proteintech, catalog no. 17168-1-AP), and H3K27ac (Abclonal, catalog no. A7253).

Techniques: Expressing, Microarray, Two Tailed Test, Comparison

Journal: Cell Death & Disease

Article Title: PDHA1–acetylation signaling suppresses cuproptosis to attenuate anti-androgen effect in prostate cancer

doi: 10.1038/s41419-026-08462-1

Figure Lengend Snippet: A , B CCK8 assay was used to assess cell viability in control and PDHA1 knockdown PCa cells ( A ), as well as wild-type (WT) and PDHA1 overexpression PCa cells ( B ) after treatment with Enz at the specified concentrations. C , D CCK8 assay was used to assess cell viability in control and PDHA1 knockdown PCa cells ( C ), as well as WT and PDHA1 overexpression PCa cells ( D ) after treatment with ES at the specified concentrations. E CCK8 assay was used to assess cell viability in control and PDHA1 knockdown PCa cells after treatment with TTM (5 μM) and Enz (20 μM), either alone or in combination. F CCK8 assay was used to assess cell viability in control and PDHA1 knockdown PCa cells after treatment with TTM (5 μM) and ES (2 nM), either alone or in combination. G The intracellular copper (II) ion concentration was measured after PCa cells were treated with TTM (5 μM) and Enz (20 μM), either alone or in combination. H The intracellular copper (II) ion concentration was measured after PCa cells were treated with TTM (5 μM) and ES (2 nM), either alone or in combination. I , J Protein levels of HSP70, LIAS, and FDX1 were evaluated in WT and PDHA1 overexpression PCa cells after treatment with Enz (20 μM) ( I ) or ES (2 nM) ( J ). Tubulin was used as a loading control. Statistical significance was determined by two-tailed unpaired t-test ( A–D ) and one-way ANOVA followed by Tukey’s multiple comparison test ( E–H ). A–D , E–H Data are presented as mean ± SD. Representative data of triplicate experiments are shown. (* P < 0.05, ** P < 0.01, *** P < 0.001).

Techniques: CCK-8 Assay, Control, Knockdown, Over Expression, Concentration Assay, Two Tailed Test, Comparison

Journal: Cell Death & Disease

Article Title: PDHA1–acetylation signaling suppresses cuproptosis to attenuate anti-androgen effect in prostate cancer

doi: 10.1038/s41419-026-08462-1

Figure Lengend Snippet: A Schematic illustration of the 22Rv1 xenograft model with control and PDHA1 knockdown groups treated with Enz (20 mg/kg, intraperitoneally, every 3 days), created using Biorender. B PDHA1 knockdown in nude mice sensitized PCa cells to Enz, as shown by the representative tumor images. C Tumor growth curves were recorded every three days (mean ± SD, n = 5 per group). D Tumor tissues were weighed, and data were summarized. E Representative H&E and IHC staining of indicated proteins in tumor tissues from each group. Scale bar, 100 μm. H-score for PDHA1 ( F ), Ki67 ( G ), and LIAS ( H ) in the specified groups. Statistical significance was determined by one-way ANOVA followed by Tukey’s multiple comparison test ( D , F–H ). D , F–H Data are presented as mean ± SD. Representative data of five replicate experiments are shown. (* P < 0.05, ** P < 0.01, *** P < 0.001).

Techniques: Control, Knockdown, Immunohistochemistry, Comparison

Journal: Cell Death & Disease

Article Title: PDHA1–acetylation signaling suppresses cuproptosis to attenuate anti-androgen effect in prostate cancer

doi: 10.1038/s41419-026-08462-1

Figure Lengend Snippet: A Heatmap showing Z-score normalized analysis of metabolites, highlighting shared changes in glutamine and cysteine metabolism intermediates. B Cysteine levels in control and PDHA1 knockdown cells were measured using a cysteine detection kit. C , D Intracellular GSH levels in control and PDHA1 knockdown cells were analyzed using flow cytometry. E Intracellular copper (II) ion levels in control and PDHA1 knockdown cells were measured with or without the presence of GSH (10 μM). F Changes in HSP70, LIAS, and FDX1 protein levels in control and PDHA1 knockdown cells were evaluated with or without GSH (10 μM). Tubulin was used as a loading control. G qRT-PCR analysis of mRNA expression of cysteine transporters (SLC1A1, SLC1A5, SLC7A5, SLC7A11) in control and PDHA1 knockdown cells. H Western blot analysis of SLC7A11 protein expression in control and PDHA1 knockdown cells. I Changes in HSP70, LIAS, and FDX1 protein levels in wild-type (WT) and SLC7A11-overexpressing cells, with or without Enz (20 μM). Tubulin was used as a loading control. J Cell viability after 48 h treatment with Enz (40 μM) with or without GSH (10 μM). Statistical significance was determined by one-way ANOVA followed by Tukey’s multiple comparison test ( B–E , G , J ). B–E , G , J Data are presented as mean ± SD. Representative data of triplicate experiments are shown. (* P < 0.05, ** P < 0.01, *** P < 0.001).

Techniques: Control, Knockdown, Flow Cytometry, Quantitative RT-PCR, Expressing, Western Blot, Comparison

Journal: Cell Death & Disease

Article Title: PDHA1–acetylation signaling suppresses cuproptosis to attenuate anti-androgen effect in prostate cancer

doi: 10.1038/s41419-026-08462-1

Figure Lengend Snippet: A Measurement of acetyl-CoA levels in control and PDHA1 knockdown cells using an acetyl-CoA detection kit. B Measurement of acetyl-CoA levels in wild-type and PDHA1-overexpressing cells using the same detection kit. C Analysis of global acetylation levels in wild-type and PDHA1-overexpressing cells using a pan-acetylation antibody. D Western blot analysis of target protein levels in wild-type and PDHA1-overexpressing cells after treatment with or without JQAD1 (1 μM) for 24 h. E ChIP-seq analysis using H3K27ac antibody to assess acetylation at transcription start sites in wild-type and PDHA1-overexpressing cells. The plot shows normalized ChIP H3K27ac signal enrichment. F Analysis of enhancers and super-enhancers in wild-type and PDHA1-overexpressing cells using the modified ROSE algorithm. G UCSC Genome Browser screenshot showing H3K27ac ChIP-seq peaks at the SLC7A11 locus in wild-type and PDHA1-overexpressing cells. H ChIP-qPCR analysis of wild-type and PDHA1-overexpressing cells using IgG and H3K27ac antibodies. Statistical significance was determined by two-tailed unpaired t-test ( B ) and one-way ANOVA followed by Tukey’s multiple comparison test ( A , H ). B , A , H Data are presented as mean ± SD. Representative data of triplicate experiments are shown. (* P < 0.05, ** P < 0.01, *** P < 0.001).

Techniques: Control, Knockdown, Western Blot, ChIP-sequencing, Modification, ChIP-qPCR, Two Tailed Test, Comparison

Review

pdha1 (Proteintech)

Structured Review

Images

1) Product Images from "PDHA1–acetylation signaling suppresses cuproptosis to attenuate anti-androgen effect in prostate cancer"

Related Articles

Western Blot:

other:

Incubation:

Saline:

Similar Products

Image Search Results