pb1189 (ATCC)
ATCC is a verified supplier 
ATCC manufactures this product 
90
Structured Review
ATCC
pb1189
Pb1189, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pb1189/pLDR8/us10487334-428-34-41
Average 90 stars, based on 6 article reviews
Pb1189, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pb1189/pLDR8/us10487334-428-34-41
Average 90 stars, based on 6 article reviews
pb1189 - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: Antibiotic-free plasmid Article Snippet: The DNA fragment corresponding to the P1 weak promoter was obtained by PCR using primers PB1186 (SEQ ID NO:35) (TCATACCAGGCCTAGGTGATACGCCTATTTTTATAGGTTAATG) and PB1187 (SEQ ID NO:36) (AACACCCCTTGTATTACTGTTTATG), using pLL14 (see Merial patent application US2005/0164946) as a template and Phusion DNA polymerase. .. The DNA fragment corresponding to the cI gene (SEQ ID NO:1) was obtained by PCR using primers PB1188 (SEQ ID NO:37) (AATACAAGGGGTGTTATGAGCACAAAAAAGAAACCATTAACAC) [containing a complementary region of P1 sequence at 5′ end (underlined)] and Article Title: Antibiotic-free plasmids Article Snippet: The DNA fragment corresponding to the P1 weak promoter was obtained by PCR using primers PB1186 (SEQ ID NO:35) (TCATACCAGGCCTAGGTGATACGCCTATTTTTATAGGTTAATG) and PB1187 (SEQ ID NO:36) (AACACCCCTTGTATTACTGTTTATG), using pLL14 (see Merial patent application US2005/0164946) as a template and Phusion DNA polymerase. .. The DNA fragment corresponding to the cI gene (SEQ ID NO:1) was obtained by PCR using primers PB1188 (SEQ ID NO:37) (AATACAAGGGGTGTTATGAGCACAAAAAAGAAACCATTAACAC) [containing a complementary region of Plsequence at 5′ end (underlined)] and Sequencing:Article Title: Antibiotic-free plasmid Article Snippet: The DNA fragment corresponding to the P1 weak promoter was obtained by PCR using primers PB1186 (SEQ ID NO:35) (TCATACCAGGCCTAGGTGATACGCCTATTTTTATAGGTTAATG) and PB1187 (SEQ ID NO:36) (AACACCCCTTGTATTACTGTTTATG), using pLL14 (see Merial patent application US2005/0164946) as a template and Phusion DNA polymerase. .. The DNA fragment corresponding to the cI gene (SEQ ID NO:1) was obtained by PCR using primers PB1188 (SEQ ID NO:37) (AATACAAGGGGTGTTATGAGCACAAAAAAGAAACCATTAACAC) [containing a complementary region of P1 sequence at 5′ end (underlined)] and |