Structured Review

Promega mgcl2
Mgcl2, supplied by Promega, used in various techniques. Bioz Stars score: 98/100, based on 1270 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mgcl2/product/Promega
Average 98 stars, based on 1270 article reviews
Price from $9.99 to $1999.99
mgcl2 - by Bioz Stars, 2020-01
98/100 stars

Images

Related Articles

Clone Assay:

Article Title: Genetic Diversity of a Natural Population of Apple stem pitting virus Isolated from Apple in Korea
Article Snippet: Complementary DNA (cDNA) synthesis was performed as follows: a mixture of 10 ng of RNA in 9 μl of nuclease-free water with 1 μl of 10 pM reverse primer was heated at 70°C for 5 min, followed by the addition of 4 μl of 5X reaction buffer, 2.5 mM MgCl2 , 0.25 mM each dNTP, 1 μl of ImProm II reverse transcriptase (Promega, Madison, WI, USA), and 1 μl of RNase inhibitor (1 U/μl), with incubation at 37°C for 1 h. PCR amplification was performed in a 50-μl volume containing 20 μl of cDNA solution, 0.2 mM each dNTP, 2 mM MgCl2 , 1 μl of 10 pM each primer, 2.5 U of DNA polymerase (Promega), and 1X PCR buffer. .. The PCR-amplified CP gene was cloned using pGEM-T easy (Promega) according to the manufacturer’s instructions.

Amplification:

Article Title: Molecular Characterization of Clostridium botulinum Isolates from Foodborne Outbreaks in Thailand, 2010
Article Snippet: Internal DNA oligomers were also designed within each amplicon for confirmatory sequence analysis in both directions. .. PCR was performed in a 50 µl reaction containing 1 ng of extracted DNA, 0.5 µM of each primer, 2.5 mM of MgCl2 , 200 µM of each dNTP, 5× Buffer and 2.5 U of GoTaq ® DNA polymerase and 1.5 mM of MgCl2 (Promega).

Article Title: Genetic Diversity of a Natural Population of Apple stem pitting virus Isolated from Apple in Korea
Article Snippet: .. Complementary DNA (cDNA) synthesis was performed as follows: a mixture of 10 ng of RNA in 9 μl of nuclease-free water with 1 μl of 10 pM reverse primer was heated at 70°C for 5 min, followed by the addition of 4 μl of 5X reaction buffer, 2.5 mM MgCl2 , 0.25 mM each dNTP, 1 μl of ImProm II reverse transcriptase (Promega, Madison, WI, USA), and 1 μl of RNase inhibitor (1 U/μl), with incubation at 37°C for 1 h. PCR amplification was performed in a 50-μl volume containing 20 μl of cDNA solution, 0.2 mM each dNTP, 2 mM MgCl2 , 1 μl of 10 pM each primer, 2.5 U of DNA polymerase (Promega), and 1X PCR buffer. .. A total of 40 cycles were conducted in a PTC-0220 Perlitier Thermal Cycler (MJ Research, Waltham, MA, USA).

Article Title: Macrophage migration inhibitory factor counter-regulates dexamethasone-induced annexin 1 expression and influences the release of eicosanoids in murine macrophages
Article Snippet: Then, 3 μl of the double-strand product was mixed with 10 × Taq /RT buffer [1 × Taq /RT buffer: 10 mmol/l Tris–HCl (pH 8·3), 50 mmol/l KCl, 1·5 mmol/l MgCl2 , 0·01% gelatine and 2·0 mmol/l dithiothreitol], 500 μmol/l deoxyoligonucleoside triphosphate mix, 25 mmol/l MgCl2 , 500 μmol/l of each sense and antisense oligonucleotide, and 0·25 μl Taq polymerase (Promega, Madison, WI). .. The PCR primers for amplification of mouse MIF and β-actin were as follows: MIF (341 bp), sense primer 5′-ACACCAATGTTCCCCGC-3′, and antisense primer 5′-AAGCGAAGGTGGAACCGT-3′; β-actin (211 bp), sense primer 5′-CCTCTATGCCAACACAGTGC-3′, and antisense primer 5′-GTACTCCTGCTTGCTGATGC-3′.

Polymerase Chain Reaction:

Article Title: Molecular Characterization of Clostridium botulinum Isolates from Foodborne Outbreaks in Thailand, 2010
Article Snippet: .. PCR was performed in a 50 µl reaction containing 1 ng of extracted DNA, 0.5 µM of each primer, 2.5 mM of MgCl2 , 200 µM of each dNTP, 5× Buffer and 2.5 U of GoTaq ® DNA polymerase and 1.5 mM of MgCl2 (Promega). .. Each PCR cycle consisted of denaturation at 94°C for 1 min, 55°C for 1 min, 72°C for 1 min and was repeated 30 times.

Article Title: Genetic Diversity of a Natural Population of Apple stem pitting virus Isolated from Apple in Korea
Article Snippet: .. Complementary DNA (cDNA) synthesis was performed as follows: a mixture of 10 ng of RNA in 9 μl of nuclease-free water with 1 μl of 10 pM reverse primer was heated at 70°C for 5 min, followed by the addition of 4 μl of 5X reaction buffer, 2.5 mM MgCl2 , 0.25 mM each dNTP, 1 μl of ImProm II reverse transcriptase (Promega, Madison, WI, USA), and 1 μl of RNase inhibitor (1 U/μl), with incubation at 37°C for 1 h. PCR amplification was performed in a 50-μl volume containing 20 μl of cDNA solution, 0.2 mM each dNTP, 2 mM MgCl2 , 1 μl of 10 pM each primer, 2.5 U of DNA polymerase (Promega), and 1X PCR buffer. .. A total of 40 cycles were conducted in a PTC-0220 Perlitier Thermal Cycler (MJ Research, Waltham, MA, USA).

Article Title: Macrophage migration inhibitory factor counter-regulates dexamethasone-induced annexin 1 expression and influences the release of eicosanoids in murine macrophages
Article Snippet: Then, 3 μl of the double-strand product was mixed with 10 × Taq /RT buffer [1 × Taq /RT buffer: 10 mmol/l Tris–HCl (pH 8·3), 50 mmol/l KCl, 1·5 mmol/l MgCl2 , 0·01% gelatine and 2·0 mmol/l dithiothreitol], 500 μmol/l deoxyoligonucleoside triphosphate mix, 25 mmol/l MgCl2 , 500 μmol/l of each sense and antisense oligonucleotide, and 0·25 μl Taq polymerase (Promega, Madison, WI). .. The PCR primers for amplification of mouse MIF and β-actin were as follows: MIF (341 bp), sense primer 5′-ACACCAATGTTCCCCGC-3′, and antisense primer 5′-AAGCGAAGGTGGAACCGT-3′; β-actin (211 bp), sense primer 5′-CCTCTATGCCAACACAGTGC-3′, and antisense primer 5′-GTACTCCTGCTTGCTGATGC-3′.

TA Cloning:

Article Title: Purification of L1-ribonucleoprotein particles (L1-RNPs) from cultured human cells
Article Snippet: .. 1X Dulbecco’s Phosphate-Buffered Saline (DPBS) (2.67 mM KCl, 1.47 mM KH2 PO4 ,138 mM NaCl, 8.06 mM NaH2 PO4 -7H2 0) DNaseI recombinant, RNase-free (Roche; Cat # 04716728001) Anti-FLAG agarose beads wash buffer [100mM KCl, 5mM MgCl2 , 10 mM HEPES (pH-7.0)] Cell lysis buffer [100mM KCl, 5mM MgCl2 , 10 mM HEPES (pH-7.0), 0.5% NP-40, 0.5mM DTT] Wash buffer 1 [25 mM HEPES (pH-7.0) 250 mM KCl, 5mM MgCl2, 0.1% NP-40] Wash buffer 2 [25 mM HEPES,(pH-7.0), 100 mM KCl, 5mM MgCl2 , 0.1% NP-40] Go Taq green master mix (Promega), DIG RNA labeling mix (Roche) 1X Glyoxal RNA loading buffer (Ambion) 10X DNA gel loading buffer (Invitrogen; Cat # 10816-015) Topo TA cloning Kit (Invitrogen; Cat # K4550-01) RNP elution buffer (wash buffer 2 containing 150 μg/ml 3X FLAG peptide). .. BGH-SP6rev: 5′- ATTTAGGTGACACTATAGAC TCATTTTATTAGGAAAGGACAG-3′ BGHfwd: 5′-ATCTCAGAAGAGGATCTGAATATGC-3′ (Bold sequences denote SP6 promoter primer sequence).

Blocking Assay:

Article Title: Purification of L1-ribonucleoprotein particles (L1-RNPs) from cultured human cells
Article Snippet: West Pico Chemiluminescent Substrate (Thermo Scientific, Cat # 34080) X-ray film X-ray film developing reagent Primary antibody to detect ORF2p ( ) Anti-FLAG antibody (Sigma; Cat# F1804) Secondary antibody; ECL Rabbit IgG, HRP-Linked Whole Ab (from donkey) (GE healthcare; Cat # NA934) Secondary antibody; ECL Mouse IgG, HRP-Linked Whole Ab (from sheep), (GE healthcare; Cat # NA931) Anti-N terminus L1 ORF2p antibody ( ) SP6 RNA polymerase (Roche) NorthernMax Gly Sample Loading Dye(Ambion; Cat # AM8551) Northern Max Gly Kit (Ambion; Cat # AM-1946) Nylon membrane, positively charged (Roche; Cat #11209299001) DIG Easy Hyb Granules (Roche; Cat # 11796895001) DIG RNA labeling mix (Roche; Cat # 11277073910) DIG wash and block buffer set (Roche; Cat # 11585762001) Anti-DIG -AP, Fab fragments (Roche; Cat # 11093274910) CDP-Star ready to use (Roche; Cat# 12041677001). .. 1X Dulbecco’s Phosphate-Buffered Saline (DPBS) (2.67 mM KCl, 1.47 mM KH2 PO4 ,138 mM NaCl, 8.06 mM NaH2 PO4 -7H2 0) DNaseI recombinant, RNase-free (Roche; Cat # 04716728001) Anti-FLAG agarose beads wash buffer [100mM KCl, 5mM MgCl2 , 10 mM HEPES (pH-7.0)] Cell lysis buffer [100mM KCl, 5mM MgCl2 , 10 mM HEPES (pH-7.0), 0.5% NP-40, 0.5mM DTT] Wash buffer 1 [25 mM HEPES (pH-7.0) 250 mM KCl, 5mM MgCl2, 0.1% NP-40] Wash buffer 2 [25 mM HEPES,(pH-7.0), 100 mM KCl, 5mM MgCl2 , 0.1% NP-40] Go Taq green master mix (Promega), DIG RNA labeling mix (Roche) 1X Glyoxal RNA loading buffer (Ambion) 10X DNA gel loading buffer (Invitrogen; Cat # 10816-015) Topo TA cloning Kit (Invitrogen; Cat # K4550-01) RNP elution buffer (wash buffer 2 containing 150 μg/ml 3X FLAG peptide).

Incubation:

Article Title: Structural visualization of key steps in human transcription initiation
Article Snippet: .. An arrested Pol II on the open promoter nucleic acid scaffold was first prepared by incubation at 28°C for 1 h of Pol II and DNA (template2-nontemplate3) at final concentrations of 300 nM and 80 nM, respectively, in the arresting buffer containing 12 mM HEPES, pH 7.9, 0.12 mM EDTA, 12% glycerol, 8.25 mM MgCl2 , 60 mM KCl, 1 mM DTT, 0.05% NP-40, 2.5 ng/µl dI-dC, 1:100 dilution of RNasin Ribonuclease inhibitor (Promega), and 2 mM CTP. .. The following purified proteins and nucleic acid were sequentially added into the arrested Pol II reaction above: nontemplate2, TBP/TFIIA, TFIIB, TFIIF, and TFIIE at final concentrations of 200 nM, 370 nM, 3.6 µM, 289 nM, and 370 nM, respectively.

Article Title: Crystal structure of the RNA-dependent RNA polymerase from influenza C virus
Article Snippet: .. For the cap-dependent cleavage and transcription assays, FluPolC (400 ng per reaction) was incubated for 2 h at 30 °C with or without (as indicated) NTPs (1 mM ATP, 0.5 mM each CTP/UTP/GTP), radiolabelled capped 20-nucleotide or 11-nucleotide RNAs, 0.6 μM each 5′ and 3′ vRNA promoter strands, in a reaction buffer containing 7.5 mM MgCl2 , 1.0 mM TCEP, 2 U μl−1 RNasin (Promega), 20 mM HEPES-NaOH, pH 7.5, 100 mM NaCl and 5% (v/v) glycerol. .. For the de novo initiation and elongation assays, FluPolC (400 or 800 ng per reaction, as indicated) was incubated for 2–3 h at 30 °C with 2.5 mM adenosine and 0.075 μM [α-32 P]GTP or 1 mM ATP, 0.5 mM each CTP/UTP, 0.1 mM GTP, 0.3 μM [α-32 P]GTP and (as indicated) 0.6 μM each 5′ or 3′ vRNA promoter strands, in the same reaction buffer as above.

Article Title: tRNA Translocation by the Eukaryotic 80S Ribosome and the Impact of GTP Hydrolysis
Article Snippet: Acetyl-[14 C]tRNAVal was obtained by incubation of 150 μg deacylated tRNAVal in 400 μl containing 30 mM HEPES pH 7.6, 100 mM KCl, 5 mM MgCl2 , 3 mM ATP, 1 U/μl RNasin® Plus (Promega), 1 mM DTT, 60 μM [14 C]Val, 600 dpm/pmol (PekinElmer) and 5 A280 /ml ARSases for 15 min at 37°C. .. Deacylation was performed in 400 μl containing 30 mM HEPES pH 7.6, 100 mM KCl, 5 mM MgCl2 , 1 U/ml RNasin Plus (Promega), 1 mM DTT, 5 A280 /μ®l total aminoacyl-tRNA synthetases, 6 mM AMP and 6 mM pyrophosphate (PPi ) for 5 min at 30°C.

Article Title: Genetic Diversity of a Natural Population of Apple stem pitting virus Isolated from Apple in Korea
Article Snippet: .. Complementary DNA (cDNA) synthesis was performed as follows: a mixture of 10 ng of RNA in 9 μl of nuclease-free water with 1 μl of 10 pM reverse primer was heated at 70°C for 5 min, followed by the addition of 4 μl of 5X reaction buffer, 2.5 mM MgCl2 , 0.25 mM each dNTP, 1 μl of ImProm II reverse transcriptase (Promega, Madison, WI, USA), and 1 μl of RNase inhibitor (1 U/μl), with incubation at 37°C for 1 h. PCR amplification was performed in a 50-μl volume containing 20 μl of cDNA solution, 0.2 mM each dNTP, 2 mM MgCl2 , 1 μl of 10 pM each primer, 2.5 U of DNA polymerase (Promega), and 1X PCR buffer. .. A total of 40 cycles were conducted in a PTC-0220 Perlitier Thermal Cycler (MJ Research, Waltham, MA, USA).

Article Title: A role for the Perlman syndrome exonuclease Dis3l2 in the Lin28-let-7 pathway
Article Snippet: Affinity pull-down assays For RNA affinity pull-down, synthetic mmu-pre-let-7a-1 or mmu-pre-let-7a-1+14U was conjugated to adipic acid dihydrazide agarose beads and incubated with whole-cell extract from P19 cells . .. For affinity purification of Flag-Lin28A, KH2 ESCs were treated with Dox at 6 μg/ml for 48 hours and then harvested in the lysis buffer (20 mM Tris-HCl, pH 8.0, 137 mM NaCl, 1 mM EDTA, 1% (v/v) Triton X-100, 10% (v/v) Glycerol, 1.5 mM MgCl2 , 1 mM DTT, 0.2 mM PMSF) supplemented with 40 units/ml of RNase inhibitor (rRNasin, Promega).

Activity Assay:

Article Title: Crystal structure of the RNA-dependent RNA polymerase from influenza C virus
Article Snippet: Paragraph title: Polymerase activity assays ... For the cap-dependent cleavage and transcription assays, FluPolC (400 ng per reaction) was incubated for 2 h at 30 °C with or without (as indicated) NTPs (1 mM ATP, 0.5 mM each CTP/UTP/GTP), radiolabelled capped 20-nucleotide or 11-nucleotide RNAs, 0.6 μM each 5′ and 3′ vRNA promoter strands, in a reaction buffer containing 7.5 mM MgCl2 , 1.0 mM TCEP, 2 U μl−1 RNasin (Promega), 20 mM HEPES-NaOH, pH 7.5, 100 mM NaCl and 5% (v/v) glycerol.

Expressing:

Article Title: The Etiology of Cleft Palate Formation in BMP7-Deficient Mice
Article Snippet: LacZ staining of embryonic tissues or sections Tissues from heterozygous Bmp7lacZ (Bmp7wt/lacZ ) embryos (expressing β-galactosidase under the control of the Bmp7 promoter) were stained with X-gal to identify the location of Bmp7 expression. .. Briefly, tissue fragments or OCT (BDH)-embedded palate sections were fixed in 2% formaldehyde, 0.2% glutaraldehyde, 0.01% sodium deoxycholate, 0.02% Nonidet-P40 (NP40) in PBS for 5 min, washed with 2 mM MgCl2 , and stained at 37°C in the dark overnight in X-gal staining solution, which contained 0.1 M phosphate pH 7.3, 2 mM MgCl2 , 0.01% sodium deoxycholate, 0.02% NP40, 5 mM K3 [Fe(CN)6 ], 5 mM K4 [Fe(CN)6 ] supplemented with 1 mg X-Gal (Promega)/ml.

Western Blot:

Article Title: Purification of L1-ribonucleoprotein particles (L1-RNPs) from cultured human cells
Article Snippet: Paragraph title: 3.3. Reagents for Immunoprecipitation, Western blotting and Northern blotting ... 1X Dulbecco’s Phosphate-Buffered Saline (DPBS) (2.67 mM KCl, 1.47 mM KH2 PO4 ,138 mM NaCl, 8.06 mM NaH2 PO4 -7H2 0) DNaseI recombinant, RNase-free (Roche; Cat # 04716728001) Anti-FLAG agarose beads wash buffer [100mM KCl, 5mM MgCl2 , 10 mM HEPES (pH-7.0)] Cell lysis buffer [100mM KCl, 5mM MgCl2 , 10 mM HEPES (pH-7.0), 0.5% NP-40, 0.5mM DTT] Wash buffer 1 [25 mM HEPES (pH-7.0) 250 mM KCl, 5mM MgCl2, 0.1% NP-40] Wash buffer 2 [25 mM HEPES,(pH-7.0), 100 mM KCl, 5mM MgCl2 , 0.1% NP-40] Go Taq green master mix (Promega), DIG RNA labeling mix (Roche) 1X Glyoxal RNA loading buffer (Ambion) 10X DNA gel loading buffer (Invitrogen; Cat # 10816-015) Topo TA cloning Kit (Invitrogen; Cat # K4550-01) RNP elution buffer (wash buffer 2 containing 150 μg/ml 3X FLAG peptide).

High Performance Liquid Chromatography:

Article Title: tRNA Translocation by the Eukaryotic 80S Ribosome and the Impact of GTP Hydrolysis
Article Snippet: Deacylation was performed in 400 μl containing 30 mM HEPES pH 7.6, 100 mM KCl, 5 mM MgCl2 , 1 U/ml RNasin Plus (Promega), 1 mM DTT, 5 A280 /μ®l total aminoacyl-tRNA synthetases, 6 mM AMP and 6 mM pyrophosphate (PPi ) for 5 min at 30°C. .. After another round of phenol/chloroform/isoamyl alcohol extraction N-acetyl-[14 C]Val-tRNAVal was purified by reversed-phase HPLC on a Nucleosil 300–7 C8 HPLC column (Knauer) using a methanol gradient as described ( ).

TCA Precipitation:

Article Title: tRNA Translocation by the Eukaryotic 80S Ribosome and the Impact of GTP Hydrolysis
Article Snippet: The amount of aminoacylated tRNA was determined by cold TCA precipitation after 15 min incubation at 37°C. .. Deacylation was performed in 400 μl containing 30 mM HEPES pH 7.6, 100 mM KCl, 5 mM MgCl2 , 1 U/ml RNasin Plus (Promega), 1 mM DTT, 5 A280 /μ®l total aminoacyl-tRNA synthetases, 6 mM AMP and 6 mM pyrophosphate (PPi ) for 5 min at 30°C.

Ligation:

Article Title: Genetic Diversity of a Natural Population of Apple stem pitting virus Isolated from Apple in Korea
Article Snippet: Complementary DNA (cDNA) synthesis was performed as follows: a mixture of 10 ng of RNA in 9 μl of nuclease-free water with 1 μl of 10 pM reverse primer was heated at 70°C for 5 min, followed by the addition of 4 μl of 5X reaction buffer, 2.5 mM MgCl2 , 0.25 mM each dNTP, 1 μl of ImProm II reverse transcriptase (Promega, Madison, WI, USA), and 1 μl of RNase inhibitor (1 U/μl), with incubation at 37°C for 1 h. PCR amplification was performed in a 50-μl volume containing 20 μl of cDNA solution, 0.2 mM each dNTP, 2 mM MgCl2 , 1 μl of 10 pM each primer, 2.5 U of DNA polymerase (Promega), and 1X PCR buffer. .. The ligation mixture was used to transform competent Escherichia coli JM 109 cells.

Northern Blot:

Article Title: Purification of L1-ribonucleoprotein particles (L1-RNPs) from cultured human cells
Article Snippet: Paragraph title: 3.3. Reagents for Immunoprecipitation, Western blotting and Northern blotting ... 1X Dulbecco’s Phosphate-Buffered Saline (DPBS) (2.67 mM KCl, 1.47 mM KH2 PO4 ,138 mM NaCl, 8.06 mM NaH2 PO4 -7H2 0) DNaseI recombinant, RNase-free (Roche; Cat # 04716728001) Anti-FLAG agarose beads wash buffer [100mM KCl, 5mM MgCl2 , 10 mM HEPES (pH-7.0)] Cell lysis buffer [100mM KCl, 5mM MgCl2 , 10 mM HEPES (pH-7.0), 0.5% NP-40, 0.5mM DTT] Wash buffer 1 [25 mM HEPES (pH-7.0) 250 mM KCl, 5mM MgCl2, 0.1% NP-40] Wash buffer 2 [25 mM HEPES,(pH-7.0), 100 mM KCl, 5mM MgCl2 , 0.1% NP-40] Go Taq green master mix (Promega), DIG RNA labeling mix (Roche) 1X Glyoxal RNA loading buffer (Ambion) 10X DNA gel loading buffer (Invitrogen; Cat # 10816-015) Topo TA cloning Kit (Invitrogen; Cat # K4550-01) RNP elution buffer (wash buffer 2 containing 150 μg/ml 3X FLAG peptide).

Generated:

Article Title: Structural visualization of key steps in human transcription initiation
Article Snippet: The various PIC intermediates were generated by including just the factors of interest during the assembly process described above. .. An arrested Pol II on the open promoter nucleic acid scaffold was first prepared by incubation at 28°C for 1 h of Pol II and DNA (template2-nontemplate3) at final concentrations of 300 nM and 80 nM, respectively, in the arresting buffer containing 12 mM HEPES, pH 7.9, 0.12 mM EDTA, 12% glycerol, 8.25 mM MgCl2 , 60 mM KCl, 1 mM DTT, 0.05% NP-40, 2.5 ng/µl dI-dC, 1:100 dilution of RNasin Ribonuclease inhibitor (Promega), and 2 mM CTP.

Sequencing:

Article Title: Molecular Characterization of Clostridium botulinum Isolates from Foodborne Outbreaks in Thailand, 2010
Article Snippet: Paragraph title: Sequence Analysis of boNT and/or Nontoxic Component Genes for Strain Differentiation ... PCR was performed in a 50 µl reaction containing 1 ng of extracted DNA, 0.5 µM of each primer, 2.5 mM of MgCl2 , 200 µM of each dNTP, 5× Buffer and 2.5 U of GoTaq ® DNA polymerase and 1.5 mM of MgCl2 (Promega).

Article Title: Genetic Diversity of a Natural Population of Apple stem pitting virus Isolated from Apple in Korea
Article Snippet: The forward primer sequence was homologous to nucleotides 7932–7955 (5′-CAATTGCAATAGGTGCGTTCAATC-3′) of the ASPV isolate, while the reverse primer sequence was complementary to nucleotides 9201–9224 (5′-AATGCAGGAGAATTAATTAACTAA-3′) of the ASPV isolate. .. Complementary DNA (cDNA) synthesis was performed as follows: a mixture of 10 ng of RNA in 9 μl of nuclease-free water with 1 μl of 10 pM reverse primer was heated at 70°C for 5 min, followed by the addition of 4 μl of 5X reaction buffer, 2.5 mM MgCl2 , 0.25 mM each dNTP, 1 μl of ImProm II reverse transcriptase (Promega, Madison, WI, USA), and 1 μl of RNase inhibitor (1 U/μl), with incubation at 37°C for 1 h. PCR amplification was performed in a 50-μl volume containing 20 μl of cDNA solution, 0.2 mM each dNTP, 2 mM MgCl2 , 1 μl of 10 pM each primer, 2.5 U of DNA polymerase (Promega), and 1X PCR buffer.

Affinity Purification:

Article Title: A role for the Perlman syndrome exonuclease Dis3l2 in the Lin28-let-7 pathway
Article Snippet: .. For affinity purification of Flag-Lin28A, KH2 ESCs were treated with Dox at 6 μg/ml for 48 hours and then harvested in the lysis buffer (20 mM Tris-HCl, pH 8.0, 137 mM NaCl, 1 mM EDTA, 1% (v/v) Triton X-100, 10% (v/v) Glycerol, 1.5 mM MgCl2 , 1 mM DTT, 0.2 mM PMSF) supplemented with 40 units/ml of RNase inhibitor (rRNasin, Promega). .. Protein complexes were affinity-purified using α-Flag M2 agarose beads (Sigma).

Recombinant:

Article Title: A role for the Perlman syndrome exonuclease Dis3l2 in the Lin28-let-7 pathway
Article Snippet: .. Dicer processing of pre-let-7 or pre-let-7+14U was performed by incubating recombinant Dicer with gel-purified 5′-end labeled synthetic pre-miRNA in a buffer containing 3.2 mM MgCl2, 20 mMTris-HCl (pH 7.9), 0.1M KCl, 10% glycerol, 5 mM DTT, 0.2 mM PMSF, 40 units/ml of RNase inhibitor (RNasin, Promega) for 1 h at 37°C. ..

Article Title: Purification of L1-ribonucleoprotein particles (L1-RNPs) from cultured human cells
Article Snippet: .. 1X Dulbecco’s Phosphate-Buffered Saline (DPBS) (2.67 mM KCl, 1.47 mM KH2 PO4 ,138 mM NaCl, 8.06 mM NaH2 PO4 -7H2 0) DNaseI recombinant, RNase-free (Roche; Cat # 04716728001) Anti-FLAG agarose beads wash buffer [100mM KCl, 5mM MgCl2 , 10 mM HEPES (pH-7.0)] Cell lysis buffer [100mM KCl, 5mM MgCl2 , 10 mM HEPES (pH-7.0), 0.5% NP-40, 0.5mM DTT] Wash buffer 1 [25 mM HEPES (pH-7.0) 250 mM KCl, 5mM MgCl2, 0.1% NP-40] Wash buffer 2 [25 mM HEPES,(pH-7.0), 100 mM KCl, 5mM MgCl2 , 0.1% NP-40] Go Taq green master mix (Promega), DIG RNA labeling mix (Roche) 1X Glyoxal RNA loading buffer (Ambion) 10X DNA gel loading buffer (Invitrogen; Cat # 10816-015) Topo TA cloning Kit (Invitrogen; Cat # K4550-01) RNP elution buffer (wash buffer 2 containing 150 μg/ml 3X FLAG peptide). .. BGH-SP6rev: 5′- ATTTAGGTGACACTATAGAC TCATTTTATTAGGAAAGGACAG-3′ BGHfwd: 5′-ATCTCAGAAGAGGATCTGAATATGC-3′ (Bold sequences denote SP6 promoter primer sequence).

Nucleic Acid Electrophoresis:

Article Title: A role for the Perlman syndrome exonuclease Dis3l2 in the Lin28-let-7 pathway
Article Snippet: The affinity eluate was subjected to SDS–polyacrylamide gel electrophoresis (SDS-PAGE) followed by Coomassie blue staining using the Colloidal Blue Staining Kit’ (Life Technologies™ ). .. For affinity purification of Flag-Lin28A, KH2 ESCs were treated with Dox at 6 μg/ml for 48 hours and then harvested in the lysis buffer (20 mM Tris-HCl, pH 8.0, 137 mM NaCl, 1 mM EDTA, 1% (v/v) Triton X-100, 10% (v/v) Glycerol, 1.5 mM MgCl2 , 1 mM DTT, 0.2 mM PMSF) supplemented with 40 units/ml of RNase inhibitor (rRNasin, Promega).

Isolation:

Article Title: Macrophage migration inhibitory factor counter-regulates dexamethasone-induced annexin 1 expression and influences the release of eicosanoids in murine macrophages
Article Snippet: Total RNA was isolated using TRIzol reagent (Invitrogen), and 2 μg of total RNA was reverse transcribed using Reverse Transcription Reagents (Fermentas, Vilnius, Lithuania). .. Then, 3 μl of the double-strand product was mixed with 10 × Taq /RT buffer [1 × Taq /RT buffer: 10 mmol/l Tris–HCl (pH 8·3), 50 mmol/l KCl, 1·5 mmol/l MgCl2 , 0·01% gelatine and 2·0 mmol/l dithiothreitol], 500 μmol/l deoxyoligonucleoside triphosphate mix, 25 mmol/l MgCl2 , 500 μmol/l of each sense and antisense oligonucleotide, and 0·25 μl Taq polymerase (Promega, Madison, WI).

Microscopy:

Article Title: The Etiology of Cleft Palate Formation in BMP7-Deficient Mice
Article Snippet: Briefly, tissue fragments or OCT (BDH)-embedded palate sections were fixed in 2% formaldehyde, 0.2% glutaraldehyde, 0.01% sodium deoxycholate, 0.02% Nonidet-P40 (NP40) in PBS for 5 min, washed with 2 mM MgCl2 , and stained at 37°C in the dark overnight in X-gal staining solution, which contained 0.1 M phosphate pH 7.3, 2 mM MgCl2 , 0.01% sodium deoxycholate, 0.02% NP40, 5 mM K3 [Fe(CN)6 ], 5 mM K4 [Fe(CN)6 ] supplemented with 1 mg X-Gal (Promega)/ml. .. Sections were mounted with water-based Mowiol 4–88 (Sigma) and documented using a Leica DM-E microscope equipped with a Leica DFC290 camera.

Purification:

Article Title: Structural visualization of key steps in human transcription initiation
Article Snippet: Paragraph title: PIC assembly and purification ... An arrested Pol II on the open promoter nucleic acid scaffold was first prepared by incubation at 28°C for 1 h of Pol II and DNA (template2-nontemplate3) at final concentrations of 300 nM and 80 nM, respectively, in the arresting buffer containing 12 mM HEPES, pH 7.9, 0.12 mM EDTA, 12% glycerol, 8.25 mM MgCl2 , 60 mM KCl, 1 mM DTT, 0.05% NP-40, 2.5 ng/µl dI-dC, 1:100 dilution of RNasin Ribonuclease inhibitor (Promega), and 2 mM CTP.

Article Title: A role for the Perlman syndrome exonuclease Dis3l2 in the Lin28-let-7 pathway
Article Snippet: Dicer assays Recombinant Flag-Dicer Protein was purified from insect cells as previously described . .. Dicer processing of pre-let-7 or pre-let-7+14U was performed by incubating recombinant Dicer with gel-purified 5′-end labeled synthetic pre-miRNA in a buffer containing 3.2 mM MgCl2, 20 mMTris-HCl (pH 7.9), 0.1M KCl, 10% glycerol, 5 mM DTT, 0.2 mM PMSF, 40 units/ml of RNase inhibitor (RNasin, Promega) for 1 h at 37°C.

Article Title: tRNA Translocation by the Eukaryotic 80S Ribosome and the Impact of GTP Hydrolysis
Article Snippet: Deacylation was performed in 400 μl containing 30 mM HEPES pH 7.6, 100 mM KCl, 5 mM MgCl2 , 1 U/ml RNasin Plus (Promega), 1 mM DTT, 5 A280 /μ®l total aminoacyl-tRNA synthetases, 6 mM AMP and 6 mM pyrophosphate (PPi ) for 5 min at 30°C. .. After another round of phenol/chloroform/isoamyl alcohol extraction N-acetyl-[14 C]Val-tRNAVal was purified by reversed-phase HPLC on a Nucleosil 300–7 C8 HPLC column (Knauer) using a methanol gradient as described ( ).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Genetic Diversity of a Natural Population of Apple stem pitting virus Isolated from Apple in Korea
Article Snippet: To detect ASPV using RT-PCR, RNA was extracted from one leaf from each tree using a CF11 cellulose (Whatman, Kent, UK) column, as described previously ( ). .. Complementary DNA (cDNA) synthesis was performed as follows: a mixture of 10 ng of RNA in 9 μl of nuclease-free water with 1 μl of 10 pM reverse primer was heated at 70°C for 5 min, followed by the addition of 4 μl of 5X reaction buffer, 2.5 mM MgCl2 , 0.25 mM each dNTP, 1 μl of ImProm II reverse transcriptase (Promega, Madison, WI, USA), and 1 μl of RNase inhibitor (1 U/μl), with incubation at 37°C for 1 h. PCR amplification was performed in a 50-μl volume containing 20 μl of cDNA solution, 0.2 mM each dNTP, 2 mM MgCl2 , 1 μl of 10 pM each primer, 2.5 U of DNA polymerase (Promega), and 1X PCR buffer.

Article Title: Macrophage migration inhibitory factor counter-regulates dexamethasone-induced annexin 1 expression and influences the release of eicosanoids in murine macrophages
Article Snippet: Paragraph title: RNA extraction and RT-PCR analysis ... Then, 3 μl of the double-strand product was mixed with 10 × Taq /RT buffer [1 × Taq /RT buffer: 10 mmol/l Tris–HCl (pH 8·3), 50 mmol/l KCl, 1·5 mmol/l MgCl2 , 0·01% gelatine and 2·0 mmol/l dithiothreitol], 500 μmol/l deoxyoligonucleoside triphosphate mix, 25 mmol/l MgCl2 , 500 μmol/l of each sense and antisense oligonucleotide, and 0·25 μl Taq polymerase (Promega, Madison, WI).

Immunoprecipitation:

Article Title: Purification of L1-ribonucleoprotein particles (L1-RNPs) from cultured human cells
Article Snippet: Paragraph title: 3.3. Reagents for Immunoprecipitation, Western blotting and Northern blotting ... 1X Dulbecco’s Phosphate-Buffered Saline (DPBS) (2.67 mM KCl, 1.47 mM KH2 PO4 ,138 mM NaCl, 8.06 mM NaH2 PO4 -7H2 0) DNaseI recombinant, RNase-free (Roche; Cat # 04716728001) Anti-FLAG agarose beads wash buffer [100mM KCl, 5mM MgCl2 , 10 mM HEPES (pH-7.0)] Cell lysis buffer [100mM KCl, 5mM MgCl2 , 10 mM HEPES (pH-7.0), 0.5% NP-40, 0.5mM DTT] Wash buffer 1 [25 mM HEPES (pH-7.0) 250 mM KCl, 5mM MgCl2, 0.1% NP-40] Wash buffer 2 [25 mM HEPES,(pH-7.0), 100 mM KCl, 5mM MgCl2 , 0.1% NP-40] Go Taq green master mix (Promega), DIG RNA labeling mix (Roche) 1X Glyoxal RNA loading buffer (Ambion) 10X DNA gel loading buffer (Invitrogen; Cat # 10816-015) Topo TA cloning Kit (Invitrogen; Cat # K4550-01) RNP elution buffer (wash buffer 2 containing 150 μg/ml 3X FLAG peptide).

Labeling:

Article Title: A role for the Perlman syndrome exonuclease Dis3l2 in the Lin28-let-7 pathway
Article Snippet: .. Dicer processing of pre-let-7 or pre-let-7+14U was performed by incubating recombinant Dicer with gel-purified 5′-end labeled synthetic pre-miRNA in a buffer containing 3.2 mM MgCl2, 20 mMTris-HCl (pH 7.9), 0.1M KCl, 10% glycerol, 5 mM DTT, 0.2 mM PMSF, 40 units/ml of RNase inhibitor (RNasin, Promega) for 1 h at 37°C. ..

Article Title: Purification of L1-ribonucleoprotein particles (L1-RNPs) from cultured human cells
Article Snippet: .. 1X Dulbecco’s Phosphate-Buffered Saline (DPBS) (2.67 mM KCl, 1.47 mM KH2 PO4 ,138 mM NaCl, 8.06 mM NaH2 PO4 -7H2 0) DNaseI recombinant, RNase-free (Roche; Cat # 04716728001) Anti-FLAG agarose beads wash buffer [100mM KCl, 5mM MgCl2 , 10 mM HEPES (pH-7.0)] Cell lysis buffer [100mM KCl, 5mM MgCl2 , 10 mM HEPES (pH-7.0), 0.5% NP-40, 0.5mM DTT] Wash buffer 1 [25 mM HEPES (pH-7.0) 250 mM KCl, 5mM MgCl2, 0.1% NP-40] Wash buffer 2 [25 mM HEPES,(pH-7.0), 100 mM KCl, 5mM MgCl2 , 0.1% NP-40] Go Taq green master mix (Promega), DIG RNA labeling mix (Roche) 1X Glyoxal RNA loading buffer (Ambion) 10X DNA gel loading buffer (Invitrogen; Cat # 10816-015) Topo TA cloning Kit (Invitrogen; Cat # K4550-01) RNP elution buffer (wash buffer 2 containing 150 μg/ml 3X FLAG peptide). .. BGH-SP6rev: 5′- ATTTAGGTGACACTATAGAC TCATTTTATTAGGAAAGGACAG-3′ BGHfwd: 5′-ATCTCAGAAGAGGATCTGAATATGC-3′ (Bold sequences denote SP6 promoter primer sequence).

Lysis:

Article Title: Purification of L1-ribonucleoprotein particles (L1-RNPs) from cultured human cells
Article Snippet: .. 1X Dulbecco’s Phosphate-Buffered Saline (DPBS) (2.67 mM KCl, 1.47 mM KH2 PO4 ,138 mM NaCl, 8.06 mM NaH2 PO4 -7H2 0) DNaseI recombinant, RNase-free (Roche; Cat # 04716728001) Anti-FLAG agarose beads wash buffer [100mM KCl, 5mM MgCl2 , 10 mM HEPES (pH-7.0)] Cell lysis buffer [100mM KCl, 5mM MgCl2 , 10 mM HEPES (pH-7.0), 0.5% NP-40, 0.5mM DTT] Wash buffer 1 [25 mM HEPES (pH-7.0) 250 mM KCl, 5mM MgCl2, 0.1% NP-40] Wash buffer 2 [25 mM HEPES,(pH-7.0), 100 mM KCl, 5mM MgCl2 , 0.1% NP-40] Go Taq green master mix (Promega), DIG RNA labeling mix (Roche) 1X Glyoxal RNA loading buffer (Ambion) 10X DNA gel loading buffer (Invitrogen; Cat # 10816-015) Topo TA cloning Kit (Invitrogen; Cat # K4550-01) RNP elution buffer (wash buffer 2 containing 150 μg/ml 3X FLAG peptide). .. BGH-SP6rev: 5′- ATTTAGGTGACACTATAGAC TCATTTTATTAGGAAAGGACAG-3′ BGHfwd: 5′-ATCTCAGAAGAGGATCTGAATATGC-3′ (Bold sequences denote SP6 promoter primer sequence).

Article Title: A role for the Perlman syndrome exonuclease Dis3l2 in the Lin28-let-7 pathway
Article Snippet: .. For affinity purification of Flag-Lin28A, KH2 ESCs were treated with Dox at 6 μg/ml for 48 hours and then harvested in the lysis buffer (20 mM Tris-HCl, pH 8.0, 137 mM NaCl, 1 mM EDTA, 1% (v/v) Triton X-100, 10% (v/v) Glycerol, 1.5 mM MgCl2 , 1 mM DTT, 0.2 mM PMSF) supplemented with 40 units/ml of RNase inhibitor (rRNasin, Promega). .. Protein complexes were affinity-purified using α-Flag M2 agarose beads (Sigma).

SDS Page:

Article Title: A role for the Perlman syndrome exonuclease Dis3l2 in the Lin28-let-7 pathway
Article Snippet: The affinity eluate was subjected to SDS–polyacrylamide gel electrophoresis (SDS-PAGE) followed by Coomassie blue staining using the Colloidal Blue Staining Kit’ (Life Technologies™ ). .. For affinity purification of Flag-Lin28A, KH2 ESCs were treated with Dox at 6 μg/ml for 48 hours and then harvested in the lysis buffer (20 mM Tris-HCl, pH 8.0, 137 mM NaCl, 1 mM EDTA, 1% (v/v) Triton X-100, 10% (v/v) Glycerol, 1.5 mM MgCl2 , 1 mM DTT, 0.2 mM PMSF) supplemented with 40 units/ml of RNase inhibitor (rRNasin, Promega).

RNA Extraction:

Article Title: Macrophage migration inhibitory factor counter-regulates dexamethasone-induced annexin 1 expression and influences the release of eicosanoids in murine macrophages
Article Snippet: Paragraph title: RNA extraction and RT-PCR analysis ... Then, 3 μl of the double-strand product was mixed with 10 × Taq /RT buffer [1 × Taq /RT buffer: 10 mmol/l Tris–HCl (pH 8·3), 50 mmol/l KCl, 1·5 mmol/l MgCl2 , 0·01% gelatine and 2·0 mmol/l dithiothreitol], 500 μmol/l deoxyoligonucleoside triphosphate mix, 25 mmol/l MgCl2 , 500 μmol/l of each sense and antisense oligonucleotide, and 0·25 μl Taq polymerase (Promega, Madison, WI).

Sample Prep:

Article Title: Structural visualization of key steps in human transcription initiation
Article Snippet: An arrested Pol II on the open promoter nucleic acid scaffold was first prepared by incubation at 28°C for 1 h of Pol II and DNA (template2-nontemplate3) at final concentrations of 300 nM and 80 nM, respectively, in the arresting buffer containing 12 mM HEPES, pH 7.9, 0.12 mM EDTA, 12% glycerol, 8.25 mM MgCl2 , 60 mM KCl, 1 mM DTT, 0.05% NP-40, 2.5 ng/µl dI-dC, 1:100 dilution of RNasin Ribonuclease inhibitor (Promega), and 2 mM CTP. .. Purified PIC complexes were crosslinked after elution by incubation with glutaraldehyde at a final concentration of 0.05%, on ice and under very low illumination conditions, for 5min, then immediately used for EM sample preparation (either negative stain or cryo-plunging).

Chromosome Walking:

Article Title: Molecular Characterization of Clostridium botulinum Isolates from Foodborne Outbreaks in Thailand, 2010
Article Snippet: PCR was performed in a 50 µl reaction containing 1 ng of extracted DNA, 0.5 µM of each primer, 2.5 mM of MgCl2 , 200 µM of each dNTP, 5× Buffer and 2.5 U of GoTaq ® DNA polymerase and 1.5 mM of MgCl2 (Promega). .. Final extension was carried out 72°C for 10 min. Amplicons were directly sequenced by primer walking, and the sequence (in both directions) was confirmed using the ABI Prism BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA).

Concentration Assay:

Article Title: Structural visualization of key steps in human transcription initiation
Article Snippet: For preparing TBP-TFIIA-TFIIB-DNA-PolII-TFIIF-TFIIE complex, extra TFIIE was added afterwards to the purified PIC at a final concentration of 100 nM. .. An arrested Pol II on the open promoter nucleic acid scaffold was first prepared by incubation at 28°C for 1 h of Pol II and DNA (template2-nontemplate3) at final concentrations of 300 nM and 80 nM, respectively, in the arresting buffer containing 12 mM HEPES, pH 7.9, 0.12 mM EDTA, 12% glycerol, 8.25 mM MgCl2 , 60 mM KCl, 1 mM DTT, 0.05% NP-40, 2.5 ng/µl dI-dC, 1:100 dilution of RNasin Ribonuclease inhibitor (Promega), and 2 mM CTP.

Staining:

Article Title: Structural visualization of key steps in human transcription initiation
Article Snippet: An arrested Pol II on the open promoter nucleic acid scaffold was first prepared by incubation at 28°C for 1 h of Pol II and DNA (template2-nontemplate3) at final concentrations of 300 nM and 80 nM, respectively, in the arresting buffer containing 12 mM HEPES, pH 7.9, 0.12 mM EDTA, 12% glycerol, 8.25 mM MgCl2 , 60 mM KCl, 1 mM DTT, 0.05% NP-40, 2.5 ng/µl dI-dC, 1:100 dilution of RNasin Ribonuclease inhibitor (Promega), and 2 mM CTP. .. Purified PIC complexes were crosslinked after elution by incubation with glutaraldehyde at a final concentration of 0.05%, on ice and under very low illumination conditions, for 5min, then immediately used for EM sample preparation (either negative stain or cryo-plunging).

Article Title: The Etiology of Cleft Palate Formation in BMP7-Deficient Mice
Article Snippet: .. Briefly, tissue fragments or OCT (BDH)-embedded palate sections were fixed in 2% formaldehyde, 0.2% glutaraldehyde, 0.01% sodium deoxycholate, 0.02% Nonidet-P40 (NP40) in PBS for 5 min, washed with 2 mM MgCl2 , and stained at 37°C in the dark overnight in X-gal staining solution, which contained 0.1 M phosphate pH 7.3, 2 mM MgCl2 , 0.01% sodium deoxycholate, 0.02% NP40, 5 mM K3 [Fe(CN)6 ], 5 mM K4 [Fe(CN)6 ] supplemented with 1 mg X-Gal (Promega)/ml. ..

Article Title: A role for the Perlman syndrome exonuclease Dis3l2 in the Lin28-let-7 pathway
Article Snippet: The affinity eluate was subjected to SDS–polyacrylamide gel electrophoresis (SDS-PAGE) followed by Coomassie blue staining using the Colloidal Blue Staining Kit’ (Life Technologies™ ). .. For affinity purification of Flag-Lin28A, KH2 ESCs were treated with Dox at 6 μg/ml for 48 hours and then harvested in the lysis buffer (20 mM Tris-HCl, pH 8.0, 137 mM NaCl, 1 mM EDTA, 1% (v/v) Triton X-100, 10% (v/v) Glycerol, 1.5 mM MgCl2 , 1 mM DTT, 0.2 mM PMSF) supplemented with 40 units/ml of RNase inhibitor (rRNasin, Promega).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Promega gotaq g2 flexi dna polymerase
    Gotaq G2 Flexi Dna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 93 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gotaq g2 flexi dna polymerase/product/Promega
    Average 90 stars, based on 93 article reviews
    Price from $9.99 to $1999.99
    gotaq g2 flexi dna polymerase - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    Promega gotaq dna polymerase
    Gotaq Dna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1465 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gotaq dna polymerase/product/Promega
    Average 90 stars, based on 1465 article reviews
    Price from $9.99 to $1999.99
    gotaq dna polymerase - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    Promega gotaq master mixes
    Gotaq Master Mixes, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 148 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gotaq master mixes/product/Promega
    Average 90 stars, based on 148 article reviews
    Price from $9.99 to $1999.99
    gotaq master mixes - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results