mca970r (Bio-Rad)
Structured Review
Mca970r, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 474 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mca970r/Mouse+anti+Rat+RECA-1/pmc12143144__mmc1-41-114-111
Average 94 stars, based on 474 article reviews
Images
Related Articles
Immunohistochemistry:Article Title: Myelinogenic Plasticity of Oligodendrocyte Precursor Cells following Spinal Cord Contusion Injury Article Snippet: .. Reca 1, clone HIS52 , Endothelial cells , Mouse, IgG1 , Serotec, other:Article Title: Blood Vessels: The Pathway Used by Schwann Cells to Colonize Nerve Conduits Article Snippet: Reca1 , MCA970R , 1:500 , Article Title: Surfen-mediated blockade of extratumoral chondroitin sulfate glycosaminoglycans inhibits glioblastoma invasion Article Snippet: Article Title: Characterization of the structure and control of the blood-nerve barrier identifies avenues for therapeutic delivery. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey anti-Rabbit Alexa Fluor 488 Thermo Fisher Scientific Cat#A21206; RRID: AB_2535792 Donkey anti-Rabbit Alexa Fluor 594 Thermo Fisher Scientific Cat#A21207; RRID: AB_141637 Donkey anti-Rabbit Alexa Fluor 647 Thermo Fisher Scientific Cat#A31573; RRID: AB_2536183 Donkey anti-Goat Alexa Fluor 405 Thermo Fisher Scientific Cat#A48259; RRID: AB_2890272 Donkey anti-Goat Alexa Fluor 488 Thermo Fisher Scientific Cat#A11055; RRID: AB_2534102 Donkey anti-Goat Alexa Fluor 594 Thermo Fisher Scientific Cat#A11058; RRID: AB_2534105 Donkey anti-Goat Alexa Fluor 647 Thermo Fisher Scientific Cat#A21447; RRID: AB_2535864 Biological samples Healthy adult nerve tissue This paper N/A Chemicals, peptides and recombinant proteins Tamoxifen Sigma-Aldrich T5648 Griffonia (Bandeiraea) Simplicifolia Lectin I (GSL I, BSL I), Rhodamine Vector Laboratories RL-1102 Evans blue Sigma-Aldrich E2129 BSA Sigma-Aldrich A3294 Dextran 40KDa fluorescein lysine fixable Thermo Fisher Scientific D1845 HRP type II Sigma-Aldrich P8250 BSA-FITC Invitrogen A23015 Goat serum Sigma-Aldrich G9023 Donkey serum Sigma-Aldrich D9663 Formaldehyde 16% TAAB Laboratories F017 Formaldehyde (EM grade) 36% TAAB Laboratories F003 Glutaraldehyde (EM grade) 20% TAAB Laboratories G011 Osmium Tetroxide 2% aqueous TAAB Laboratories O005 Potassium Ferricyanide Sigma-Aldrich P-8131 AIN-76A Rodent Diet With 1,200 mg PLX5622 (Free Base)/kg Research Diets, Inc. Plexxikon Inc D11100404i AIN-76A Rodent Diet Research Diets, Inc. Plexxikon Inc D10001i Critical Commercial Assays PureLink RNA Micro kit Thermo Fisher Scientific Cat#12183016 SuperScript II Thermo Fisher Scientific 18064014 MESA Blue qPCR Mastermix Plus Kit Eurogentec RT-SY2X-03+NRWOUB Invitrogen Molecular Probes TSA Kit 25, with HRP-streptavidin and Alexa Fluor 594 tyramide Thermo Fischer Scientific Cat# T-20935 Experimental Models: Organisms/Strains Crl:CD(SD) Rattus norvegicus Charles River Laboratories 001 Cat#734476; RRID:RGD734476 C57BL/6J Charles River Laboratories 632 Cat# JAX_000664; RRID:IMSR_JAX:000664 P0-RafTR mouse Napoli et al.38 Available from Jackson Stock# 018449 Oligonucleotides B2M forward: CAGTCTCAGTGGGGTGAAT reverse: ATGGGAAGCCGAACATACTG This paper N/A Malat1 forward: TGGGTTAGAGAAGGCGTGTACTG reverse: TCAGCGGCAACTGGGAAA This paper N/A Antisense Oligonucleotide Malat1: GCATTCTAATAGCAGC IONIS Pharmaceuticals N/A Software and algorithms Fiji / ImageJ Schindelin et al.84 https://imagej.net/Fiji/Downloads (Continued on next page) Developmental Cell 58, 174–191.e1–e8, February 6, 2023 e2 Article Title: Exercise promotes the functional integration of human stem cell-derived neural grafts in a rodent model of Parkinson’s disease Article Snippet: BARHL1 Rabbit Novus Biologicals Cat# NBP1-86513 1:200 BDNF Rabbit Abcam Cat# ab46176 1:2000 Calbindin-C28K Mouse Swant Cat# 300 1:1000 DAPI - Sigma Aldrich Cat# D8417 1:5000 ERK Rabbit Cell Signaling Tech Cat# 91025 1:300 CC1 Mouse Abcam Cat# ab16794 1:200 cFOS Goat Santa Cruz Cat# sc-52 1:1000 FOXA2 Goat Santa Cruz Cat# sc-6554 1:200 GDNF Rabbit Invitrogen Cat# PA5-89957 1:2000 Green fluorescent protein (GFP) Chicken Abcam Cat# ab13970 1:1000 GFP Rabbit Abcam Cat# ab290 1:1000 GIRK2 Rabbit Abcam Cat# ab65096 1:500 Nestin Mouse R&D Systems Cat# MAB353 1:1000 NeuN Mouse Millipore Cat# MAB377 1:1500 OTX2 Goat R&D Systems Cat# AF1979 1:500 pERK Rabbit Cell Signaling Tech Cat# A1065 1:300 |
