Review



mca970r  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Bio-Rad mca970r
    Mca970r, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 474 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mca970r/Mouse+anti+Rat+RECA-1/pmc12143144__mmc1-41-114-111
    Average 94 stars, based on 474 article reviews
    mca970r - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Immunohistochemistry:

    Article Title: Myelinogenic Plasticity of Oligodendrocyte Precursor Cells following Spinal Cord Contusion Injury
    Article Snippet: .. Reca 1, clone HIS52 , Endothelial cells , Mouse, IgG1 , Serotec, MCA970R , 1:500; IHC. ..

    other:

    Article Title: Blood Vessels: The Pathway Used by Schwann Cells to Colonize Nerve Conduits
    Article Snippet: Reca1 , MCA970R , 1:500 , Mouse , Bio-Rad (AbD Serotec).


    Article Title: Characterization of the structure and control of the blood-nerve barrier identifies avenues for therapeutic delivery.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey anti-Rabbit Alexa Fluor 488 Thermo Fisher Scientific Cat#A21206; RRID: AB_2535792 Donkey anti-Rabbit Alexa Fluor 594 Thermo Fisher Scientific Cat#A21207; RRID: AB_141637 Donkey anti-Rabbit Alexa Fluor 647 Thermo Fisher Scientific Cat#A31573; RRID: AB_2536183 Donkey anti-Goat Alexa Fluor 405 Thermo Fisher Scientific Cat#A48259; RRID: AB_2890272 Donkey anti-Goat Alexa Fluor 488 Thermo Fisher Scientific Cat#A11055; RRID: AB_2534102 Donkey anti-Goat Alexa Fluor 594 Thermo Fisher Scientific Cat#A11058; RRID: AB_2534105 Donkey anti-Goat Alexa Fluor 647 Thermo Fisher Scientific Cat#A21447; RRID: AB_2535864 Biological samples Healthy adult nerve tissue This paper N/A Chemicals, peptides and recombinant proteins Tamoxifen Sigma-Aldrich T5648 Griffonia (Bandeiraea) Simplicifolia Lectin I (GSL I, BSL I), Rhodamine Vector Laboratories RL-1102 Evans blue Sigma-Aldrich E2129 BSA Sigma-Aldrich A3294 Dextran 40KDa fluorescein lysine fixable Thermo Fisher Scientific D1845 HRP type II Sigma-Aldrich P8250 BSA-FITC Invitrogen A23015 Goat serum Sigma-Aldrich G9023 Donkey serum Sigma-Aldrich D9663 Formaldehyde 16% TAAB Laboratories F017 Formaldehyde (EM grade) 36% TAAB Laboratories F003 Glutaraldehyde (EM grade) 20% TAAB Laboratories G011 Osmium Tetroxide 2% aqueous TAAB Laboratories O005 Potassium Ferricyanide Sigma-Aldrich P-8131 AIN-76A Rodent Diet With 1,200 mg PLX5622 (Free Base)/kg Research Diets, Inc. Plexxikon Inc D11100404i AIN-76A Rodent Diet Research Diets, Inc. Plexxikon Inc D10001i Critical Commercial Assays PureLink RNA Micro kit Thermo Fisher Scientific Cat#12183016 SuperScript II Thermo Fisher Scientific 18064014 MESA Blue qPCR Mastermix Plus Kit Eurogentec RT-SY2X-03+NRWOUB Invitrogen Molecular Probes TSA Kit 25, with HRP-streptavidin and Alexa Fluor 594 tyramide Thermo Fischer Scientific Cat# T-20935 Experimental Models: Organisms/Strains Crl:CD(SD) Rattus norvegicus Charles River Laboratories 001 Cat#734476; RRID:RGD734476 C57BL/6J Charles River Laboratories 632 Cat# JAX_000664; RRID:IMSR_JAX:000664 P0-RafTR mouse Napoli et al.38 Available from Jackson Stock# 018449 Oligonucleotides B2M forward: CAGTCTCAGTGGGGTGAAT reverse: ATGGGAAGCCGAACATACTG This paper N/A Malat1 forward: TGGGTTAGAGAAGGCGTGTACTG reverse: TCAGCGGCAACTGGGAAA This paper N/A Antisense Oligonucleotide Malat1: GCATTCTAATAGCAGC IONIS Pharmaceuticals N/A Software and algorithms Fiji / ImageJ Schindelin et al.84 https://imagej.net/Fiji/Downloads (Continued on next page) Developmental Cell 58, 174–191.e1–e8, February 6, 2023 e2

    Article Title: Exercise promotes the functional integration of human stem cell-derived neural grafts in a rodent model of Parkinson’s disease
    Article Snippet: BARHL1 Rabbit Novus Biologicals Cat# NBP1-86513 1:200 BDNF Rabbit Abcam Cat# ab46176 1:2000 Calbindin-C28K Mouse Swant Cat# 300 1:1000 DAPI - Sigma Aldrich Cat# D8417 1:5000 ERK Rabbit Cell Signaling Tech Cat# 91025 1:300 CC1 Mouse Abcam Cat# ab16794 1:200 cFOS Goat Santa Cruz Cat# sc-52 1:1000 FOXA2 Goat Santa Cruz Cat# sc-6554 1:200 GDNF Rabbit Invitrogen Cat# PA5-89957 1:2000 Green fluorescent protein (GFP) Chicken Abcam Cat# ab13970 1:1000 GFP Rabbit Abcam Cat# ab290 1:1000 GIRK2 Rabbit Abcam Cat# ab65096 1:500 Nestin Mouse R&D Systems Cat# MAB353 1:1000 NeuN Mouse Millipore Cat# MAB377 1:1500 OTX2 Goat R&D Systems Cat# AF1979 1:500 pERK Rabbit Cell Signaling Tech Cat# A1065 1:300 RECA-1 Mouse Abd Serotec Cat# MCA970R 1:2000 SOX9 Rabbit Abcam Cat# ab185966 1:500 Human Synaptophysin (hSYP) Mouse Enzo Life Sciences Cat# ADI-905-782-100 1:200 PITX3 Goat Santa Cruz Cat# sc-19307 1:200 Tyrosine Hydroxylase (TH) Rabbit Pel-freeze Cat# P40101-0 1:1000 TH Sheep Pelfreeze Cat# P60101-0 1:800 Supplementary Table 1: List of antibodies and dilutions.



    Similar Products

    94
    Bio-Rad mca970r
    Mca970r, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mca970r/Mouse+anti+Rat+RECA-1/pmc12143144__mmc1-41-114-111
    Average 94 stars, based on 1 article reviews
    mca970r - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Bio-Rad reca mouse abd serotec mca970r
    Reca Mouse Abd Serotec Mca970r, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mca970r/Mouse+anti+Rat+RECA-1/pmc08160354__41467_2021_23125_MOESM1_ESM-37-131-133
    Average 94 stars, based on 1 article reviews
    reca mouse abd serotec mca970r - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Bio-Rad species reca 1 bio rad mca970r 88 cxcl12 r d systems mab350 89 cxcr4 thermo fisher scientific
    Antibodies used for Western blotting, immunocytochemistry, and immunohistochemistry
    Species Reca 1 Bio Rad Mca970r 88 Cxcl12 R D Systems Mab350 89 Cxcr4 Thermo Fisher Scientific, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mca970r/Mouse+anti+Rat+RECA-1/pmc06902699-273-137-139
    Average 94 stars, based on 1 article reviews
    species reca 1 bio rad mca970r 88 cxcl12 r d systems mab350 89 cxcr4 thermo fisher scientific - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Bio-Rad rabbit santa cruz biotechnology reca1 mca970r
    Antibodies used for Western blotting, immunocytochemistry, and immunohistochemistry
    Rabbit Santa Cruz Biotechnology Reca1 Mca970r, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mca970r/Mouse+anti+Rat+RECA-1/pmc07349576__cells___09___01366___s001-0-84-92
    Average 94 stars, based on 1 article reviews
    rabbit santa cruz biotechnology reca1 mca970r - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    Antibodies used for Western blotting, immunocytochemistry, and immunohistochemistry

    Journal: The FASEB Journal

    Article Title: Surfen-mediated blockade of extratumoral chondroitin sulfate glycosaminoglycans inhibits glioblastoma invasion

    doi: 10.1096/fj.201802610RR

    Figure Lengend Snippet: Antibodies used for Western blotting, immunocytochemistry, and immunohistochemistry

    Article Snippet: Membranes were then washed with 1× TBS and kept in 1× TBS until imaged using a ChemiDoc MP System (Bio-Rad). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Name Company Catalog no. Reference LAR BD Biosciences (San Jose, CA, USA) 610350 56 , 78 RAGE R&D Systems MAB1179 27 , 79 NG1 Thermo Fisher Scientific PA1-41202 26 NG3 R&D Systems AF2920 26 ERK Cell Signaling Technology (Danvers, MA, USA) 9102S 80 pERK Cell Signaling Technology 9101S 80 Akt Cell Signaling Technology 9272S 81 pAkt Cell Signaling Technology 9271S 81 FAK Thermo Fisher Scientific 44-626G 82 Vinculin MilliporeSigma V9131-100 μl 83 GAPDH Abcam ab8245 84 CD133 Miltenyi Biotec 130-113-108 Human-specific but cross-validated in species CS-56 MilliporeSigma C8035 85 Sox1 Abcam ab87775 86 VEGFa Abcam ab46154 87 VEGFR1 Calbiochem (San Diego, CA, USA) PC322L Human-specific but cross-validated in species RECA-1 Bio-Rad MCA970R 88 CXCL12 R&D Systems MAB350 89 CXCR4 Thermo Fisher Scientific 35-8800 Human-specific but cross-validated in species NeuN MilliporeSigma MAB377 90 Goat anti-mouse IgG1 488 Thermo Fisher Scientific A21121 Open in a separate window NeuN, neuronal nuclei; pAkt, phosphorylated Akt; pERK, phosphorylated ERK; RECA-1, rat endothelial cell antigen antiendothelial cell antibody.

    Techniques: Western Blot, Immunocytochemistry

    Description of primers used for gene expression analyses in rats

    Journal: The FASEB Journal

    Article Title: Surfen-mediated blockade of extratumoral chondroitin sulfate glycosaminoglycans inhibits glioblastoma invasion

    doi: 10.1096/fj.201802610RR

    Figure Lengend Snippet: Description of primers used for gene expression analyses in rats

    Article Snippet: Membranes were then washed with 1× TBS and kept in 1× TBS until imaged using a ChemiDoc MP System (Bio-Rad). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Name Company Catalog no. Reference LAR BD Biosciences (San Jose, CA, USA) 610350 56 , 78 RAGE R&D Systems MAB1179 27 , 79 NG1 Thermo Fisher Scientific PA1-41202 26 NG3 R&D Systems AF2920 26 ERK Cell Signaling Technology (Danvers, MA, USA) 9102S 80 pERK Cell Signaling Technology 9101S 80 Akt Cell Signaling Technology 9272S 81 pAkt Cell Signaling Technology 9271S 81 FAK Thermo Fisher Scientific 44-626G 82 Vinculin MilliporeSigma V9131-100 μl 83 GAPDH Abcam ab8245 84 CD133 Miltenyi Biotec 130-113-108 Human-specific but cross-validated in species CS-56 MilliporeSigma C8035 85 Sox1 Abcam ab87775 86 VEGFa Abcam ab46154 87 VEGFR1 Calbiochem (San Diego, CA, USA) PC322L Human-specific but cross-validated in species RECA-1 Bio-Rad MCA970R 88 CXCL12 R&D Systems MAB350 89 CXCR4 Thermo Fisher Scientific 35-8800 Human-specific but cross-validated in species NeuN MilliporeSigma MAB377 90 Goat anti-mouse IgG1 488 Thermo Fisher Scientific A21121 Open in a separate window NeuN, neuronal nuclei; pAkt, phosphorylated Akt; pERK, phosphorylated ERK; RECA-1, rat endothelial cell antigen antiendothelial cell antibody.

    Techniques: Expressing

    Surfen treatment decreases angiogenesis and chemokine signaling in F98 tumors. A) Representative low-magnification epifluorescence imaging of control tumor periphery with insets containing high-magnification confocal images of the nuclear marker DAPI, VEGFa, VEGFR1, and endothelial cell marker Reca. Scale bars, 100 and 50 µm. B) Representative low-magnification epifluorescence imaging of control tumor periphery with insets containing high-magnification confocal images of the nuclear marker DAPI, VEGFa, VEGFR1, and endothelial cell marker Reca. Scale bars, 100 and 50 µm. C) Cell density quantifications of cells positive for either VEGFa or VEGFR1 across control and surfen-treated tumor tissue. D) Colocalization quantification for VEGFa and VEGFR1 between control and surfen-treated tumor tissue. E) Correlation analysis between amounts of VEGFa present and VEGFR1+ cells. F) Representative low-magnification epifluorescence imaging of control tumor periphery with insets containing high-magnification confocal images of the nuclear marker DAPI, chemokine CXCL12, and chemokine receptor CXCR4. Scale bars, 100 and 50 µm. G) Representative low-magnification epifluorescence imaging of surfen-treated tumor boundaries with insets containing high-magnification confocal images of the nuclear marker DAPI, chemokine CXCL12, and chemokine receptor CXCR4. H, I) Quantification for amount of detectable CXCL12 within both control and surfen-treated tissue (H) and for percentage of CXCR4+ cells within the same tissue (I). J) Colocalization analysis for CXCL12 and CXCR4 between control and surfen-treated tumor tissue. Error bars represent means ± sd. *P < 0.05, Student’s t test followed by Mann-Whitney rank-sum test.

    Journal: The FASEB Journal

    Article Title: Surfen-mediated blockade of extratumoral chondroitin sulfate glycosaminoglycans inhibits glioblastoma invasion

    doi: 10.1096/fj.201802610RR

    Figure Lengend Snippet: Surfen treatment decreases angiogenesis and chemokine signaling in F98 tumors. A) Representative low-magnification epifluorescence imaging of control tumor periphery with insets containing high-magnification confocal images of the nuclear marker DAPI, VEGFa, VEGFR1, and endothelial cell marker Reca. Scale bars, 100 and 50 µm. B) Representative low-magnification epifluorescence imaging of control tumor periphery with insets containing high-magnification confocal images of the nuclear marker DAPI, VEGFa, VEGFR1, and endothelial cell marker Reca. Scale bars, 100 and 50 µm. C) Cell density quantifications of cells positive for either VEGFa or VEGFR1 across control and surfen-treated tumor tissue. D) Colocalization quantification for VEGFa and VEGFR1 between control and surfen-treated tumor tissue. E) Correlation analysis between amounts of VEGFa present and VEGFR1+ cells. F) Representative low-magnification epifluorescence imaging of control tumor periphery with insets containing high-magnification confocal images of the nuclear marker DAPI, chemokine CXCL12, and chemokine receptor CXCR4. Scale bars, 100 and 50 µm. G) Representative low-magnification epifluorescence imaging of surfen-treated tumor boundaries with insets containing high-magnification confocal images of the nuclear marker DAPI, chemokine CXCL12, and chemokine receptor CXCR4. H, I) Quantification for amount of detectable CXCL12 within both control and surfen-treated tissue (H) and for percentage of CXCR4+ cells within the same tissue (I). J) Colocalization analysis for CXCL12 and CXCR4 between control and surfen-treated tumor tissue. Error bars represent means ± sd. *P < 0.05, Student’s t test followed by Mann-Whitney rank-sum test.

    Article Snippet: Membranes were then washed with 1× TBS and kept in 1× TBS until imaged using a ChemiDoc MP System (Bio-Rad). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Name Company Catalog no. Reference LAR BD Biosciences (San Jose, CA, USA) 610350 56 , 78 RAGE R&D Systems MAB1179 27 , 79 NG1 Thermo Fisher Scientific PA1-41202 26 NG3 R&D Systems AF2920 26 ERK Cell Signaling Technology (Danvers, MA, USA) 9102S 80 pERK Cell Signaling Technology 9101S 80 Akt Cell Signaling Technology 9272S 81 pAkt Cell Signaling Technology 9271S 81 FAK Thermo Fisher Scientific 44-626G 82 Vinculin MilliporeSigma V9131-100 μl 83 GAPDH Abcam ab8245 84 CD133 Miltenyi Biotec 130-113-108 Human-specific but cross-validated in species CS-56 MilliporeSigma C8035 85 Sox1 Abcam ab87775 86 VEGFa Abcam ab46154 87 VEGFR1 Calbiochem (San Diego, CA, USA) PC322L Human-specific but cross-validated in species RECA-1 Bio-Rad MCA970R 88 CXCL12 R&D Systems MAB350 89 CXCR4 Thermo Fisher Scientific 35-8800 Human-specific but cross-validated in species NeuN MilliporeSigma MAB377 90 Goat anti-mouse IgG1 488 Thermo Fisher Scientific A21121 Open in a separate window NeuN, neuronal nuclei; pAkt, phosphorylated Akt; pERK, phosphorylated ERK; RECA-1, rat endothelial cell antigen antiendothelial cell antibody.

    Techniques: Imaging, Marker, MANN-WHITNEY