product image labsoftware (Bio-Rad)

Bio-Rad is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Bio-Rad product image labsoftware
Product Image Labsoftware, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 36188 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/labsoftware/Image+Lab+Software/pm41219538-189-274-273
Average 99 stars, based on 36188 article reviews

product image labsoftware - by Bioz Stars, 2026-09

99/100 stars

Images

Recombinant:

Article Title: CYP51A1 drives resistance to pH-dependent cell death in pancreatic cancer
Article Snippet: Fetal bovine serum Thermo Fisher Scientific Cat# A3840001 Chemicals, peptides, and recombinant proteins 4μ8C Selleck Chemicals Cat# S7272 Bafilomycin A1 Selleck Chemicals Cat# S1413 BCA Thermo Fisher Scientific Cat# 23225 Cell lysis buffer Biosharp Cat# BL509A Crystal violet Solarbio Life Science Cat# C8470 Dulbecco's modified Eagle's medium Thermo Fisher Scientific Cat# 11995073 Enhanced chemiluminescence Thermo Fisher Scientific Cat# 34095 Ferrostatin-1 Selleck Chemicals Cat# S7243 Hydroxychloroquine Selleck Chemicals Cat# S4430 ISRIB Selleck Chemicals Cat# S7400 JTC801 Selleck Chemicals Cat# S2722 Lanosterol Selleck Chemicals Cat# S4755 Lovastatin Selleck Chemicals Cat# S2061 Lipofectamine RNA iMAX Thermo Fisher Scientific Cat# 13778500 LysoTracker Green DND-26 Yeasen Cat# 40738ES50 Melatonin Selleck Chemicals Cat# S1204 MG132 Selleck Chemicals Cat# S2619 MβCD Beyotime Cat# ST1515 NAA Sigma-Aldrich Cat#A4625 Opti-MEM I Gibco Cat# 31985070 Polyacrylamide gel electrophoresis gels Epizyme Cat# PG112 Polyvinylidene difluoride membranes Millipore Cat# IPVH00010 PrimeScript RT Master Mix Takara Cat# RR036A Protease inhibitor ROCHE Cat# 11836153001 Puromycin YEASEN Cat# 60210ES72 RSL3 Selleck Chemicals Cat# S8155 Staurosporine Selleck Chemicals Cat# S1421 Streptomycin/penicillin YEASEN Cat# 60162ES76 TB Green Premix Ex Taq II Takara Cat# RR820Q Thioflavin T Selleck Chemicals Cat# S6873 Thioflavin T Selleck Chemicals Cat# S6873 U18666A Abcam Cat# ab133116 Water-soluble cholesterol Sigma-Aldrich Cat# C4951 BCECF-AM MedChemExpress Cat# HY-101883 Lyso Tracker Green DND-26 Yeasen Cat# 40738ES50 Critical commercial assays Cell Counting Kit-8 YEASEN Cat# 40203ES80 Dual-luciferase reporter gene assay kit Beyotime Cat# RG029S Fluorometric proteasome 20S activity assay kit Apexbio Cat# K2242 ER cholesterol kit Sigma-Aldrich Cat# ER0100 Filipin III cholesterol assay kit Abcam Cat# ab133116 Hoechst 33342 and propidium iodide BestBio Cat# BB-4131-1 pHrodo Green AM fluorescent probe Thermo Fisher Scientific Cat# P35373 Plasma/nuclear protein separation kit Solarbio Life Science Cat# R0050 Plus Micro Kit QIAGEN Cat# 74034 PrimeScript RT Master Mix Takara Cat# RR036A RNeasy Plus Micro Kit QIAGEN Cat# 74034 Total cholesterol kit Sigma-Aldrich Cat# MAK043 Deposited data Lipidomics This paper Mass spectrometry-based drug targets This paper Transcriptome This paper Experimental models: cell lines 293FT cells Thermo Fisher Scientific Cat# R70007 Human PDAC cell line MIAPaCa2 American Type Culture Collection Cat# CRL-1420 Human PDAC cell line PANC1 American Type Culture Collection Cat# CRL-1469 Human PDAC cell line SW1990 American Type Culture Collection Cat# CRL-2172 .. C57BL/6J mice The Jackson Laboratory Cat# 000664 KPC mice David Tuveson N/A NOD-SCID mice The Jackson Laboratory Cat# 001303 Oligonucleotides Primers for various genes This paper Methods section Recombinant DNA Various genes This paper Methods section Software and algorithms Bio-Rad CFX Manager software 2.0 Bio-Rad CFX Manager https://www.biorad.com/en- hk/sku/1845000-cfxmanagersoftware?ID=1845000 GraphPad Prism 8.02 GraphPad https://www.graphpad.c om/ Image J Image J https://imagej.net/softwa re/imagej/ Image Lab 5.2.1 Image Lab https://www.bio- rad.com/en-hk/product/ image-labsoftware?ID=KRE6P5E 8Z ..

Software:

Article Title: Cgref1 is a CREB-H-regulated hepatokine that promotes hepatic de novo lipogenesis by mediating epididymal fat insulin resistance
Article Snippet: .. 79 https://ij.imjoy.io/ Zeiss ZEN Blue (Microscopy Software) Centre For Panoromic Sciences, HKU https://www.zeiss.com/microscopy/en/product s/software/zeiss-zen-desk.html Living Image 4.4 (Compatible with IVIS PE Spectrum) Centre For Panoromic Sciences, HKU Part No. 128113; https://www.perkinelmer.com/uk/product/spec trum-200-living-image-v4series-1-128113 Image Lab Software (Compatible with ChemiDoc MP Imaging System) School of Biomedical Sciences, HKU https://www.bio-rad.com/enhk/product/image-labsoftware?ID=KRE6P5E8Z GE AKTA Purifier 10 FPLC System w/ UV-900 Detector (with Computer and Software) School of Biomedical Sciences, HKU https://www.marshallscientific.com/GE-AKTAPurifier-10-FPLC-System-w-UV-900-Detectop/ak-p10uv.htm Other X-ray Film Super RX-N Fuji Cat# 47410 Microseal 'B' PCR Plate Sealing Film, adhesive, optical Bio-Rad Cat# MSB1001 Amicon® Ultra-15 Centrifugal Filter Unit Millipore Cat# UFC9010 HisTrap HP His tag protein purification column Cytiva Cat# 17524801 3mm Stainless Steel Beads Locally Sourced N/A Accu-Chek Guide Glucose Meter Roche N/A Accu-Chek Guide Test Strips Roche N/A 6 Table S2. ..

other:

Article Title: Local nuclear to cytoplasmic ratio regulates H3.3 incorporation via cell cycle state during zygotic genome activation.
Article Snippet: Reagent/resource Reference or source Identifier or catalog Number y,w; H3.3A-Dendra2, grp1/CyO; Weischaus lab, H3.3A-Dendra2 allele: Amodeo lab y,w;; Weischaus lab BDSC: 1495 nos-PBac Shvartsman Lab Recombinant DNA pScarlessHD- H3.3 AS31ADendra2-DsRed Amodeo lab This paper pScarlessHD- H3.3 ASVMDendra2-DsRed Amodeo lab This paper pScarlessHD- H3.3 AASVMDendra2-DsRed Amodeo lab This paper pU6-BbsI-chiRNA Harrison Lab, O’Connor-Giles Lab, Wildonger Lab Addgene: 45946 pU6-H3.3A-chiRNA Amodeo lab This paper pU6-H3.3A-chiRNA_v2 Amodeo lab This paper Antibodies Anti-H3 Abcam Abcam: ab1791 Anti-H3K9Me3 Abcam Abcam: ab8898 Alexa Fluor 647 donkey antirabbit IgG Invitrogen Invitrogen: A31573 Oligonucleotides and other sequence-based reagents Guide-RNA for chimeras_1: GCGCGTCACCATTATGCCCA Amodeo lab This paper Guide-RNA for chimeras_2: GCAAGGCGCCCCGCAAGCAGC Amodeo lab This paper TaqMan gene expression array: Slbp (FAM) Applied Biosystems Applied Biosystems: Dm02135120_g1 TaqMan gene expression array: zld (FAM) Applied Biosystems Applied Biosystems: Dm01845528_s1 TaqMan gene expression array: His3.3A (FAM) Applied Biosystems Applied Biosystems: Dm02538716_s1 TaqMan gene expression array: His3.3B (FAM) Applied Biosystems Applied Biosystems: Dm02330817_gH TaqMan gene expression array: Hira (FAM) Applied Biosystems Applied Biosystems: Dm01833585_g1 TaqMan gene expression array: Gapdh2 (VIC) Applied Biosystems Applied Biosystems: Dm01843776_s1 Chemicals, enzymes, and other reagents Protease inhibitor cocktail Sigma Sigma: P2714 Hoechst 33342 Thermo Scientific Thermo Scientific: 62249 EverBrite mounting medium Biotium Biotium: 23001 Halocarbon oil Sigma Sigma: H8773 TGX Stain-FreeTM FastCastTM Acrylamide Kit, 12% Bio-Rad Bio-Rad: 1610185 PicoPureTM RNA Isolation Kit Applied Biosystems Applied Biosystems: KIT0204 ProtoScript First Strand cDNA Synthesis Kit New England Biolabs New England Biolabs: E6560L Reagent/resource Reference or source Identifier or catalog Number TaqMan GEX master mix Applied Biosystems Applied Biosystems: 4369016 Software Ilastik-1.4.0 Open source https:// www.ilastik.org Fiji (2.14.0/1.54 f) Open source https://fiji.sc/ Zen 3.3 (Blue edition) Zeiss R Open source https://www.rproject.org Image lab Bio-Rad http://www.biorad.com/en-us/ product/image-labsoftware?

Microscopy:

Imaging:

Fast Protein Liquid Chromatography:

Polymerase Chain Reaction:

Adhesive:

Protein Purification:

SDS Page:

Article Title: CODANIN-1 sequesters ASF1 by using a histone H3 mimic helix to regulate the histone supply.
Article Snippet: .. SDS-PAGE was carried out using a 12% acrylamide gel, and the gel intensitywasmeasured using Image LabSoftware (Bio-Rad). .. We employed purified 6xHis-tagged ASF1A1-172 as the ligand and CODANIN-1 variants, including wild type andmutants: Mut1 (BD-Nmut), Mut2 (HMH-Nmut), Mut3 (HMH-Cmut),Mut4 (BD-Cmut),Mut5 (BD-Nmut / HMH-Nmut), Mut6 (HMH-Cmut / BD-Cmut), Mut7 (BD-Nmut / HMH-Cmut), Mut8 (BD-Nmut / BD-Cmut), and Mut9 (HMH-Nmut / HMH-Cmut) as analytes.

Acrylamide Gel Assay:

Molecular Weight:

Article Title: Structural basis of ubiquitin ligase Nedd4-2 autoinhibition and regulation by calcium and 14-3-3 proteins.
Article Snippet: .. The polyubiquitinated products werequantifiedusing Image Labsoftware v6.1.0 (Bio-RadLaboratories, Inc., Hercules, CA, USA) by measuring the density of bands with a molecular weight equal to or greater than that of Nedd4-2 with 1 ubiquitin molecule. .. Subsequently, the gels were stained with Coomassie brilliant blue and scanned using a Fusion Solo S scanner (Vilber Lourmat).

Review