Journal: bioRxiv
Article Title: A fusion Cell-Permeable C16orf74 Peptide Selectively Disrupts Calcineurin-NFAT Interaction and Inhibits T-cell Activation Without Cytotoxicity
doi: 10.64898/2026.05.21.726749
Figure Lengend Snippet: (A) Evaluation of NFAT transcriptional activity using an immune co-culture bioassay. Jurkat T cells stably expressing a luciferase reporter under the control of an NFAT-response element were co-cultured with Raji antigen-presenting cells. Cells were treated with vehicle (activated cells), the positive control CsA (150 nM), or the peptide conjugates R11-C16 or TAT-C16 (10 µM). Luminescence was measured and is expressed relative to the activated control. Data are presented as mean ± SD of independent replicates. ****P<0.001; ***P<0.005; ns – non significant. (B) Quantitative RT-PCR analysis of IL-2 gene expression in Jurkat T cells. Cells were pre-treated with R11-C16 or CsA for 1.5 hours, followed by stimulation with PMA and ionomycin for 6 hours. Results are expressed as log fold change relative to unstimulated cells ("Cells only"). Data are presented as mean ± SD. ****P<0.001; ***P<0.005; ns – non significant.
Article Snippet: Primer sequences were obtained from OriGene: RPLP0 forward: TGGTCATCCAGCAGGTGTTCGA RPLP0 reverse: ACAGACACTGGCAACATTGCGG IL-2 forward: AGAACTCAAACCTCTGGAGGAAG IL-2 reverse: GCTGTCTCATCAGCATATTCACAC Gene expression was calculated as log2 fold change and normalized to the activation control (PMA + ionomycin) within each experiment.
Techniques: Activity Assay, Co-Culture Assay, Bioassay, Stable Transfection, Expressing, Luciferase, Control, Cell Culture, Positive Control, Quantitative RT-PCR, Gene Expression
