Review



hspp1  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    TaKaRa hspp1
    Hspp1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hspp1/10__1074_slash_jbc__m109968200-56-4-11
    Average 86 stars, based on 1 article reviews
    hspp1 - by Bioz Stars, 2026-10
    86/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Characterization of Murine Sphingosine-1-phosphate Phosphohydrolase
    Article Snippet: .. The 3 -end of hSPP1 was amplified from human placental cDNA (CLONTECH) using primers 5 - GGAAGTGGTGCTGGAATTGCATG and 5 -GCCTCCCATGTTCAACATCATGG, and an 830-bp BamHI-EcoRI fragment was isolated from the cloned PCR product. ..

    Isolation:

    Article Title: Characterization of Murine Sphingosine-1-phosphate Phosphohydrolase
    Article Snippet: .. The 3 -end of hSPP1 was amplified from human placental cDNA (CLONTECH) using primers 5 - GGAAGTGGTGCTGGAATTGCATG and 5 -GCCTCCCATGTTCAACATCATGG, and an 830-bp BamHI-EcoRI fragment was isolated from the cloned PCR product. ..

    Clone Assay:

    Article Title: Characterization of Murine Sphingosine-1-phosphate Phosphohydrolase
    Article Snippet: .. The 3 -end of hSPP1 was amplified from human placental cDNA (CLONTECH) using primers 5 - GGAAGTGGTGCTGGAATTGCATG and 5 -GCCTCCCATGTTCAACATCATGG, and an 830-bp BamHI-EcoRI fragment was isolated from the cloned PCR product. ..

    Polymerase Chain Reaction:

    Article Title: Characterization of Murine Sphingosine-1-phosphate Phosphohydrolase
    Article Snippet: .. The 3 -end of hSPP1 was amplified from human placental cDNA (CLONTECH) using primers 5 - GGAAGTGGTGCTGGAATTGCATG and 5 -GCCTCCCATGTTCAACATCATGG, and an 830-bp BamHI-EcoRI fragment was isolated from the cloned PCR product. ..



    Similar Products

    hspp1  (TaKaRa)
    86
    TaKaRa hspp1
    Hspp1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hspp1/10__1074_slash_jbc__m109968200-56-4-11
    Average 86 stars, based on 1 article reviews
    hspp1 - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    hspp1  (R&D Systems)
    93
    R&D Systems hspp1
    Hspp1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hspp1/Human+Osteopontin%2FOPN+Antibody/pm33734599-105-88-91
    Average 93 stars, based on 1 article reviews
    hspp1 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    10male hspp1 and 10c57bl/6jrj (wt) mice  (Janvier Labs)
    90
    Janvier Labs 10male hspp1 and 10c57bl/6jrj (wt) mice
    10male Hspp1 And 10c57bl/6jrj (Wt) Mice, supplied by Janvier Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hspp1/10male+hspp1+and+10c57bl+6jrj++wt++mice/pm27490454-62-3-10
    Average 90 stars, based on 1 article reviews
    10male hspp1 and 10c57bl/6jrj (wt) mice - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    plasmid hspp1-pcdna3.1  (Qiagen)
    90
    Qiagen plasmid hspp1-pcdna3.1
    Plasmid Hspp1 Pcdna3.1, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hspp1/pcdna3+1/us07374889-383-12-16
    Average 90 stars, based on 1 article reviews
    plasmid hspp1-pcdna3.1 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results