Review




Structured Review

AnaSpec g2ct
Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: <t>G2CT).</t> C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).
G2ct, supplied by AnaSpec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/g2ct/inactive+control+g2ct+variant/pmc06601735-83-1-11
Average 90 stars, based on 1 article reviews
g2ct - by Bioz Stars, 2026-09
90/100 stars

Images

1) Product Images from "Blocking Synaptic Removal of GluA2-Containing AMPA Receptors Prevents the Natural Forgetting of Long-Term Memories"

Article Title: Blocking Synaptic Removal of GluA2-Containing AMPA Receptors Prevents the Natural Forgetting of Long-Term Memories

Journal: The Journal of Neuroscience

doi: 10.1523/JNEUROSCI.3333-15.2016

Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: G2CT). C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).
Figure Legend Snippet: Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: G2CT). C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).

Techniques Used:

Interfering with AP2-dependent GluA2/AMPAR removal and delayed onset of GluA23Y infusions prevent forgetting of long-term object location memories. A–C, Inhibiting AP2-dependent synaptic removal of GluA2/AMPARs prevents forgetting (see Fig. 8B for cannula placements). A, Animals were trained as before (Fig. 1D), but instead of GluA23Y, the peptide G2CT (n = 7, inactive control peptide, Ctrl, n = 7) was infused to interfere with the binding of AP2 to GluA2 to attenuate activity-dependent synaptic removal of GluA2/AMPARs. B, Only animals infused with G2CT preferred exploring the object at the new location, expressing significantly stronger novelty preference than the animals infused with the inactive control peptide (Ctrl). C, There were no group differences in exploratory activity. D–F, Infusing GluA23Y can prolong remote memories shortly before they would be naturally forgotten (see Fig. 8C for cannula placements). D, Seven days after the last training session (i.e., on day 8 after training), shortly before rats normally would forget the location memory (see Fig. 1A–C), animals received GluA23Y infusions into the dorsal hippocampus twice daily for 6 d. Twenty-four hours after the last infusion (or 14 d after the end of training), memory for object location was assessed by moving one of the objects to a novel location. E, Animals infused with GluA23Y (n = 7) preferred to explore the object at the new location, whereas animals that had received the inactive control variant (Ctrl, n = 6) explored both objects for an equal amount of time. The group difference was significant. F, Exploratory activity was the same for both groups.
Figure Legend Snippet: Interfering with AP2-dependent GluA2/AMPAR removal and delayed onset of GluA23Y infusions prevent forgetting of long-term object location memories. A–C, Inhibiting AP2-dependent synaptic removal of GluA2/AMPARs prevents forgetting (see Fig. 8B for cannula placements). A, Animals were trained as before (Fig. 1D), but instead of GluA23Y, the peptide G2CT (n = 7, inactive control peptide, Ctrl, n = 7) was infused to interfere with the binding of AP2 to GluA2 to attenuate activity-dependent synaptic removal of GluA2/AMPARs. B, Only animals infused with G2CT preferred exploring the object at the new location, expressing significantly stronger novelty preference than the animals infused with the inactive control peptide (Ctrl). C, There were no group differences in exploratory activity. D–F, Infusing GluA23Y can prolong remote memories shortly before they would be naturally forgotten (see Fig. 8C for cannula placements). D, Seven days after the last training session (i.e., on day 8 after training), shortly before rats normally would forget the location memory (see Fig. 1A–C), animals received GluA23Y infusions into the dorsal hippocampus twice daily for 6 d. Twenty-four hours after the last infusion (or 14 d after the end of training), memory for object location was assessed by moving one of the objects to a novel location. E, Animals infused with GluA23Y (n = 7) preferred to explore the object at the new location, whereas animals that had received the inactive control variant (Ctrl, n = 6) explored both objects for an equal amount of time. The group difference was significant. F, Exploratory activity was the same for both groups.

Techniques Used: Binding Assay, Activity Assay, Expressing, Variant Assay

Exploratory behavior during training sessions
Figure Legend Snippet: Exploratory behavior during training sessions

Techniques Used:

Related Articles

Control:

Article Title: Blocking Synaptic Removal of GluA2-Containing AMPA Receptors Prevents the Natural Forgetting of Long-Term Memories
Article Snippet: .. The peptides G2CT and inactive control G2CT variant were purchased from AnaSpec. ..

Variant Assay:

Article Title: Blocking Synaptic Removal of GluA2-Containing AMPA Receptors Prevents the Natural Forgetting of Long-Term Memories
Article Snippet: .. The peptides G2CT and inactive control G2CT variant were purchased from AnaSpec. ..



Similar Products

91
Addgene inc g2ct
LTD induced by LFS ( a ) and LTP induced by HFS ( b ) in the hippocampal CA1 region of 8-week-old mice; quantification on the right shows fEPSPs at 50–60 min after LFS or HFS normalized to the pre-stimulation baseline; one-way ANOVA was used for comparison across groups ( p = 3.8 × 10 −28 ) and Student–Newman–Keuls test for comparison with the Cre − group. c The input-output relationship. d Paired-pulse ratio. e – g Open field test. h Elevated zero maze test. i Light/dark box test. j The percentage of time spent in freezing before and after each CS-US pairing. k Cued fear memory tested at 24 h after fear conditioning. l Contextual fear memory tested at 24 h after fear conditioning; two-way ANOVA was used for statistical analysis ( p = 0.005 for interaction between the effects of genotype and test on freezing; p = 0.004 for the simple main effect of Cre − vs. Cre + in the contextual test). m Contextual fear memory tested at 1 h after fear conditioning. n, o Fear conditioning training and contextual memory test at 2 weeks after cannula implantation in the dorsal hippocampal CA1 region of WT mice. CQ was infused through the implanted cannula at 30 min before the contextual fear memory test. p – u Mice were injected with AAV expressing <t>G2CT</t> or scrambled peptides and tested at 3 weeks after injection for contextual fear memory ( p ; two-way ANOVA was used for statistical analysis; p = 0.158 for interaction between the effects of genotype and virus on freezing; p = 0.032 for the main effect of virus; p = 0.021 for the comparison between scramble vs. G2CT within Cre + using Student–Newman–Keuls test), open field test ( q – s ), elevated zero maze test ( t ) or light/dark box test ( u ). Data show mean ± SEM; * p < 0.05, ** p < 0.01, *** p < 0.001; no adjustments were made for multiple comparisons; n indicates the number of slices in a – d (one slice from each animal) and the number of animals in e – u . Source data are provided as a Source Data file.
G2ct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/g2ct/pAAV+CaMKIIa+iChloC+2A+tDimer+(Plasmid+%2366709)/pmc07293213-7-0-2
Average 91 stars, based on 1 article reviews
g2ct - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

90
AnaSpec g2ct
Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: <t>G2CT).</t> C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).
G2ct, supplied by AnaSpec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/g2ct/inactive+control+g2ct+variant/pmc06601735-83-1-11
Average 90 stars, based on 1 article reviews
g2ct - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
AnaSpec peptides g2ct
Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: <t>G2CT).</t> C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).
Peptides G2ct, supplied by AnaSpec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/g2ct/inactive+control+g2ct+variant/10__1523_slash_jneurosci__3333___15__2016-57-1-11
Average 90 stars, based on 1 article reviews
peptides g2ct - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
AnaSpec inactive control g2ct variant
Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: <t>G2CT).</t> C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).
Inactive Control G2ct Variant, supplied by AnaSpec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/g2ct/inactive+control+g2ct+variant/10__1523_slash_jneurosci__3333___15__2016-57-4-11
Average 90 stars, based on 1 article reviews
inactive control g2ct variant - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


LTD induced by LFS ( a ) and LTP induced by HFS ( b ) in the hippocampal CA1 region of 8-week-old mice; quantification on the right shows fEPSPs at 50–60 min after LFS or HFS normalized to the pre-stimulation baseline; one-way ANOVA was used for comparison across groups ( p = 3.8 × 10 −28 ) and Student–Newman–Keuls test for comparison with the Cre − group. c The input-output relationship. d Paired-pulse ratio. e – g Open field test. h Elevated zero maze test. i Light/dark box test. j The percentage of time spent in freezing before and after each CS-US pairing. k Cued fear memory tested at 24 h after fear conditioning. l Contextual fear memory tested at 24 h after fear conditioning; two-way ANOVA was used for statistical analysis ( p = 0.005 for interaction between the effects of genotype and test on freezing; p = 0.004 for the simple main effect of Cre − vs. Cre + in the contextual test). m Contextual fear memory tested at 1 h after fear conditioning. n, o Fear conditioning training and contextual memory test at 2 weeks after cannula implantation in the dorsal hippocampal CA1 region of WT mice. CQ was infused through the implanted cannula at 30 min before the contextual fear memory test. p – u Mice were injected with AAV expressing G2CT or scrambled peptides and tested at 3 weeks after injection for contextual fear memory ( p ; two-way ANOVA was used for statistical analysis; p = 0.158 for interaction between the effects of genotype and virus on freezing; p = 0.032 for the main effect of virus; p = 0.021 for the comparison between scramble vs. G2CT within Cre + using Student–Newman–Keuls test), open field test ( q – s ), elevated zero maze test ( t ) or light/dark box test ( u ). Data show mean ± SEM; * p < 0.05, ** p < 0.01, *** p < 0.001; no adjustments were made for multiple comparisons; n indicates the number of slices in a – d (one slice from each animal) and the number of animals in e – u . Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: Autophagy controls the induction and developmental decline of NMDAR-LTD through endocytic recycling

doi: 10.1038/s41467-020-16794-5

Figure Lengend Snippet: LTD induced by LFS ( a ) and LTP induced by HFS ( b ) in the hippocampal CA1 region of 8-week-old mice; quantification on the right shows fEPSPs at 50–60 min after LFS or HFS normalized to the pre-stimulation baseline; one-way ANOVA was used for comparison across groups ( p = 3.8 × 10 −28 ) and Student–Newman–Keuls test for comparison with the Cre − group. c The input-output relationship. d Paired-pulse ratio. e – g Open field test. h Elevated zero maze test. i Light/dark box test. j The percentage of time spent in freezing before and after each CS-US pairing. k Cued fear memory tested at 24 h after fear conditioning. l Contextual fear memory tested at 24 h after fear conditioning; two-way ANOVA was used for statistical analysis ( p = 0.005 for interaction between the effects of genotype and test on freezing; p = 0.004 for the simple main effect of Cre − vs. Cre + in the contextual test). m Contextual fear memory tested at 1 h after fear conditioning. n, o Fear conditioning training and contextual memory test at 2 weeks after cannula implantation in the dorsal hippocampal CA1 region of WT mice. CQ was infused through the implanted cannula at 30 min before the contextual fear memory test. p – u Mice were injected with AAV expressing G2CT or scrambled peptides and tested at 3 weeks after injection for contextual fear memory ( p ; two-way ANOVA was used for statistical analysis; p = 0.158 for interaction between the effects of genotype and virus on freezing; p = 0.032 for the main effect of virus; p = 0.021 for the comparison between scramble vs. G2CT within Cre + using Student–Newman–Keuls test), open field test ( q – s ), elevated zero maze test ( t ) or light/dark box test ( u ). Data show mean ± SEM; * p < 0.05, ** p < 0.01, *** p < 0.001; no adjustments were made for multiple comparisons; n indicates the number of slices in a – d (one slice from each animal) and the number of animals in e – u . Source data are provided as a Source Data file.

Article Snippet: G2CT , Addgene, #66709 , EcoRI/Kpnl , F - CCGGAATTCAAGCGGATGAAGCTGAACATCAACCCTAGC R – CGGGGTACCGCTAGGGTTGATGTTCAGCTTCATCCGCTT.

Techniques: Comparison, Injection, Expressing, Virus

Journal: Nature Communications

Article Title: Autophagy controls the induction and developmental decline of NMDAR-LTD through endocytic recycling

doi: 10.1038/s41467-020-16794-5

Figure Lengend Snippet:

Article Snippet: G2CT , Addgene, #66709 , EcoRI/Kpnl , F - CCGGAATTCAAGCGGATGAAGCTGAACATCAACCCTAGC R – CGGGGTACCGCTAGGGTTGATGTTCAGCTTCATCCGCTT.

Techniques: Plasmid Preparation, Mutagenesis

Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: G2CT). C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).

Journal: The Journal of Neuroscience

Article Title: Blocking Synaptic Removal of GluA2-Containing AMPA Receptors Prevents the Natural Forgetting of Long-Term Memories

doi: 10.1523/JNEUROSCI.3333-15.2016

Figure Lengend Snippet: Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: G2CT). C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).

Article Snippet: The peptides G2CT and inactive control G2CT variant were purchased from AnaSpec.

Techniques:

Interfering with AP2-dependent GluA2/AMPAR removal and delayed onset of GluA23Y infusions prevent forgetting of long-term object location memories. A–C, Inhibiting AP2-dependent synaptic removal of GluA2/AMPARs prevents forgetting (see Fig. 8B for cannula placements). A, Animals were trained as before (Fig. 1D), but instead of GluA23Y, the peptide G2CT (n = 7, inactive control peptide, Ctrl, n = 7) was infused to interfere with the binding of AP2 to GluA2 to attenuate activity-dependent synaptic removal of GluA2/AMPARs. B, Only animals infused with G2CT preferred exploring the object at the new location, expressing significantly stronger novelty preference than the animals infused with the inactive control peptide (Ctrl). C, There were no group differences in exploratory activity. D–F, Infusing GluA23Y can prolong remote memories shortly before they would be naturally forgotten (see Fig. 8C for cannula placements). D, Seven days after the last training session (i.e., on day 8 after training), shortly before rats normally would forget the location memory (see Fig. 1A–C), animals received GluA23Y infusions into the dorsal hippocampus twice daily for 6 d. Twenty-four hours after the last infusion (or 14 d after the end of training), memory for object location was assessed by moving one of the objects to a novel location. E, Animals infused with GluA23Y (n = 7) preferred to explore the object at the new location, whereas animals that had received the inactive control variant (Ctrl, n = 6) explored both objects for an equal amount of time. The group difference was significant. F, Exploratory activity was the same for both groups.

Journal: The Journal of Neuroscience

Article Title: Blocking Synaptic Removal of GluA2-Containing AMPA Receptors Prevents the Natural Forgetting of Long-Term Memories

doi: 10.1523/JNEUROSCI.3333-15.2016

Figure Lengend Snippet: Interfering with AP2-dependent GluA2/AMPAR removal and delayed onset of GluA23Y infusions prevent forgetting of long-term object location memories. A–C, Inhibiting AP2-dependent synaptic removal of GluA2/AMPARs prevents forgetting (see Fig. 8B for cannula placements). A, Animals were trained as before (Fig. 1D), but instead of GluA23Y, the peptide G2CT (n = 7, inactive control peptide, Ctrl, n = 7) was infused to interfere with the binding of AP2 to GluA2 to attenuate activity-dependent synaptic removal of GluA2/AMPARs. B, Only animals infused with G2CT preferred exploring the object at the new location, expressing significantly stronger novelty preference than the animals infused with the inactive control peptide (Ctrl). C, There were no group differences in exploratory activity. D–F, Infusing GluA23Y can prolong remote memories shortly before they would be naturally forgotten (see Fig. 8C for cannula placements). D, Seven days after the last training session (i.e., on day 8 after training), shortly before rats normally would forget the location memory (see Fig. 1A–C), animals received GluA23Y infusions into the dorsal hippocampus twice daily for 6 d. Twenty-four hours after the last infusion (or 14 d after the end of training), memory for object location was assessed by moving one of the objects to a novel location. E, Animals infused with GluA23Y (n = 7) preferred to explore the object at the new location, whereas animals that had received the inactive control variant (Ctrl, n = 6) explored both objects for an equal amount of time. The group difference was significant. F, Exploratory activity was the same for both groups.

Article Snippet: The peptides G2CT and inactive control G2CT variant were purchased from AnaSpec.

Techniques: Binding Assay, Activity Assay, Expressing, Variant Assay

Exploratory behavior during training sessions

Journal: The Journal of Neuroscience

Article Title: Blocking Synaptic Removal of GluA2-Containing AMPA Receptors Prevents the Natural Forgetting of Long-Term Memories

doi: 10.1523/JNEUROSCI.3333-15.2016

Figure Lengend Snippet: Exploratory behavior during training sessions

Article Snippet: The peptides G2CT and inactive control G2CT variant were purchased from AnaSpec.

Techniques: