Review




Structured Review

Proteintech dio2
Dio2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dio2/product/Proteintech
Average 93 stars, based on 25 article reviews
dio2 - by Bioz Stars, 2026-02
93/100 stars

Images



Similar Products

92
Thermo Fisher gene exp dio2 mm00515664 m1
Relative gene expression of A, type 3 deiodinase ( Dio3 ); B, <t>type</t> <t>2</t> <t>deiodinase</t> ( <t>Dio2</t> ); C, thyroid hormone transporter 8 ( Mct8 ); and D, thyroid hormone transporter 10 ( Mct10 ) in male and female mice subjected to sham surgery or 12 weeks post myocardial infarction (MI). Gene expression levels are normalized to the housekeeping gene RPL4 . Values are expressed as mean ± SEM, with individual data points shown. Statistical analyses were performed using 2-way analysis of variance with sex and MI status (sham vs MI) as factors, followed by Tukey post hoc test for multiple comparisons. Statistical significance is indicated as follows: a and b, for significant Tukey post hoc comparisons for sex and MI; c, for the main effect of MI; d, for the main effect of sex ( P < .05).
Gene Exp Dio2 Mm00515664 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp dio2 mm00515664 m1/product/Thermo Fisher
Average 92 stars, based on 1 article reviews
gene exp dio2 mm00515664 m1 - by Bioz Stars, 2026-02
92/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp dio2 rn00581867 m1
Relative expression of ( A ) Dio1 , ( B ) <t>Dio2</t> , ( C ) Slc5a5 (NIS), and ( D ) Tpo genes in the thyroid gland of experimental rats. Results are presented as mean ± standard deviation (n = 7). Bars marked with different letters differ significantly at p ≤ 0.05. Description of experimental groups: Group #1 —rats fed the AIN-93G (control) diet; Group #2 —rats fed the AIN-93G diet with the addition of lyophilized non-biofortified lettuce, with KI from the mineral mixture providing iodine in the amount recommended for this diet; Group #3 , #4 , #5 —rats fed the AIN-93G diet with the addition of lyophilized iodine-biofortified lettuce in the form of potassium iodate (Group #3), 8-hydroxy-7-iodo-5-quinolinesulfonic acid (Group #4), and 5,7-diiodo-8-quinolinol (Group #5), providing iodine in the amount recommended for this diet; Group #6 , #7 , #8 —rats fed the AIN-93G diet with the addition of lyophilized iodine-biofortified lettuce in the form of potassium iodate (Group #6), 8-hydroxy-7-iodo-5-quinolinesulfonic acid (Group #7), and 5,7-diiodo-8-quinolinol (Group #8), providing iodine in an amount twice that recommended for this diet.
Gene Exp Dio2 Rn00581867 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp dio2 rn00581867 m1/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
gene exp dio2 rn00581867 m1 - by Bioz Stars, 2026-02
86/100 stars
  Buy from Supplier

93
Proteintech dio2
Relative expression of ( A ) Dio1 , ( B ) <t>Dio2</t> , ( C ) Slc5a5 (NIS), and ( D ) Tpo genes in the thyroid gland of experimental rats. Results are presented as mean ± standard deviation (n = 7). Bars marked with different letters differ significantly at p ≤ 0.05. Description of experimental groups: Group #1 —rats fed the AIN-93G (control) diet; Group #2 —rats fed the AIN-93G diet with the addition of lyophilized non-biofortified lettuce, with KI from the mineral mixture providing iodine in the amount recommended for this diet; Group #3 , #4 , #5 —rats fed the AIN-93G diet with the addition of lyophilized iodine-biofortified lettuce in the form of potassium iodate (Group #3), 8-hydroxy-7-iodo-5-quinolinesulfonic acid (Group #4), and 5,7-diiodo-8-quinolinol (Group #5), providing iodine in the amount recommended for this diet; Group #6 , #7 , #8 —rats fed the AIN-93G diet with the addition of lyophilized iodine-biofortified lettuce in the form of potassium iodate (Group #6), 8-hydroxy-7-iodo-5-quinolinesulfonic acid (Group #7), and 5,7-diiodo-8-quinolinol (Group #8), providing iodine in an amount twice that recommended for this diet.
Dio2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dio2/product/Proteintech
Average 93 stars, based on 1 article reviews
dio2 - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

94
Thermo Fisher gene exp dio2 gg03362313 m1
Expression levels of <t>DIO2</t> mRNA in chicken hens. (A) Internal organs: Lu - lungs, H - heart, L - liver, K - kidney, Sp - spleen, P – pancreas. (B) Other tissues: Hyp - hypothalamus, Pit - pituitary gland, St - stomach, SI- small intestine, SM - skeletal muscles, AT - adipose tissue, Sk – skin. (C) Ovary: SWF – small white follicles 1–4 mm, LWF – large white follicles 4–8 mm, the granulosa and theca layer of preovulatory follicles F3−F1. (D) Oviduct: I - infundibulum, M - magnum, Is - isthmus, SG - shell gland, V - vagina. Each value represents the mean of the normalised relative quantity ± SEM ( n = 8), normalised to hypoxanthine phosphoribosyltransferase as a reference gene and standardised to the DIO2 mRNA expression in the thyroid gland as a control tissue. Values ​​marked with different letters are significantly different ( P < 0.05); one-way analysis of variance with Tukey’s post-hoc test.
Gene Exp Dio2 Gg03362313 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp dio2 gg03362313 m1/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
gene exp dio2 gg03362313 m1 - by Bioz Stars, 2026-02
94/100 stars
  Buy from Supplier

Image Search Results


Relative gene expression of A, type 3 deiodinase ( Dio3 ); B, type 2 deiodinase ( Dio2 ); C, thyroid hormone transporter 8 ( Mct8 ); and D, thyroid hormone transporter 10 ( Mct10 ) in male and female mice subjected to sham surgery or 12 weeks post myocardial infarction (MI). Gene expression levels are normalized to the housekeeping gene RPL4 . Values are expressed as mean ± SEM, with individual data points shown. Statistical analyses were performed using 2-way analysis of variance with sex and MI status (sham vs MI) as factors, followed by Tukey post hoc test for multiple comparisons. Statistical significance is indicated as follows: a and b, for significant Tukey post hoc comparisons for sex and MI; c, for the main effect of MI; d, for the main effect of sex ( P < .05).

Journal: Endocrinology

Article Title: Activity of Cardiomyocyte Type 3 Deiodinase After Myocardial Infarction Influences Cardiac Recovery in Females

doi: 10.1210/endocr/bqaf181

Figure Lengend Snippet: Relative gene expression of A, type 3 deiodinase ( Dio3 ); B, type 2 deiodinase ( Dio2 ); C, thyroid hormone transporter 8 ( Mct8 ); and D, thyroid hormone transporter 10 ( Mct10 ) in male and female mice subjected to sham surgery or 12 weeks post myocardial infarction (MI). Gene expression levels are normalized to the housekeeping gene RPL4 . Values are expressed as mean ± SEM, with individual data points shown. Statistical analyses were performed using 2-way analysis of variance with sex and MI status (sham vs MI) as factors, followed by Tukey post hoc test for multiple comparisons. Statistical significance is indicated as follows: a and b, for significant Tukey post hoc comparisons for sex and MI; c, for the main effect of MI; d, for the main effect of sex ( P < .05).

Article Snippet: The following gene-specific TaqMan assays were used: Dio3 (Mm00548953_s1), Dio2 (Mm00515664_m1), Mct8 (Mm00486204_m1), and Mct10 (Mm00661045_m1).

Techniques: Gene Expression

Relative expression of ( A ) Dio1 , ( B ) Dio2 , ( C ) Slc5a5 (NIS), and ( D ) Tpo genes in the thyroid gland of experimental rats. Results are presented as mean ± standard deviation (n = 7). Bars marked with different letters differ significantly at p ≤ 0.05. Description of experimental groups: Group #1 —rats fed the AIN-93G (control) diet; Group #2 —rats fed the AIN-93G diet with the addition of lyophilized non-biofortified lettuce, with KI from the mineral mixture providing iodine in the amount recommended for this diet; Group #3 , #4 , #5 —rats fed the AIN-93G diet with the addition of lyophilized iodine-biofortified lettuce in the form of potassium iodate (Group #3), 8-hydroxy-7-iodo-5-quinolinesulfonic acid (Group #4), and 5,7-diiodo-8-quinolinol (Group #5), providing iodine in the amount recommended for this diet; Group #6 , #7 , #8 —rats fed the AIN-93G diet with the addition of lyophilized iodine-biofortified lettuce in the form of potassium iodate (Group #6), 8-hydroxy-7-iodo-5-quinolinesulfonic acid (Group #7), and 5,7-diiodo-8-quinolinol (Group #8), providing iodine in an amount twice that recommended for this diet.

Journal: Nutrients

Article Title: Iodoquinoline-Biofortified Lettuce as a Safe and Bioavailable Dietary Iodine Source: In Vivo Study in Rats

doi: 10.3390/nu18010036

Figure Lengend Snippet: Relative expression of ( A ) Dio1 , ( B ) Dio2 , ( C ) Slc5a5 (NIS), and ( D ) Tpo genes in the thyroid gland of experimental rats. Results are presented as mean ± standard deviation (n = 7). Bars marked with different letters differ significantly at p ≤ 0.05. Description of experimental groups: Group #1 —rats fed the AIN-93G (control) diet; Group #2 —rats fed the AIN-93G diet with the addition of lyophilized non-biofortified lettuce, with KI from the mineral mixture providing iodine in the amount recommended for this diet; Group #3 , #4 , #5 —rats fed the AIN-93G diet with the addition of lyophilized iodine-biofortified lettuce in the form of potassium iodate (Group #3), 8-hydroxy-7-iodo-5-quinolinesulfonic acid (Group #4), and 5,7-diiodo-8-quinolinol (Group #5), providing iodine in the amount recommended for this diet; Group #6 , #7 , #8 —rats fed the AIN-93G diet with the addition of lyophilized iodine-biofortified lettuce in the form of potassium iodate (Group #6), 8-hydroxy-7-iodo-5-quinolinesulfonic acid (Group #7), and 5,7-diiodo-8-quinolinol (Group #8), providing iodine in an amount twice that recommended for this diet.

Article Snippet: Quantitative real-time PCR (qPCR) was performed to assess gene expression levels using TaqMan ® Gene Expression Assays (Thermo Fisher Scientific) specific for the following rat genes: Dio1 (Rn00572183_m1), Dio2 (Rn00581867_m1), Slc5a5 (Rn00583900_m1), and Tpo (Rn00571159_m1).

Techniques: Expressing, Standard Deviation, Control

Expression levels of DIO2 mRNA in chicken hens. (A) Internal organs: Lu - lungs, H - heart, L - liver, K - kidney, Sp - spleen, P – pancreas. (B) Other tissues: Hyp - hypothalamus, Pit - pituitary gland, St - stomach, SI- small intestine, SM - skeletal muscles, AT - adipose tissue, Sk – skin. (C) Ovary: SWF – small white follicles 1–4 mm, LWF – large white follicles 4–8 mm, the granulosa and theca layer of preovulatory follicles F3−F1. (D) Oviduct: I - infundibulum, M - magnum, Is - isthmus, SG - shell gland, V - vagina. Each value represents the mean of the normalised relative quantity ± SEM ( n = 8), normalised to hypoxanthine phosphoribosyltransferase as a reference gene and standardised to the DIO2 mRNA expression in the thyroid gland as a control tissue. Values ​​marked with different letters are significantly different ( P < 0.05); one-way analysis of variance with Tukey’s post-hoc test.

Journal: Poultry Science

Article Title: Expression profile of thyroid hormone deiodinases in the adult laying hen ( Gallus gallus domesticus )

doi: 10.1016/j.psj.2025.106079

Figure Lengend Snippet: Expression levels of DIO2 mRNA in chicken hens. (A) Internal organs: Lu - lungs, H - heart, L - liver, K - kidney, Sp - spleen, P – pancreas. (B) Other tissues: Hyp - hypothalamus, Pit - pituitary gland, St - stomach, SI- small intestine, SM - skeletal muscles, AT - adipose tissue, Sk – skin. (C) Ovary: SWF – small white follicles 1–4 mm, LWF – large white follicles 4–8 mm, the granulosa and theca layer of preovulatory follicles F3−F1. (D) Oviduct: I - infundibulum, M - magnum, Is - isthmus, SG - shell gland, V - vagina. Each value represents the mean of the normalised relative quantity ± SEM ( n = 8), normalised to hypoxanthine phosphoribosyltransferase as a reference gene and standardised to the DIO2 mRNA expression in the thyroid gland as a control tissue. Values ​​marked with different letters are significantly different ( P < 0.05); one-way analysis of variance with Tukey’s post-hoc test.

Article Snippet: DIO2 , Deiodinase, iodothyronine type II , Gg03362313_m1 , ACAAGCAGGTCAAACTTGGAGGAGA , 76.

Techniques: Expressing, Muscles, Control