|
MedChemExpress
caxii Caxii, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/pm42008867-79-30-41?v=MedChemExpress Average 91 stars, based on 1 article reviews
caxii - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
MedChemExpress
ca12/carbonic anhydrase 12, human Ca12/Carbonic Anhydrase 12, Human, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/custom%40hy-p72866%4042008867?v=MedChemExpress Average 91 stars, based on 1 article reviews
ca12/carbonic anhydrase 12, human - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
Carlo Erba Reagents
ca ca12 Ca Ca12, supplied by Carlo Erba Reagents, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/10__1080_slash_1828051x__2025__2592715-51-31-34?v=Carlo+Erba+Reagents Average 86 stars, based on 1 article reviews
ca ca12 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Proteintech
anti ca xii Anti Ca Xii, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/pm41418744-157-6-9?v=Proteintech Average 93 stars, based on 1 article reviews
anti ca xii - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Synthego Inc
ca12 knockout crrna Ca12 Knockout Crrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/pmc11646563-925-0-5?v=Synthego+Inc Average 86 stars, based on 1 article reviews
ca12 knockout crrna - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Synthego Inc
ca12 knockout genotyping forward primer ggtggagggagcattgccta Ca12 Knockout Genotyping Forward Primer Ggtggagggagcattgccta, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/pmc11646563-928-0-7?v=Synthego+Inc Average 86 stars, based on 1 article reviews
ca12 knockout genotyping forward primer ggtggagggagcattgccta - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Synthego Inc
ca12 knockout genotyping reverse primer caggacagtgcagatgagct Ca12 Knockout Genotyping Reverse Primer Caggacagtgcagatgagct, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/pmc11646563-929-0-7?v=Synthego+Inc Average 86 stars, based on 1 article reviews
ca12 knockout genotyping reverse primer caggacagtgcagatgagct - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Synthego Inc
ca12 knockout crrna2 ggcagcccuacuuaccucgg Ca12 Knockout Crrna2 Ggcagcccuacuuaccucgg, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/pmc11646563-927-0-5?v=Synthego+Inc Average 86 stars, based on 1 article reviews
ca12 knockout crrna2 ggcagcccuacuuaccucgg - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Synthego Inc
ca12 knockout crrna2 ggaugugcauguccgagggc Ca12 Knockout Crrna2 Ggaugugcauguccgagggc, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/pmc11646563-926-0-5?v=Synthego+Inc Average 86 stars, based on 1 article reviews
ca12 knockout crrna2 ggaugugcauguccgagggc - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Atlas Antibodies
anti ca12 Anti Ca12, supplied by Atlas Antibodies, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/pmc12775590-75-5-8?v=Atlas+Antibodies Average 93 stars, based on 1 article reviews
anti ca12 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |