|
Bioss
carbonic anhydrase 12 pe Carbonic Anhydrase 12 Pe, supplied by Bioss, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/pm28473691-178-35-37?v=Bioss Average 91 stars, based on 1 article reviews
carbonic anhydrase 12 pe - by Bioz Stars,
2026-07
91/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp ca12 hs01080909 m1 Gene Exp Ca12 Hs01080909 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/pmc10388000-94-40-6?v=Thermo+Fisher Average 91 stars, based on 1 article reviews
gene exp ca12 hs01080909 m1 - by Bioz Stars,
2026-07
91/100 stars
|
Buy from Supplier |
|
OriGene
ca12 cdna ![]() Ca12 Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/pmc07845918-157-13-15?v=OriGene Average 90 stars, based on 1 article reviews
ca12 cdna - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Atlas Antibodies
anti ca12 ![]() Anti Ca12, supplied by Atlas Antibodies, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/pmc12775590-75-5-8?v=Atlas+Antibodies Average 93 stars, based on 1 article reviews
anti ca12 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
OriGene
gctgtctcgcttggaagaaatcgct b ataatgcccacagggacaaagaagg c agagggctccctgaagttagaggat ca12 ![]() Gctgtctcgcttggaagaaatcgct B Ataatgcccacagggacaaagaagg C Agagggctccctgaagttagaggat Ca12, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/pmc06137035__41598_2018_32034_MOESM1_ESM-17-42-48?v=OriGene Average 90 stars, based on 1 article reviews
gctgtctcgcttggaagaaatcgct b ataatgcccacagggacaaagaagg c agagggctccctgaagttagaggat ca12 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
R&D Systems
caix ![]() Caix, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/pmc06028082-89-6-18?v=R%26D+Systems Average 90 stars, based on 1 article reviews
caix - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
carbonic anhydrase 12 ![]() Carbonic Anhydrase 12, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/10__1158_slash_1078___0432__ccr___11___0238-57-14-19?v=OriGene Average 90 stars, based on 1 article reviews
carbonic anhydrase 12 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Proteintech
anti rabbit ca12 ![]() Anti Rabbit Ca12, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/pmc05062583-402-27-29?v=Proteintech Average 93 stars, based on 1 article reviews
anti rabbit ca12 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Sino Biological
caxii ![]() Caxii, supplied by Sino Biological, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/pmc08632296-302-34-56?v=Sino+Biological Average 90 stars, based on 1 article reviews
caxii - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Cusabio
caviii ![]() Caviii, supplied by Cusabio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/pmc10650537-106-18-19?v=Cusabio Average 91 stars, based on 1 article reviews
caviii - by Bioz Stars,
2026-07
91/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp ca12 hs01080902 m1 ![]() Gene Exp Ca12 Hs01080902 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ca12/10__1080_slash_2162402x__2018__1445452-262-105--1?v=Thermo+Fisher Average 85 stars, based on 1 article reviews
gene exp ca12 hs01080902 m1 - by Bioz Stars,
2026-07
85/100 stars
|
Buy from Supplier |
Image Search Results
Journal: The Journal of Experimental Medicine
Article Title: Large pH oscillations promote host defense against human airways infection
doi: 10.1084/jem.20201831
Figure Lengend Snippet: Expression of membrane-associated carbonic anhydrases CA4, CA9, CA12, and CA14 in human and pig airway epithelia. (A) mRNA levels in primary human bronchial cells ( n = 9–12 measurements from ≥3 cultures). Error bars represent SE. (B) CA12 mRNA levels normalized to GAPDH. Human: freshly isolated HBE cells, cultured non-CF and CF HBEs, and HEK cells (with endogenous CA12 expression as positive control). Pig: freshly isolated trachea, cultured PTE cells, skeletal muscle (negative control), and kidney cortex (positive control). Mean ± SE t test, compared with pig trachea; n/ P value: a (4/0.0048), b (4/0.016), and c (4/0.0778). (C) Immunoblot showing CA12 protein expression with tubulin as loading control. Fresh tissues were flash frozen in liquid N 2 , pulverized, and extracted into lysis buffer. HEK cells were transfected with CA12 as positive control (HEK-CA12). Immunostaining was lost when antibody was preincubated with CA12 as a blocking protein. (D) Summary of relative levels of human and pig CA12 protein. Band densities were normalized to tubulin, and the normalized values were plotted relative to that for pig. Mean ± SE t test, compared with pig trachea; n/ P value: differences a (5/0.0036), b (5/0.0022), and c (4/0.0159). (E) Upper image: x-y view of HBE cells showing CA12 (red) at the apical pole (non-CF donor). Lower image: x-z view showing the apical localization of CA12 and acetylated tubulin in ciliated cells. White scale bar = 10 µm. AP, apical; BL, basolateral. (F) Localization of CA12 (red) and tubulin or MUC5AC (green) in isolated, well-differentiated HBE cells from non-CF donor. White scale bar = 10 µm. (G) Cartoon showing reversible hydration of CO 2 in the ASL catalyzed by membrane-bound CA12.
Article Snippet: Cells at 50%–80% confluence were transfected in 100-mm Petri dishes with 4 μg
Techniques: Expressing, Membrane, Isolation, Cell Culture, Positive Control, Negative Control, Western Blot, Control, Lysis, Transfection, Immunostaining, Blocking Assay
Journal: The Journal of Experimental Medicine
Article Title: Large pH oscillations promote host defense against human airways infection
doi: 10.1084/jem.20201831
Figure Lengend Snippet: CA12 is expressed in ciliated cells not goblet cells. (A) Well-differentiated HBEs from non-CF (upper images) and CF (lower images) donors show the colocalization of CA12 with tubulin. Left images show cilia as tubulin immunofluorescence. Middle images show strong CA12 expression after refocusing on the apical cell surface. Merging these images on the right reveals that CA12 expression is exclusively in ciliated cells. Top right image (x-z view) shows CA12 immunofluorescence immediately beneath cilia. AP, apical; BL, basolateral. Scale bars = 20 µm. (B) CA12 (red) and MUC5AC (green) immunostaining of well-differentiated non-CF (upper images) and CF (lower images) HBEs. CA12 and MUC5AC immunofluorescence was not observed in the same cells. CF cultures had more goblet cells and fewer CA12-expressing cells, which may explain the reduced CA12 expression shown in . Scale bars = 20 µm.
Article Snippet: Cells at 50%–80% confluence were transfected in 100-mm Petri dishes with 4 μg
Techniques: Immunofluorescence, Expressing, Immunostaining
Journal: The Journal of Experimental Medicine
Article Title: Large pH oscillations promote host defense against human airways infection
doi: 10.1084/jem.20201831
Figure Lengend Snippet: CA12 antibody specificity and immunostaining in human lung tissue. (A) Most CA12 immunostaining at the apical pole of ciliated cells was abolished by excess recombinant CA12 as a blocking protein. Scale bars = 10 µm. (B) CA12 signals (red) were detected only in ciliated cells in human lung tissue. Left image: ciliated cell marker tubulin (green) localized with CA12 immunofluorescence (red). Right image: goblet cell marker MUC5AC (green) did not colocalize with CA12 (red). Scale bars = 20 µm.
Article Snippet: Cells at 50%–80% confluence were transfected in 100-mm Petri dishes with 4 μg
Techniques: Immunostaining, Recombinant, Blocking Assay, Marker, Immunofluorescence
Journal: The Journal of Experimental Medicine
Article Title: Large pH oscillations promote host defense against human airways infection
doi: 10.1084/jem.20201831
Figure Lengend Snippet: CA12 immunostaining is reduced in CF bronchial and nasal cell cultures. (A) Apical localization of CA12 in bronchial and nasal brushings (left images) and well-differentiated bronchial and nasal cells isolated from air–liquid interface cultures. White scale bars = 10 µm. (B) Summary of CA12 immunofluorescence intensities measured as in A with identical microscope settings. Mean ± SE, one-way ANOVA with Tukey’s post-hoc test. a and b are significantly different; n/ P value: 6–8/7.8 × 10 −6 . (C) CA12 immunofluorescence in well-differentiated non-CF and CF HBEs (four images each condition). Fluorescence intensities were determined using the same settings and analyzed using IMARIS software. White scale bars = 20 µm. (D) Summary of all single-cell CA12 immunofluorescence intensities from 8–10 different cultures ( n = 751 non-CF cells and 568 CF cells). Error bars represent mean ± SE. (E) Mean CA12 immunofluorescence intensities from individual cultures (each average of 50–100 cells was considered n = 1). Mean ± SE, Student’s t test; P = 0.0084. (F) Number of cells with CA12 immunofluorescence in cultures of cells from two non-CF and two CF patients. Mean ± SE, Student’s t test; P = 0.0033. A.U., arbitrary units.
Article Snippet: Cells at 50%–80% confluence were transfected in 100-mm Petri dishes with 4 μg
Techniques: Immunostaining, Isolation, Immunofluorescence, Microscopy, Fluorescence, Software
Journal: PLoS ONE
Article Title: Differential expression and function of CAIX and CAXII in breast cancer: A comparison between tumorgraft models and cells
doi: 10.1371/journal.pone.0199476
Figure Lengend Snippet: Panel A . mRNA from all breast cancer patients (unrestricted analysis) was probed for the CA9 gene expression (CAIX-mRNA) using Affimetrix ID 205199_at. Panel B . mRNA expression in triple negative breast cancer patients was probed for CAIX mRNA using Affimetrix ID, 205199. Panel C . mRNA from all breast cancer patients (unrestricted analysis) was probed for the CA12 gene expression (CAXII mRNA) using Affimetrix ID, 215867_at. Panel D . mRNA from all ER-positive breast cancer patients was probed for the CAXII mRNA using Affimetrix ID, 215867_at.
Article Snippet: Membranes were incubated with specific antibodies:
Techniques: Expressing
Journal: PLoS ONE
Article Title: Differential expression and function of CAIX and CAXII in breast cancer: A comparison between tumorgraft models and cells
doi: 10.1371/journal.pone.0199476
Figure Lengend Snippet: Panel A. Frozen tissue samples from PDX tumors were homogenized in RIPA buffer containing protease inhibitor. Western blots were probed with antibodies for CAIX, CAXII, CAII, ER, E-cadherin, actin, and GAPDH. Panel B. Tumor growth rates of orthotopically implanted, cryo-preserved tumor tissue was evaluated in NOD/SCID mice. Panel C. Immunohistochemistry was utilized to evaluate expression of CAIX, CAXII, ER, and Ki67 in TNBC (HCl-001) and ER/PR-positive (HCl-011) tumors from Panel B. Magnification: primary objective magnification, 10x.
Article Snippet: Membranes were incubated with specific antibodies:
Techniques: Protease Inhibitor, Western Blot, Immunohistochemistry, Expressing
Journal: PLoS ONE
Article Title: Differential expression and function of CAIX and CAXII in breast cancer: A comparison between tumorgraft models and cells
doi: 10.1371/journal.pone.0199476
Figure Lengend Snippet: Cell growth was monitored by the MTT assay in which CAIX and CAXII were knocked-down in UFH-001 and T47D cells using shRNA or activity was blocked using the impermeant sulfonamide inhibitor, N-3500 (1mM). Panels A and B. UFH-001 cells. Panels C and D. T47D cells. Asterisks denote statistical significance (* p < 0.05, *** p < 0.001.
Article Snippet: Membranes were incubated with specific antibodies:
Techniques: MTT Assay, shRNA, Activity Assay
Journal: PLoS ONE
Article Title: Differential expression and function of CAIX and CAXII in breast cancer: A comparison between tumorgraft models and cells
doi: 10.1371/journal.pone.0199476
Figure Lengend Snippet: Cell migration and invasion were determined using trans-well chambers. Panel A. UFH-001 cells (empty vector and CRISPR-CAIX knockdown cells from ) were plated in the upper transwell chambers and allowed to migrate or invade across the membrane for 24 h (upper images) or 48 h (lower images), respectively. Tabulation of results is shown to the right ( p < 0.05). Panel B. T47D cells (empty vector or CAXII knockdown cells from ) were plated in the upper transwell chambers and allowed to migrate or invade across the membrane for 24 h (upper images) or 48 h (lower images), respectively. Tabulation of results is shown to the right.
Article Snippet: Membranes were incubated with specific antibodies:
Techniques: Migration, Plasmid Preparation, CRISPR
Journal: PLoS ONE
Article Title: Differential expression and function of CAIX and CAXII in breast cancer: A comparison between tumorgraft models and cells
doi: 10.1371/journal.pone.0199476
Figure Lengend Snippet: 18 O exchange was used to measure CA activity in cells at pH 6.8, 7.4, and 7.9. Panels A and B. A representative plot of CAIX activity in response to pH is shown for UFH-001 cells exposed to normoxic or hypoxic conditions. Three independent biological replicates were used to quantify the first order rate constants. Panels C and D. A representative plot of CAXII activity in response to pH is shown for T47D cells exposed to normoxic and hypoxic conditions. Three independent biological replicates were used to quantify the first order rate constants. The asterisks denote statistical significance. * p < 0.05, ** p < 0.01, **** p < 0.0001.
Article Snippet: Membranes were incubated with specific antibodies:
Techniques: Activity Assay
Journal: PLoS ONE
Article Title: Differential expression and function of CAIX and CAXII in breast cancer: A comparison between tumorgraft models and cells
doi: 10.1371/journal.pone.0199476
Figure Lengend Snippet: Membrane ghosts were prepared from hypoxic UFH-001 and normoxic T47D cells. Panel A. 18 O exchange data is reported as the rate of activity divided by the enzyme concentration in a pH-dependent manner. The concentration of CAIX in the membrane suspension was estimated at 4.1 nM. The concentration of CAXII in the membrane suspension was estimated at 31.4 nM. Panel B. The kcat exch /K eff s (kcat/Km) with units, M -1 s -1 , is shown for the hydration of CO 2 and dehydration of bicarbonate catalyzed by CAIX. Panel C. the kcat exch /K eff s (kcat/Km) with units, M -1 s -1 , is shown for the hydration of CO 2 and dehydration of bicarbonate catalyzed by CAXII.
Article Snippet: Membranes were incubated with specific antibodies:
Techniques: Activity Assay, Concentration Assay
Journal: Cancers
Article Title: Carbonic Anhydrase Inhibitors Induce Ferroptosis through Inhibition of AKT/FTH1 Signaling in Ewing Sarcoma Tumor Cells
doi: 10.3390/cancers15215225
Figure Lengend Snippet: Identification of CA-mRNAs in the tissue of ES patients. ( A ) Box plots show the level of CA-mRNA expression in the ES tumor tissue of patients with relapse (red bar) and no relapse (black bar). Two-way ANOVA, Bonferroni test, p = 0.0088 for CA2 mRNA; ( B ) Kaplan–Meier plots for overall survival of the patients with ES using the GSE63155 dataset. Patients were classified according to CA2 mRNA expression (as described in Methods section). Log-rank test p value 0.081; ( C ) Box plots show the level of CAI, CAII, CAVIII, CAX and CAXII protein expression using primary paraffin-embedded ES tumor sections (N = 9) via immunohistochemistry. Kruskal–Wallis test p = 0.0031; PPI network constructed using STRING software (STRING: functional protein association networks ( www.string-db.org )). for the 50 most differentially expressed and top21 ( D ) proteins exhibiting highest degree of correlation with CAII (Spearman degree of correlation between 7.2 × 10 14 till 5.2 × 10 14 ) were used.
Article Snippet: Prior to staining, the working dilution for CAI (Cusabio, Cat # CSB-PA004364ESR1HU, 1/200), CAII (FineTest, Cat #FNab01161, 1/200),
Techniques: Expressing, Immunohistochemistry, Construct, Software, Functional Assay