parp1 egfp dr shan zha  (Proteintech)

Journal: Nucleic Acids Research

Article Title: APLF facilitates interstrand DNA crosslink repair and replication fork protection to confer cisplatin resistance

doi: 10.1093/nar/gkae211

Figure Lengend Snippet: APLF and FANCD2 are enriched at DNA damage sites upon cisplatin treatment. ( A ) Representative images of immunofluorescent staining of tGFP-APLF (green) and γH2AX (red). Nuclei were stained with DAPI. T24 cells expressing tGFP-APLF were treated with mock or 100 μM cisplatin (CDDP) for 3 h. ( B ) Quantification of tGFP-APLF and γH2AX fluorescent intensity after cisplatin treatment. At least 150 cells from each sample were measured. The p -value was determined by the Mann–Whitney test. *** represents P < 0.001. ( C ) The tGFP-APLF and γH2AX intensities are highly correlated after cisplatin treatment. The profiles of tGFP-APLF and γH2AX fluorescent intensity in a cross-section are shown in the right panel. ( D ) The colocalization of γH2AX and tGFP-APLF was analyzed using Manders’ colocalization coefficient (M1 = red overlap with green; M2 = green overlap with red). At least 20 cells from each cell line were analyzed. ( E ) Representative images of immunofluorescent staining of APLF (green), γH2AX (red), and FANCD2 (green). ( F ) Quantification of APLF, γH2AX, and FANCD2 fluorescent intensity after cisplatin treatment. At least 150 cells from each sample were measured.

Article Snippet: Sections were deparaffinized, rehydrated, incubated with target antibody APLF (1:100, Gene Tex, GTX87979) and γH2AX (1:100, Cell Signaling Technology, 9718), and stained by VECTASTAIN Elite ABC HRP Kit (Vector Laboratories) and DAB Peroxidase (HRP) Substrate Kit (Vector Laboratories) according to the manufacturer's protocols.

Techniques: Staining, Expressing, MANN-WHITNEY

Journal: Nucleic Acids Research

Article Title: APLF facilitates interstrand DNA crosslink repair and replication fork protection to confer cisplatin resistance

doi: 10.1093/nar/gkae211

Figure Lengend Snippet: The depletion of APLF and FANCD2 impairs ICL repair. ( A ) The single depletion of APLF and FANCD2 and double-depletion both of APLF and FANCD2 were verified by western blot analysis with the specific antibodies as indicated. The expression of APLF and FANCD2 was depleted using shRNA-lentivirus. The non-targeting shLacZ was used as a control. ( B , C ) The colony formation assay. Cells were chronically treated with various concentrations of cisplatin, carboplatin, or MMC for 10 days. All data are the means ± standard deviation (SD) for at least two independent experiments. The p- value was determined by the Student's t -test. * P < 0.05; ** P < 0.01. ( D ) The immunostaining of γH2AX and H2AX of each cell line after cisplatin treatment. Cells were treated with mock or 40 μM cisplatin (CDDP) for 3 h. ( E ) Genomic platinum levels of each cell line were determined by ICP-MS. All data are the means ± SD for two independent experiments. The P -value was determined by the Student's t -test. * P < 0.05.

Article Snippet: Sections were deparaffinized, rehydrated, incubated with target antibody APLF (1:100, Gene Tex, GTX87979) and γH2AX (1:100, Cell Signaling Technology, 9718), and stained by VECTASTAIN Elite ABC HRP Kit (Vector Laboratories) and DAB Peroxidase (HRP) Substrate Kit (Vector Laboratories) according to the manufacturer's protocols.

Techniques: Western Blot, Expressing, shRNA, Control, Colony Assay, Standard Deviation, Immunostaining

Journal: Nucleic Acids Research

Article Title: APLF facilitates interstrand DNA crosslink repair and replication fork protection to confer cisplatin resistance

doi: 10.1093/nar/gkae211

Figure Lengend Snippet: PARP1 activity facilitates APLF recruitment to DNA damage sites. ( A ) The immunostaining of PARP1 in the PARP1-proficient (T24) and knockout (PARP1-KO) T24 cells. PARP1 was also introduced into the PARP1-KO T24 cells using retroviruses. The pLHCX vector carrying sgRNA-resistant PARP1 was packaged into retrovirus particles in the GP2-293 cell line. The PARP1-KO cells were infected with the retrovirus to stably express wild-type PARP1. The empty vector was used as a control. ( B ) Quantification of APLF and γH2AX fluorescent intensity from the PARP1-deficient (vector) and PARP1-proficient cells following mock or 100 μM cisplatin treatment for 1 or 3 h. ( C ) Quantification of FANCD2 and γH2AX fluorescent intensity with a similar treatment to (C). ( D ) Quantification of APLF and γH2AX fluorescent intensity from T24 cells with mock or 100 μM cisplatin treatment for 1 h. 10 μM Olaparib was used to treat cells 2 h before cisplatin treatment. ( E ) Quantitation of FANCD2 and γH2AX fluorescent intensity with a similar treatment to (D). At least 120 cells from each condition were measured. The P -value was determined by the Mann–Whitney test. ** P < 0.01; *** P < 0.001; ns, not significant.

Article Snippet: Sections were deparaffinized, rehydrated, incubated with target antibody APLF (1:100, Gene Tex, GTX87979) and γH2AX (1:100, Cell Signaling Technology, 9718), and stained by VECTASTAIN Elite ABC HRP Kit (Vector Laboratories) and DAB Peroxidase (HRP) Substrate Kit (Vector Laboratories) according to the manufacturer's protocols.

Techniques: Activity Assay, Immunostaining, Knock-Out, Plasmid Preparation, Infection, Stable Transfection, Control, Quantitation Assay, MANN-WHITNEY

Journal: Nucleic Acids Research

Article Title: APLF facilitates interstrand DNA crosslink repair and replication fork protection to confer cisplatin resistance

doi: 10.1093/nar/gkae211

Figure Lengend Snippet: Depletion of APLF sensitizes cells to cisplatin in a xenograft mouse model. NOD SCID mice bearing shLacZ or shAPLF T24 xenograft tumors were treated with PBS or 2 mg/kg cisplatin for five weeks. ( A ) The body weight of each group during the 5-week treatment. ( B ) Tumor images representing excised tumors from each group. ( C ) Tumor weight for each group after sacrifice. ( D ) Tumor volume of each group during the 5-week treatment. The data are presented as means ± SD. * P < 0.05 represents a significant difference between the PBS and cisplatin groups. ( E ) Immunohistochemical staining of APLF and γH2AX in tumor tissues.

Article Snippet: Sections were deparaffinized, rehydrated, incubated with target antibody APLF (1:100, Gene Tex, GTX87979) and γH2AX (1:100, Cell Signaling Technology, 9718), and stained by VECTASTAIN Elite ABC HRP Kit (Vector Laboratories) and DAB Peroxidase (HRP) Substrate Kit (Vector Laboratories) according to the manufacturer's protocols.

Techniques: Immunohistochemical staining, Staining

Journal: bioRxiv

Article Title: Kinase activity of histone chaperone APLF maintains steady state of centrosomes in mouse embryonic stem cells

doi: 10.1101/2024.02.06.579158

Figure Lengend Snippet: A. Plot representing the pairwise sequence alignment of amino acids in mouse vs. human APLF proteins using LALIGN bioinformatics tool ( https://www.ebi.ac.uk/Tools/services/web/toolresult.ebi?jobId=lalign-I20231015-184430-0525-54532945-p1m&context=protein&analysis=visual ) . Pairwise sequence alignment was generated by EMBOSS tool, wherein red represent small and hydrophobic, including aromatic amino acids; blue represent acidic, magenta represent basic and green represent hydroxyl/sulfhydryl/amine/Glycine residues. B. Domain specific constructs of mouse APLF, based on alignment with human APLF (refer to Fig. S1). C. Western blot analysis for the expression of GFP-tagged APLF constructs. Individual APLF domains were cloned in pEGFPN1 vector and transfected in HEK293T cells. Protein was isolated in RIPA buffer from HEK293T cells and run on SDS-PAGE and probed with GFP antibody. D-F. FRAP analysis for the detection of in vivo nucleosome assay mediated by APLF. GFP-tagged APLF constructs expressing HEK 293T cells were co-transfected with H2B-mCherry plasmid and subjected to FRAP analysis. Photobleaching was done at ROI in H2B:mCherry expressing cells and were monitored for the fluorescence recovery in the bleached region (D). Graphical representation for halftime of recovery, E, and mobile fraction present, F, in cells harboring different constructs of APLF. Ordinary one-way ANOVA statistical analysis was done with Tukey’s multiple comparisons tests, ****p<0.0001. G. HEK293T cells transfected with GFP tagged APLF domain constructs were subjected to 10mM etoposide or DMSO for 4 hours to induce double strand DNA damage followed by its release and observation for the formation of gH2A.X foci by immunofluorescence analysis at 0 and 24 hours of its release to monitor the DNA repair activity. Graphical representation of the DNA repair assay mediated in presence of APLF full length, ΔFHA, ΔAD clones and control cells. A two-way ANOVA statistical analysis was done followed by Tukey’s multiple comparisons tests, ****p<0.0001.

Article Snippet: The cDNA of APLF full length and APLF ΔFHA and APLF ΔAD were amplified with respective primer pairs (Table S1) and subcloned into Flag-HA-pCDNA3.1 (Addgene #52535) , pcDNA TM 3.1/V5-His A (a kind gift from, Dr. K B Harikumar, RGCB), pEGFP-N1 (a kind gift from Dr. Arumugam Rajavelu, RGCB).

Techniques: Sequencing, Generated, Construct, Western Blot, Expressing, Clone Assay, Plasmid Preparation, Transfection, Isolation, SDS Page, In Vivo, Fluorescence, Immunofluorescence, Activity Assay, Control

Journal: bioRxiv

Article Title: Kinase activity of histone chaperone APLF maintains steady state of centrosomes in mouse embryonic stem cells

doi: 10.1101/2024.02.06.579158

Figure Lengend Snippet: Mouse APLF interactome . A. Total protein was isolated from HEK293T cells transfected with FLAG-tagged Aplf or empty FLAG vector. APLF-interacting proteins were pulled down using FLAG antibody by co-immunoprecipitation and the complex extracted from Protein-A sepharose beads was run on a SDS-PAGE and the gel piece was subjected to LC/MS-MS analysis for the determination of interacting partners of APLF. STRING database analysis for the APLF interacting partners resulted in the creation of seven distinct clusters. * Indicate PCNT as one of the interacting partners (the relevance has been discussed in the later section of the study). B, C. Pie-chart representing the Gene ontology (GO) analysis for top 10 biological processes and cellular components using DAVID bioinformatics tool ( https://david.ncifcrf.gov ). D, E. APLF domain specific interaction partners- Total protein was isolated from HEK283T cells transfected with FLAG-tagged ΔAD-APLF, ΔFHA-APLF or empty FLAG vector. Domain specific interacting proteins were pulled down using FLAG antibody by co-immunoprecipitation and the complex extracted from Protein-A sepharose beads was run on a SDS-PAGE and the gel piece was subjected to LC/MS-MS analysis for the determination of interacting partners of different domains of APLF. STRING database analysis for the domain specific APLF interacting partners resulted in the creation of three distinct clusters for ΔFHA domains (D) and three for ΔAD (5).

Article Snippet: The cDNA of APLF full length and APLF ΔFHA and APLF ΔAD were amplified with respective primer pairs (Table S1) and subcloned into Flag-HA-pCDNA3.1 (Addgene #52535) , pcDNA TM 3.1/V5-His A (a kind gift from, Dr. K B Harikumar, RGCB), pEGFP-N1 (a kind gift from Dr. Arumugam Rajavelu, RGCB).

Techniques: Isolation, Transfection, Plasmid Preparation, Immunoprecipitation, SDS Page, Liquid Chromatography with Mass Spectroscopy

Journal: bioRxiv

Article Title: Kinase activity of histone chaperone APLF maintains steady state of centrosomes in mouse embryonic stem cells

doi: 10.1101/2024.02.06.579158

Figure Lengend Snippet: APLF localizes to centrosomes . A, B. Immunofluorescence analysis for the expression of APLF in mouse ESCs. B. Immunofluorescence analysis for the co-localization of APLF with CETN2 in mouse ESCs. Inset- APLF and CETN2 expression and co-localization. C. ESCs were synchronized in interphase and mitotic phase (refer to Fig. S3C) of cell cycle under different treatment conditions. These cells were further analyzed for the expression of APLF along with TUBG by immunofluorescence. D, E. Pearson correlation coefficient was determined for APLF co-localizing with TUBG or CETN2 across different cell cycle phases. Ordinary One- way ANOVA was used for statistical analysis followed by Brown-Forsythe test and Tukey’s multiple comparisons tests, ****p<0.0001.

Article Snippet: The cDNA of APLF full length and APLF ΔFHA and APLF ΔAD were amplified with respective primer pairs (Table S1) and subcloned into Flag-HA-pCDNA3.1 (Addgene #52535) , pcDNA TM 3.1/V5-His A (a kind gift from, Dr. K B Harikumar, RGCB), pEGFP-N1 (a kind gift from Dr. Arumugam Rajavelu, RGCB).

Techniques: Immunofluorescence, Expressing

Journal: bioRxiv

Article Title: Kinase activity of histone chaperone APLF maintains steady state of centrosomes in mouse embryonic stem cells

doi: 10.1101/2024.02.06.579158

Figure Lengend Snippet: APLF regulate centrosome number . A. Western blot analysis for the expression of FLAG-tagged APLF in ESCs. Protein was isolated in RIPA buffer from ESCs stably transfected with the FLAG-tagged mouse Aplf and empty FLAG vector, run on SDS-PAGE and probed with APLF antibody. B. Co-immunoprecipitation of APLF and CETN2. Proteins isolated from the above sets were immunoprecipitated with FLAG antibody followed by immunoblotting with CETN2. IgG was used as the negative control. C. ESCs stably expressing FUCCI construct were sorted on the basis of reciprocal expression of CDT1 and its inhibitor Geminin. CDT1 (red) peaks in the G1 whereas the Geminin (green) peaks at G2M. Double positive represents the G1S population (refer to Fig. S4A). Total RNA was isolated from the cell samples and subjected to the generation of cDNA. qRT-PCR analysis was performed to determine the expression of Aplf mRNA in different phases of cell cycle. Ordinary one-way ANOVA with Tukey’s multiple comparisons tests were performed for the statistical analysis, **p<0.01. D. Western blot analysis for the expression of APLF in different cell cycle phases synchronized cells (refer to S3C). E, F. Immunofluorescence analysis for the expression of APLF and TUBG in FLAG-tagged constructs in ESCs. ESC- Aplf FLAG cells demonstrate increased centrosome number. Inset A and B from the ESC clump shows cells with increased centrosome numbers in different colonies of ESCs (F). G. Western blot analysis for the expression of centrosome associated markers including CETN2 and TUBG in ESCs. H. Scatter plot representing the quantification of number of cells having ≥3 centrosomes in vector control and Aplf -FLAG ESCs. I. Scatter plot representing the quantification of number of cells having ≤2 centrosomes in vector control and Aplf -FLAG expressing ESCs. A two-tailed unpaired t-test was performed for the statistical analysis, ****p<0.0001. J. Mitotic aberrations formed upon increased expression of APLF in ESCs stably transfected with Aplf -FLAG construct, were analyzed with TUBG immunostaining. K. Stacked bars representing the percentage of normal (bipolar) vs. abnormal (multipolar) spindle formation in control FLAG and Aplf -FLAG expressing ESCs. One sided Fisher’s exact test was used for the statistical analysis, **p<0.01.

Article Snippet: The cDNA of APLF full length and APLF ΔFHA and APLF ΔAD were amplified with respective primer pairs (Table S1) and subcloned into Flag-HA-pCDNA3.1 (Addgene #52535) , pcDNA TM 3.1/V5-His A (a kind gift from, Dr. K B Harikumar, RGCB), pEGFP-N1 (a kind gift from Dr. Arumugam Rajavelu, RGCB).

Techniques: Western Blot, Expressing, Isolation, Stable Transfection, Transfection, Plasmid Preparation, SDS Page, Immunoprecipitation, Negative Control, Construct, Quantitative RT-PCR, Immunofluorescence, Control, Two Tailed Test, Immunostaining

Journal: bioRxiv

Article Title: Kinase activity of histone chaperone APLF maintains steady state of centrosomes in mouse embryonic stem cells

doi: 10.1101/2024.02.06.579158

Figure Lengend Snippet: A. qRT-PCR analysis for the expression of Plk4 in stably expressing FLAG and Aplf -FLAG ESCs. Two-tailed paired t-test was used for the statistical analysis, ns- not significant. B. Western blot analysis for the expression of PLK4 in the same set of cells analyzed in A. C. Co-immunoprecipitation of endogenous APLF with PLK4. Proteins were isolated from ESCs and immunoprecipitated with APLF antibody followed by immunoblotting with PLK4. D. Proteins isolated from ESCs were immunoprecipitated with PLK4 antibody followed by immunoblotting with APLF. E. In the same set of cells analyzed in , proteins were isolated and immunoprecipitated with pan p-Ser/Thr antibody followed by immunoblotting with PLK4. The presence of band at 100KDa confirms that the increased expression of APLF enhanced phosphorylation of PLK4 in ESCs. F. Western blot analysis for the expression of p-PLK4 S305 in FLAG and Aplf -FLAG expressing ESCs. Level of total PLK4, APLF and GAPDH was also determined in the same set of samples.

Article Snippet: The cDNA of APLF full length and APLF ΔFHA and APLF ΔAD were amplified with respective primer pairs (Table S1) and subcloned into Flag-HA-pCDNA3.1 (Addgene #52535) , pcDNA TM 3.1/V5-His A (a kind gift from, Dr. K B Harikumar, RGCB), pEGFP-N1 (a kind gift from Dr. Arumugam Rajavelu, RGCB).

Techniques: Quantitative RT-PCR, Expressing, Stable Transfection, Two Tailed Test, Western Blot, Immunoprecipitation, Isolation, Phospho-proteomics

Journal: bioRxiv

Article Title: Kinase activity of histone chaperone APLF maintains steady state of centrosomes in mouse embryonic stem cells

doi: 10.1101/2024.02.06.579158

Figure Lengend Snippet: DNA repair factor and histone chaperone APLF is a kinase . A. Mouse APLF structure was predicted using the bioinformatics tool, I-TASSER program. B. Docking studies revealed presence of three putative ATP binding sites within the FHA domain. C-K. Detection of kinase activity using ADP-Glo kinase reagent. Different constructs of APLF were cloned into His-tag vector (refer to Fig. S5). Eluate #5 (having 250mM imidazole) was used as the source for the enzyme. C. Graph shows the enzymatic activity of APLF in Relative Luminescence Unit (RLU) with increasing amount of the enzyme APLF. His-tagged clones were transfected in HEK293T cells and the protein was isolated and purified using Ni-NTA agarose beads and eluted in 250mM imidazole. Simple linear regression analysis was performed for the curve fitting. D. The affinity towards ATP was determined by assaying the kinase activity at different concentrations of ATP. Binding of ATP within APLF follows the Michaelis–Menten equation with a K m for ATP= 27.15 μM. Michaelis-Menten least square non-linear fit was used to derive the K m for ATP. E. Scatter plot shows the enzymatic activity of control APLF and ΔFHA His-tagged and His-tagged empty vector control proteins were purified in a similar manner mentioned above. Two-sided unpaired t-test was performed for the statistical analysis, ns- not significant, ****p<0.0001. F. The three ATP binding sites within the FHA domain were mutated by site directed mutagenesis and the His-tagged clones were transfected in HEK293T cells and processed for the isolation of purified proteins. These APLF mutated enzymes were analyzed for the enzymatic activity. Scatter plot shows the loss in enzymatic activity upon incorporation of mutation within the FHA domains. G, H. Control His-tag vector, APLF-His-tag and APLF R37A -His- tag constructs were transfected in ESCs for the detection of alteration in centrosome numbers. Immunofluorescence analysis was performed for the expression of TUBG in the cells (refer to Fig. S5G). Scatter plot representing the quantification of number of cells having ≥3 or ≤2 centrosomes in control, Aplf -His, APLF R37A -His expressing ESCs. Two-sided unpaired t-test was performed for the statistical analysis, ns- not significant, ***p<0.001. I. Western blot analysis for the presence of phosphorylated proteins in the enzymatic reaction mix mentioned in C. The product formed was run on SDS-PAGE and immunoblotted with pan phospho-Ser/Thr antibody. A band at ∼100KDa showed increase in intensity with increasing amount of APLF. J. Scatter plot for the enzymatic activity of APLF in presence of either whole cell lysate or PLK4 mutated at the autophosphorylation site of S305 as the substrate. Two-tailed unpaired t-test performed for the statistical analysis, **p<0.01.

Article Snippet: The cDNA of APLF full length and APLF ΔFHA and APLF ΔAD were amplified with respective primer pairs (Table S1) and subcloned into Flag-HA-pCDNA3.1 (Addgene #52535) , pcDNA TM 3.1/V5-His A (a kind gift from, Dr. K B Harikumar, RGCB), pEGFP-N1 (a kind gift from Dr. Arumugam Rajavelu, RGCB).

Techniques: Binding Assay, Activity Assay, Construct, Clone Assay, Plasmid Preparation, Transfection, Isolation, Purification, Control, Mutagenesis, Immunofluorescence, Expressing, Western Blot, SDS Page, Two Tailed Test

Journal: bioRxiv

Article Title: Kinase activity of histone chaperone APLF maintains steady state of centrosomes in mouse embryonic stem cells

doi: 10.1101/2024.02.06.579158

Figure Lengend Snippet: The kinase activity of APLF regulate PLK4 phosphorylation thereby regulating centrosome number. The model has been generated with Biorender.

Article Snippet: The cDNA of APLF full length and APLF ΔFHA and APLF ΔAD were amplified with respective primer pairs (Table S1) and subcloned into Flag-HA-pCDNA3.1 (Addgene #52535) , pcDNA TM 3.1/V5-His A (a kind gift from, Dr. K B Harikumar, RGCB), pEGFP-N1 (a kind gift from Dr. Arumugam Rajavelu, RGCB).

Techniques: Activity Assay, Phospho-proteomics, Generated

Journal: STAR Protocols

Article Title: Protocol for isolation of mouse pre-implantation embryos for gene expression analysis

doi: 10.1016/j.xpro.2023.102479

Figure Lengend Snippet:

Article Snippet: Aprataxin PNK-like Factor ( Aplf ) , Eurofins , Forward- CAAGGAAGCCCTGAAATAACC Reverse-CTGAAAGCTCTGCATTCACCT.

Techniques: Recombinant, Concentration Assay, Isolation, Reverse Transcription, SYBR Green Assay, Software, Sterility, Microscopy, Fluorescence, Confocal Microscopy, Transferring