Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) HCT116 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 100 nM BI6727, or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (B) HCT116 cells were transfected with siRNA targeting PLK1 or firefly luciferase (siFF) as a non-targeting control for 48 h. During the final 16 h, the cells were treated with 100 ng/mL nocodazole. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 2. (C) Wild-type or PLK1 analog-sensitive (AS) RPE-1 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 10 μM 3MB-PP1, or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-PLK1 (lane 2), or a catalytically inactive version of FLAG-PLK1 (T210A; lane 3). Twenty-four hours post-transfection, the cells were collected, and all cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-PLK1 (lane 2), or a version of FLAG-PLK1 containing a mutation within the Polo-box domain (Pincer; lane 3). Twenty-four hours post-transfection, the cells were collected, and PLK1 was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 2. (F) HCT116 cells were synchronized in mitosis using 100 ng/mL nocodazole for 16 h. Following synchronization, the cells were treated with 10 mM MLN4924 for 4 h prior to harvesting. Cells were then were collected using the mitotic shake-off procedure. Endogenous AKAP2 was immunoprecipitated and eluates were analyzed by immunoblot for the indicated proteins. WCE, whole-cell extract. n = 2. (G) Plot showing residues identified by MS on AKAP2 that were phosphorylated by PLK1 in an in vitro kinase assay. The x axis corresponds to amino acid residue numbers of AKAP2. PSM, peptide-spectrum match. Immunoprecipitated AKAP2 was incubated with three independent sources of recombinant PLK1. Each reaction was analyzed by MS with technical duplicates.

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: GGACGAATTGGCGGTGAGGTCTC , Eton Bioscience , N/A.

Techniques: Western Blot, Transfection, Luciferase, Control, Expressing, Plasmid Preparation, Mutagenesis, Immunoprecipitation, In Vitro, Kinase Assay, Residue, Incubation, Recombinant

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) HCT116 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 100 nM MLN4924, or 100 nM bortezomib for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 2. (B) Plot showing the log 2 ratio of all proteins identified by MS when comparing samples from BI2536-treated mitotic cells to samples from DMSO-treated mitotic cells (x axis) and the log 2 ratio of all proteins identified by MS when comparing samples from siβTrCP-treated mitotic cells to samples from siFF-treated mitotic cells (y axis). Claspin and WEE1 are identified as a positive controls. Proteins indicated in red were increased by PLK1i and siβTrCP. (C) HCT116 cells were transfected with siRNA targeting Cullin 1, βTrCP1/2, CCNF, or firefly luciferase (siFF) as a non-targeting control for 48 h. During the final 16 h, the cells were treated with 100 ng/mL nocodazole. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-βTrCP1 (lane 2), or wild-type FLAG-βTrCP2 (lane 3). Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-βTrCP2 (lane 2), or a version of FLAG-βTrCP2 with a mutation in the substrate binding domain (WD40 Mut ; lane 3). Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 2. (F) HCT116 cells were synchronized in mitosis using 100 ng/mL nocodazole for 16 h. Following synchronization, the cells were treated with 10 mM MLN4924 for 4 h prior to harvesting. Cells were then were collected using the mitotic shake-off procedure. Endogenous AKAP2 was immunoprecipitated and eluates were analyzed by immunoblot for the indicated proteins. WCE, whole-cell extract. Asterisk denotes the heavy chain. n = 2.

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: GGACGAATTGGCGGTGAGGTCTC , Eton Bioscience , N/A.

Techniques: Western Blot, Transfection, Luciferase, Control, Expressing, Plasmid Preparation, Immunoprecipitation, Mutagenesis, Binding Assay

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) Schematic depicting AKAP2 showing the PKA binding domain and relative positions of the three putative βTrCP binding sites in AKAP2. The corresponding amino acids for each motif are 382–384 (DSG1), 472–474 (DSG2), and 502–504 (DSG3). (B) Sequence alignment of the DSG2 motif in Homo sapiens , Mus musculus , and Xenopus laevis. The CDC25B degron sequence for βTrCP is also shown, demonstrating a known example that is divergent from the canonical DSGxxS sequence. The sequence of the AKAP2 DSG2-motif mutant used in future experiments is shown below. (C) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 (WT or DSG degron mutants) together with an empty vector control or FLAG-βTrCP2. Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were treated with 100 ng/mL nocodazole for 16 h to synchronize cells in mitosis. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (F) HEK293T cells were co-transfected with the indicated plasmids for 48 h. After 48 h, the cells were collected and lysed under denaturing conditions. Ubiquitinated proteins were captured using Ni-NTA pull-down. The ubiquitination status of AKAP2 was analyzed by immunoblot. Cells were treated with 20 μM MG132 and 20 μM PR619 for 4 h prior to collection. n = 2. (G) In vitro ubiquitination reactions using TAMRA-labeled AKAP2 WT peptide or AKAP2 phospho-peptide (p-S473) as a substrate, monitored by fluorescence scanning of an SDS-PAGE gel. Representative of n = 4 independent experiments.

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: GGACGAATTGGCGGTGAGGTCTC , Eton Bioscience , N/A.

Techniques: Binding Assay, Sequencing, Mutagenesis, Transfection, Expressing, Plasmid Preparation, Control, Immunoprecipitation, Western Blot, Stable Transfection, In Vitro, Labeling, Fluorescence, SDS Page

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) AKAP2 IP-MS schematic. Myc-AKAP2 was transfected into HEK293T cells in triplicate. AKAP2 was immunoprecipitated using anti-Myc affinity gel and samples were analyzed by LC-MS/MS. (B) AKAP2 interactome showing selected interactors and the biological processes they function in as identified by IP-MS. (C) HEK293T cells were transfected with Myc-AKAP2 or an empty pInducer20 vector (EV) control for 24 h. After 24 h, AKAP2 was immunoprecipitated using anti-Myc affinity gel, and the eluates were analyzed by immunoblot for the indicated proteins. n = 2. (D) Representative max projections of HCT116 FLAG-AKAP2 WT cells that were immunolabeled for DAPI, F-actin (phalloidin), microtubules (α-tubulin), and AKAP2. White arrows indicate areas of co-localization.

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: GGACGAATTGGCGGTGAGGTCTC , Eton Bioscience , N/A.

Techniques: Transfection, Immunoprecipitation, Liquid Chromatography with Mass Spectroscopy, Plasmid Preparation, Control, Western Blot, Immunolabeling

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) Representative images of a single z plane of HCT116 FLAG-AKAP2 WT and FLAG-AKAP2 DSG2 cells that were immunolabeled for DAPI, F-actin (phalloidin), microtubules (α-tubulin), and AKAP2, which are quantified in (B)–(D). (B) Quantification of F-actin via phalloidin immunostaining during metaphase. Phalloidin intensity was normalized to cell area. Statistical analysis was performed by two-tailed t test: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 43; AKAP2 DSG2 , 33. (C) Quantification of mitotic spindle length during metaphase. Statistical analysis was performed by two-tailed t test: * p % 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 37; AKAP2 DSG2 , 34. (D) Quantification of mitotic spindle orientation during metaphase. Statistical analysis was performed by two-tailed t test: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 37; AKAP2 DSG2 , 34.

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: GGACGAATTGGCGGTGAGGTCTC , Eton Bioscience , N/A.

Techniques: Immunolabeling, Immunostaining, Two Tailed Test

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet:

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: GGACGAATTGGCGGTGAGGTCTC , Eton Bioscience , N/A.

Techniques: Virus, Recombinant, Infection, Transfection, Western Blot, Saline, Sequencing, Plasmid Preparation, Mutagenesis, Bicinchoninic Acid Protein Assay, Staining, Expressing, Luciferase, Software, Mass Spectrometry

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) Schematic depicting AKAP2 showing the PKA binding domain and relative positions of the three putative βTrCP binding sites in AKAP2. The corresponding amino acids for each motif are 382–384 (DSG1), 472–474 (DSG2), and 502–504 (DSG3). (B) Sequence alignment of the DSG2 motif in Homo sapiens , Mus musculus , and Xenopus laevis. The CDC25B degron sequence for βTrCP is also shown, demonstrating a known example that is divergent from the canonical DSGxxS sequence. The sequence of the AKAP2 DSG2-motif mutant used in future experiments is shown below. (C) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 (WT or DSG degron mutants) together with an empty vector control or FLAG-βTrCP2. Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were treated with 100 ng/mL nocodazole for 16 h to synchronize cells in mitosis. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (F) HEK293T cells were co-transfected with the indicated plasmids for 48 h. After 48 h, the cells were collected and lysed under denaturing conditions. Ubiquitinated proteins were captured using Ni-NTA pull-down. The ubiquitination status of AKAP2 was analyzed by immunoblot. Cells were treated with 20 μM MG132 and 20 μM PR619 for 4 h prior to collection. n = 2. (G) In vitro ubiquitination reactions using TAMRA-labeled AKAP2 WT peptide or AKAP2 phospho-peptide (p-S473) as a substrate, monitored by fluorescence scanning of an SDS-PAGE gel. Representative of n = 4 independent experiments.

Article Snippet: AKAP2 vectors including N-Myc-AKAP2 WT (pcDNA 3.1+), N-Myc-AKAP2 DSG1 (pcDNA 3.1+), N-Myc-AKAP2 DSG2 (pcDNA 3.1+), N-Myc-AKAP2 DSG3 (pcDNA 3.1+), N-FLAG-AKAP2 WT (pGenLenti), N-FLAG-AKAP2 DSG2 (pGenLenti), AKAP2 WT (pGenDONR), and AKAP2 DSG2 (pGenDONR) were purchased from GenScript.

Techniques: Binding Assay, Sequencing, Mutagenesis, Transfection, Expressing, Plasmid Preparation, Control, Immunoprecipitation, Western Blot, Stable Transfection, Ubiquitin Proteomics, In Vitro, Labeling, Fluorescence, SDS Page

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) Representative images of a single z plane of HCT116 FLAG-AKAP2 WT and FLAG-AKAP2 DSG2 cells that were immunolabeled for DAPI, F-actin (phalloidin), microtubules (α-tubulin), and AKAP2, which are quantified in (B)–(D). (B) Quantification of F-actin via phalloidin immunostaining during metaphase. Phalloidin intensity was normalized to cell area. Statistical analysis was performed by two-tailed t test: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 43; AKAP2 DSG2 , 33. (C) Quantification of mitotic spindle length during metaphase. Statistical analysis was performed by two-tailed t test: * p % 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 37; AKAP2 DSG2 , 34. (D) Quantification of mitotic spindle orientation during metaphase. Statistical analysis was performed by two-tailed t test: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 37; AKAP2 DSG2 , 34.

Article Snippet: AKAP2 vectors including N-Myc-AKAP2 WT (pcDNA 3.1+), N-Myc-AKAP2 DSG1 (pcDNA 3.1+), N-Myc-AKAP2 DSG2 (pcDNA 3.1+), N-Myc-AKAP2 DSG3 (pcDNA 3.1+), N-FLAG-AKAP2 WT (pGenLenti), N-FLAG-AKAP2 DSG2 (pGenLenti), AKAP2 WT (pGenDONR), and AKAP2 DSG2 (pGenDONR) were purchased from GenScript.

Techniques: Immunolabeling, Immunostaining, Two Tailed Test

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet:

Article Snippet: AKAP2 vectors including N-Myc-AKAP2 WT (pcDNA 3.1+), N-Myc-AKAP2 DSG1 (pcDNA 3.1+), N-Myc-AKAP2 DSG2 (pcDNA 3.1+), N-Myc-AKAP2 DSG3 (pcDNA 3.1+), N-FLAG-AKAP2 WT (pGenLenti), N-FLAG-AKAP2 DSG2 (pGenLenti), AKAP2 WT (pGenDONR), and AKAP2 DSG2 (pGenDONR) were purchased from GenScript.

Techniques: Virus, Recombinant, Infection, Transfection, Western Blot, Saline, Sequencing, Plasmid Preparation, Mutagenesis, Bicinchoninic Acid Protein Assay, Staining, Expressing, Luciferase, Software, Mass Spectrometry

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) Schematic depicting AKAP2 showing the PKA binding domain and relative positions of the three putative βTrCP binding sites in AKAP2. The corresponding amino acids for each motif are 382–384 (DSG1), 472–474 (DSG2), and 502–504 (DSG3). (B) Sequence alignment of the DSG2 motif in Homo sapiens , Mus musculus , and Xenopus laevis. The CDC25B degron sequence for βTrCP is also shown, demonstrating a known example that is divergent from the canonical DSGxxS sequence. The sequence of the AKAP2 DSG2-motif mutant used in future experiments is shown below. (C) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 (WT or DSG degron mutants) together with an empty vector control or FLAG-βTrCP2. Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were treated with 100 ng/mL nocodazole for 16 h to synchronize cells in mitosis. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (F) HEK293T cells were co-transfected with the indicated plasmids for 48 h. After 48 h, the cells were collected and lysed under denaturing conditions. Ubiquitinated proteins were captured using Ni-NTA pull-down. The ubiquitination status of AKAP2 was analyzed by immunoblot. Cells were treated with 20 μM MG132 and 20 μM PR619 for 4 h prior to collection. n = 2. (G) In vitro ubiquitination reactions using TAMRA-labeled AKAP2 WT peptide or AKAP2 phospho-peptide (p-S473) as a substrate, monitored by fluorescence scanning of an SDS-PAGE gel. Representative of n = 4 independent experiments.

Article Snippet: pcDNA3.1(+) Myc-AKAP2 DSG1 , GenScript , N/A.

Techniques: Binding Assay, Sequencing, Mutagenesis, Transfection, Expressing, Plasmid Preparation, Control, Immunoprecipitation, Western Blot, Stable Transfection, Ubiquitin Proteomics, In Vitro, Labeling, Fluorescence, SDS Page

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet:

Article Snippet: pcDNA3.1(+) Myc-AKAP2 DSG1 , GenScript , N/A.

Techniques: Virus, Recombinant, Infection, Transfection, Western Blot, Saline, Sequencing, Plasmid Preparation, Mutagenesis, Bicinchoninic Acid Protein Assay, Staining, Expressing, Luciferase, Software, Mass Spectrometry

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) Schematic depicting AKAP2 showing the PKA binding domain and relative positions of the three putative βTrCP binding sites in AKAP2. The corresponding amino acids for each motif are 382–384 (DSG1), 472–474 (DSG2), and 502–504 (DSG3). (B) Sequence alignment of the DSG2 motif in Homo sapiens , Mus musculus , and Xenopus laevis. The CDC25B degron sequence for βTrCP is also shown, demonstrating a known example that is divergent from the canonical DSGxxS sequence. The sequence of the AKAP2 DSG2-motif mutant used in future experiments is shown below. (C) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 (WT or DSG degron mutants) together with an empty vector control or FLAG-βTrCP2. Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were treated with 100 ng/mL nocodazole for 16 h to synchronize cells in mitosis. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (F) HEK293T cells were co-transfected with the indicated plasmids for 48 h. After 48 h, the cells were collected and lysed under denaturing conditions. Ubiquitinated proteins were captured using Ni-NTA pull-down. The ubiquitination status of AKAP2 was analyzed by immunoblot. Cells were treated with 20 μM MG132 and 20 μM PR619 for 4 h prior to collection. n = 2. (G) In vitro ubiquitination reactions using TAMRA-labeled AKAP2 WT peptide or AKAP2 phospho-peptide (p-S473) as a substrate, monitored by fluorescence scanning of an SDS-PAGE gel. Representative of n = 4 independent experiments.

Article Snippet: AKAP2 vectors including N-Myc-AKAP2 WT (pcDNA 3.1+), N-Myc-AKAP2 DSG1 (pcDNA 3.1+), N-Myc-AKAP2 DSG2 (pcDNA 3.1+), N-Myc-AKAP2 DSG3 (pcDNA 3.1+), N-FLAG-AKAP2 WT (pGenLenti), N-FLAG-AKAP2 DSG2 (pGenLenti), AKAP2 WT (pGenDONR), and AKAP2 DSG2 (pGenDONR) were purchased from GenScript.

Techniques: Binding Assay, Sequencing, Mutagenesis, Transfection, Expressing, Plasmid Preparation, Control, Immunoprecipitation, Western Blot, Stable Transfection, Ubiquitin Proteomics, In Vitro, Labeling, Fluorescence, SDS Page

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet:

Article Snippet: AKAP2 vectors including N-Myc-AKAP2 WT (pcDNA 3.1+), N-Myc-AKAP2 DSG1 (pcDNA 3.1+), N-Myc-AKAP2 DSG2 (pcDNA 3.1+), N-Myc-AKAP2 DSG3 (pcDNA 3.1+), N-FLAG-AKAP2 WT (pGenLenti), N-FLAG-AKAP2 DSG2 (pGenLenti), AKAP2 WT (pGenDONR), and AKAP2 DSG2 (pGenDONR) were purchased from GenScript.

Techniques: Virus, Recombinant, Infection, Transfection, Western Blot, Saline, Sequencing, Plasmid Preparation, Mutagenesis, Bicinchoninic Acid Protein Assay, Staining, Expressing, Luciferase, Software, Mass Spectrometry

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) HCT116 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 100 nM BI6727, or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (B) HCT116 cells were transfected with siRNA targeting PLK1 or firefly luciferase (siFF) as a non-targeting control for 48 h. During the final 16 h, the cells were treated with 100 ng/mL nocodazole. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 2. (C) Wild-type or PLK1 analog-sensitive (AS) RPE-1 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 10 μM 3MB-PP1, or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-PLK1 (lane 2), or a catalytically inactive version of FLAG-PLK1 (T210A; lane 3). Twenty-four hours post-transfection, the cells were collected, and all cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-PLK1 (lane 2), or a version of FLAG-PLK1 containing a mutation within the Polo-box domain (Pincer; lane 3). Twenty-four hours post-transfection, the cells were collected, and PLK1 was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 2. (F) HCT116 cells were synchronized in mitosis using 100 ng/mL nocodazole for 16 h. Following synchronization, the cells were treated with 10 mM MLN4924 for 4 h prior to harvesting. Cells were then were collected using the mitotic shake-off procedure. Endogenous AKAP2 was immunoprecipitated and eluates were analyzed by immunoblot for the indicated proteins. WCE, whole-cell extract. n = 2. (G) Plot showing residues identified by MS on AKAP2 that were phosphorylated by PLK1 in an in vitro kinase assay. The x axis corresponds to amino acid residue numbers of AKAP2. PSM, peptide-spectrum match. Immunoprecipitated AKAP2 was incubated with three independent sources of recombinant PLK1. Each reaction was analyzed by MS with technical duplicates.

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: AGACCAGAGTCAAGCTCCTC , Eton Bioscience , N/A.

Techniques: Western Blot, Transfection, Luciferase, Control, Expressing, Plasmid Preparation, Mutagenesis, Immunoprecipitation, In Vitro, Kinase Assay, Residue, Incubation, Recombinant

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) HCT116 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 100 nM MLN4924, or 100 nM bortezomib for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 2. (B) Plot showing the log 2 ratio of all proteins identified by MS when comparing samples from BI2536-treated mitotic cells to samples from DMSO-treated mitotic cells (x axis) and the log 2 ratio of all proteins identified by MS when comparing samples from siβTrCP-treated mitotic cells to samples from siFF-treated mitotic cells (y axis). Claspin and WEE1 are identified as a positive controls. Proteins indicated in red were increased by PLK1i and siβTrCP. (C) HCT116 cells were transfected with siRNA targeting Cullin 1, βTrCP1/2, CCNF, or firefly luciferase (siFF) as a non-targeting control for 48 h. During the final 16 h, the cells were treated with 100 ng/mL nocodazole. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-βTrCP1 (lane 2), or wild-type FLAG-βTrCP2 (lane 3). Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-βTrCP2 (lane 2), or a version of FLAG-βTrCP2 with a mutation in the substrate binding domain (WD40 Mut ; lane 3). Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 2. (F) HCT116 cells were synchronized in mitosis using 100 ng/mL nocodazole for 16 h. Following synchronization, the cells were treated with 10 mM MLN4924 for 4 h prior to harvesting. Cells were then were collected using the mitotic shake-off procedure. Endogenous AKAP2 was immunoprecipitated and eluates were analyzed by immunoblot for the indicated proteins. WCE, whole-cell extract. Asterisk denotes the heavy chain. n = 2.

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: AGACCAGAGTCAAGCTCCTC , Eton Bioscience , N/A.

Techniques: Western Blot, Transfection, Luciferase, Control, Expressing, Plasmid Preparation, Immunoprecipitation, Mutagenesis, Binding Assay

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) Schematic depicting AKAP2 showing the PKA binding domain and relative positions of the three putative βTrCP binding sites in AKAP2. The corresponding amino acids for each motif are 382–384 (DSG1), 472–474 (DSG2), and 502–504 (DSG3). (B) Sequence alignment of the DSG2 motif in Homo sapiens , Mus musculus , and Xenopus laevis. The CDC25B degron sequence for βTrCP is also shown, demonstrating a known example that is divergent from the canonical DSGxxS sequence. The sequence of the AKAP2 DSG2-motif mutant used in future experiments is shown below. (C) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 (WT or DSG degron mutants) together with an empty vector control or FLAG-βTrCP2. Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were treated with 100 ng/mL nocodazole for 16 h to synchronize cells in mitosis. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (F) HEK293T cells were co-transfected with the indicated plasmids for 48 h. After 48 h, the cells were collected and lysed under denaturing conditions. Ubiquitinated proteins were captured using Ni-NTA pull-down. The ubiquitination status of AKAP2 was analyzed by immunoblot. Cells were treated with 20 μM MG132 and 20 μM PR619 for 4 h prior to collection. n = 2. (G) In vitro ubiquitination reactions using TAMRA-labeled AKAP2 WT peptide or AKAP2 phospho-peptide (p-S473) as a substrate, monitored by fluorescence scanning of an SDS-PAGE gel. Representative of n = 4 independent experiments.

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: AGACCAGAGTCAAGCTCCTC , Eton Bioscience , N/A.

Techniques: Binding Assay, Sequencing, Mutagenesis, Transfection, Expressing, Plasmid Preparation, Control, Immunoprecipitation, Western Blot, Stable Transfection, In Vitro, Labeling, Fluorescence, SDS Page

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) AKAP2 IP-MS schematic. Myc-AKAP2 was transfected into HEK293T cells in triplicate. AKAP2 was immunoprecipitated using anti-Myc affinity gel and samples were analyzed by LC-MS/MS. (B) AKAP2 interactome showing selected interactors and the biological processes they function in as identified by IP-MS. (C) HEK293T cells were transfected with Myc-AKAP2 or an empty pInducer20 vector (EV) control for 24 h. After 24 h, AKAP2 was immunoprecipitated using anti-Myc affinity gel, and the eluates were analyzed by immunoblot for the indicated proteins. n = 2. (D) Representative max projections of HCT116 FLAG-AKAP2 WT cells that were immunolabeled for DAPI, F-actin (phalloidin), microtubules (α-tubulin), and AKAP2. White arrows indicate areas of co-localization.

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: AGACCAGAGTCAAGCTCCTC , Eton Bioscience , N/A.

Techniques: Transfection, Immunoprecipitation, Liquid Chromatography with Mass Spectroscopy, Plasmid Preparation, Control, Western Blot, Immunolabeling

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) Representative images of a single z plane of HCT116 FLAG-AKAP2 WT and FLAG-AKAP2 DSG2 cells that were immunolabeled for DAPI, F-actin (phalloidin), microtubules (α-tubulin), and AKAP2, which are quantified in (B)–(D). (B) Quantification of F-actin via phalloidin immunostaining during metaphase. Phalloidin intensity was normalized to cell area. Statistical analysis was performed by two-tailed t test: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 43; AKAP2 DSG2 , 33. (C) Quantification of mitotic spindle length during metaphase. Statistical analysis was performed by two-tailed t test: * p % 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 37; AKAP2 DSG2 , 34. (D) Quantification of mitotic spindle orientation during metaphase. Statistical analysis was performed by two-tailed t test: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 37; AKAP2 DSG2 , 34.

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: AGACCAGAGTCAAGCTCCTC , Eton Bioscience , N/A.

Techniques: Immunolabeling, Immunostaining, Two Tailed Test

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet:

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: AGACCAGAGTCAAGCTCCTC , Eton Bioscience , N/A.

Techniques: Virus, Recombinant, Infection, Transfection, Western Blot, Saline, Sequencing, Plasmid Preparation, Mutagenesis, Bicinchoninic Acid Protein Assay, Staining, Expressing, Luciferase, Software, Mass Spectrometry

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) Schematic depicting AKAP2 showing the PKA binding domain and relative positions of the three putative βTrCP binding sites in AKAP2. The corresponding amino acids for each motif are 382–384 (DSG1), 472–474 (DSG2), and 502–504 (DSG3). (B) Sequence alignment of the DSG2 motif in Homo sapiens , Mus musculus , and Xenopus laevis. The CDC25B degron sequence for βTrCP is also shown, demonstrating a known example that is divergent from the canonical DSGxxS sequence. The sequence of the AKAP2 DSG2-motif mutant used in future experiments is shown below. (C) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 (WT or DSG degron mutants) together with an empty vector control or FLAG-βTrCP2. Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were treated with 100 ng/mL nocodazole for 16 h to synchronize cells in mitosis. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (F) HEK293T cells were co-transfected with the indicated plasmids for 48 h. After 48 h, the cells were collected and lysed under denaturing conditions. Ubiquitinated proteins were captured using Ni-NTA pull-down. The ubiquitination status of AKAP2 was analyzed by immunoblot. Cells were treated with 20 μM MG132 and 20 μM PR619 for 4 h prior to collection. n = 2. (G) In vitro ubiquitination reactions using TAMRA-labeled AKAP2 WT peptide or AKAP2 phospho-peptide (p-S473) as a substrate, monitored by fluorescence scanning of an SDS-PAGE gel. Representative of n = 4 independent experiments.

Article Snippet: pcDNA3.1(+) Myc-AKAP2 DSG2 , GenScript , N/A.

Techniques: Binding Assay, Sequencing, Mutagenesis, Transfection, Expressing, Plasmid Preparation, Control, Immunoprecipitation, Western Blot, Stable Transfection, Ubiquitin Proteomics, In Vitro, Labeling, Fluorescence, SDS Page

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) Representative images of a single z plane of HCT116 FLAG-AKAP2 WT and FLAG-AKAP2 DSG2 cells that were immunolabeled for DAPI, F-actin (phalloidin), microtubules (α-tubulin), and AKAP2, which are quantified in (B)–(D). (B) Quantification of F-actin via phalloidin immunostaining during metaphase. Phalloidin intensity was normalized to cell area. Statistical analysis was performed by two-tailed t test: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 43; AKAP2 DSG2 , 33. (C) Quantification of mitotic spindle length during metaphase. Statistical analysis was performed by two-tailed t test: * p % 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 37; AKAP2 DSG2 , 34. (D) Quantification of mitotic spindle orientation during metaphase. Statistical analysis was performed by two-tailed t test: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 37; AKAP2 DSG2 , 34.

Article Snippet: pcDNA3.1(+) Myc-AKAP2 DSG2 , GenScript , N/A.

Techniques: Immunolabeling, Immunostaining, Two Tailed Test

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet:

Article Snippet: pcDNA3.1(+) Myc-AKAP2 DSG2 , GenScript , N/A.

Techniques: Virus, Recombinant, Infection, Transfection, Western Blot, Saline, Sequencing, Plasmid Preparation, Mutagenesis, Bicinchoninic Acid Protein Assay, Staining, Expressing, Luciferase, Software, Mass Spectrometry

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) HCT116 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 100 nM BI6727, or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (B) HCT116 cells were transfected with siRNA targeting PLK1 or firefly luciferase (siFF) as a non-targeting control for 48 h. During the final 16 h, the cells were treated with 100 ng/mL nocodazole. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 2. (C) Wild-type or PLK1 analog-sensitive (AS) RPE-1 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 10 μM 3MB-PP1, or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-PLK1 (lane 2), or a catalytically inactive version of FLAG-PLK1 (T210A; lane 3). Twenty-four hours post-transfection, the cells were collected, and all cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-PLK1 (lane 2), or a version of FLAG-PLK1 containing a mutation within the Polo-box domain (Pincer; lane 3). Twenty-four hours post-transfection, the cells were collected, and PLK1 was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 2. (F) HCT116 cells were synchronized in mitosis using 100 ng/mL nocodazole for 16 h. Following synchronization, the cells were treated with 10 mM MLN4924 for 4 h prior to harvesting. Cells were then were collected using the mitotic shake-off procedure. Endogenous AKAP2 was immunoprecipitated and eluates were analyzed by immunoblot for the indicated proteins. WCE, whole-cell extract. n = 2. (G) Plot showing residues identified by MS on AKAP2 that were phosphorylated by PLK1 in an in vitro kinase assay. The x axis corresponds to amino acid residue numbers of AKAP2. PSM, peptide-spectrum match. Immunoprecipitated AKAP2 was incubated with three independent sources of recombinant PLK1. Each reaction was analyzed by MS with technical duplicates.

Article Snippet: pGenDONR AKAP2 WT , GenScript , N/A.

Techniques: Western Blot, Transfection, Luciferase, Control, Expressing, Plasmid Preparation, Mutagenesis, Immunoprecipitation, In Vitro, Kinase Assay, Residue, Incubation, Recombinant

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) HCT116 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 100 nM MLN4924, or 100 nM bortezomib for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 2. (B) Plot showing the log 2 ratio of all proteins identified by MS when comparing samples from BI2536-treated mitotic cells to samples from DMSO-treated mitotic cells (x axis) and the log 2 ratio of all proteins identified by MS when comparing samples from siβTrCP-treated mitotic cells to samples from siFF-treated mitotic cells (y axis). Claspin and WEE1 are identified as a positive controls. Proteins indicated in red were increased by PLK1i and siβTrCP. (C) HCT116 cells were transfected with siRNA targeting Cullin 1, βTrCP1/2, CCNF, or firefly luciferase (siFF) as a non-targeting control for 48 h. During the final 16 h, the cells were treated with 100 ng/mL nocodazole. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-βTrCP1 (lane 2), or wild-type FLAG-βTrCP2 (lane 3). Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-βTrCP2 (lane 2), or a version of FLAG-βTrCP2 with a mutation in the substrate binding domain (WD40 Mut ; lane 3). Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 2. (F) HCT116 cells were synchronized in mitosis using 100 ng/mL nocodazole for 16 h. Following synchronization, the cells were treated with 10 mM MLN4924 for 4 h prior to harvesting. Cells were then were collected using the mitotic shake-off procedure. Endogenous AKAP2 was immunoprecipitated and eluates were analyzed by immunoblot for the indicated proteins. WCE, whole-cell extract. Asterisk denotes the heavy chain. n = 2.

Article Snippet: pGenDONR AKAP2 WT , GenScript , N/A.

Techniques: Western Blot, Transfection, Luciferase, Control, Expressing, Plasmid Preparation, Immunoprecipitation, Mutagenesis, Binding Assay

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) Schematic depicting AKAP2 showing the PKA binding domain and relative positions of the three putative βTrCP binding sites in AKAP2. The corresponding amino acids for each motif are 382–384 (DSG1), 472–474 (DSG2), and 502–504 (DSG3). (B) Sequence alignment of the DSG2 motif in Homo sapiens , Mus musculus , and Xenopus laevis. The CDC25B degron sequence for βTrCP is also shown, demonstrating a known example that is divergent from the canonical DSGxxS sequence. The sequence of the AKAP2 DSG2-motif mutant used in future experiments is shown below. (C) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 (WT or DSG degron mutants) together with an empty vector control or FLAG-βTrCP2. Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were treated with 100 ng/mL nocodazole for 16 h to synchronize cells in mitosis. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (F) HEK293T cells were co-transfected with the indicated plasmids for 48 h. After 48 h, the cells were collected and lysed under denaturing conditions. Ubiquitinated proteins were captured using Ni-NTA pull-down. The ubiquitination status of AKAP2 was analyzed by immunoblot. Cells were treated with 20 μM MG132 and 20 μM PR619 for 4 h prior to collection. n = 2. (G) In vitro ubiquitination reactions using TAMRA-labeled AKAP2 WT peptide or AKAP2 phospho-peptide (p-S473) as a substrate, monitored by fluorescence scanning of an SDS-PAGE gel. Representative of n = 4 independent experiments.

Article Snippet: pGenDONR AKAP2 WT , GenScript , N/A.

Techniques: Binding Assay, Sequencing, Mutagenesis, Transfection, Expressing, Plasmid Preparation, Control, Immunoprecipitation, Western Blot, Stable Transfection, Ubiquitin Proteomics, In Vitro, Labeling, Fluorescence, SDS Page

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) AKAP2 IP-MS schematic. Myc-AKAP2 was transfected into HEK293T cells in triplicate. AKAP2 was immunoprecipitated using anti-Myc affinity gel and samples were analyzed by LC-MS/MS. (B) AKAP2 interactome showing selected interactors and the biological processes they function in as identified by IP-MS. (C) HEK293T cells were transfected with Myc-AKAP2 or an empty pInducer20 vector (EV) control for 24 h. After 24 h, AKAP2 was immunoprecipitated using anti-Myc affinity gel, and the eluates were analyzed by immunoblot for the indicated proteins. n = 2. (D) Representative max projections of HCT116 FLAG-AKAP2 WT cells that were immunolabeled for DAPI, F-actin (phalloidin), microtubules (α-tubulin), and AKAP2. White arrows indicate areas of co-localization.

Article Snippet: pGenDONR AKAP2 WT , GenScript , N/A.

Techniques: Protein-Protein interactions, Transfection, Immunoprecipitation, Liquid Chromatography with Mass Spectroscopy, Plasmid Preparation, Control, Western Blot, Immunolabeling

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) Representative images of a single z plane of HCT116 FLAG-AKAP2 WT and FLAG-AKAP2 DSG2 cells that were immunolabeled for DAPI, F-actin (phalloidin), microtubules (α-tubulin), and AKAP2, which are quantified in (B)–(D). (B) Quantification of F-actin via phalloidin immunostaining during metaphase. Phalloidin intensity was normalized to cell area. Statistical analysis was performed by two-tailed t test: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 43; AKAP2 DSG2 , 33. (C) Quantification of mitotic spindle length during metaphase. Statistical analysis was performed by two-tailed t test: * p % 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 37; AKAP2 DSG2 , 34. (D) Quantification of mitotic spindle orientation during metaphase. Statistical analysis was performed by two-tailed t test: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 37; AKAP2 DSG2 , 34.

Article Snippet: pGenDONR AKAP2 WT , GenScript , N/A.

Techniques: Immunolabeling, Immunostaining, Two Tailed Test

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet:

Article Snippet: pGenDONR AKAP2 WT , GenScript , N/A.

Techniques: Virus, Recombinant, Infection, Transfection, Western Blot, Saline, Sequencing, Plasmid Preparation, Mutagenesis, Bicinchoninic Acid Protein Assay, Staining, Expressing, Luciferase, Software, Mass Spectrometry

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet:

Article Snippet: pcDNA3.1(+) Myc-AKAP2 WT , GenScript , N/A.

Techniques: Virus, Recombinant, Infection, Transfection, Western Blot, Saline, Sequencing, Plasmid Preparation, Mutagenesis, Bicinchoninic Acid Protein Assay, Staining, Expressing, Luciferase, Software, Mass Spectrometry

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) HCT116 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 100 nM BI6727, or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (B) HCT116 cells were transfected with siRNA targeting PLK1 or firefly luciferase (siFF) as a non-targeting control for 48 h. During the final 16 h, the cells were treated with 100 ng/mL nocodazole. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 2. (C) Wild-type or PLK1 analog-sensitive (AS) RPE-1 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 10 μM 3MB-PP1, or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-PLK1 (lane 2), or a catalytically inactive version of FLAG-PLK1 (T210A; lane 3). Twenty-four hours post-transfection, the cells were collected, and all cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-PLK1 (lane 2), or a version of FLAG-PLK1 containing a mutation within the Polo-box domain (Pincer; lane 3). Twenty-four hours post-transfection, the cells were collected, and PLK1 was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 2. (F) HCT116 cells were synchronized in mitosis using 100 ng/mL nocodazole for 16 h. Following synchronization, the cells were treated with 10 mM MLN4924 for 4 h prior to harvesting. Cells were then were collected using the mitotic shake-off procedure. Endogenous AKAP2 was immunoprecipitated and eluates were analyzed by immunoblot for the indicated proteins. WCE, whole-cell extract. n = 2. (G) Plot showing residues identified by MS on AKAP2 that were phosphorylated by PLK1 in an in vitro kinase assay. The x axis corresponds to amino acid residue numbers of AKAP2. PSM, peptide-spectrum match. Immunoprecipitated AKAP2 was incubated with three independent sources of recombinant PLK1. Each reaction was analyzed by MS with technical duplicates.

Article Snippet: AKAP2 vectors including N-Myc-AKAP2 WT (pcDNA 3.1+), N-Myc-AKAP2 DSG1 (pcDNA 3.1+), N-Myc-AKAP2 DSG2 (pcDNA 3.1+), N-Myc-AKAP2 DSG3 (pcDNA 3.1+), N-FLAG-AKAP2 WT (pGenLenti), N-FLAG-AKAP2 DSG2 (pGenLenti), AKAP2 WT (pGenDONR), and AKAP2 DSG2 (pGenDONR) were purchased from GenScript.

Techniques: Western Blot, Transfection, Luciferase, Control, Expressing, Plasmid Preparation, Mutagenesis, Immunoprecipitation, In Vitro, Kinase Assay, Residue, Incubation, Recombinant

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) HCT116 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 100 nM MLN4924, or 100 nM bortezomib for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 2. (B) Plot showing the log 2 ratio of all proteins identified by MS when comparing samples from BI2536-treated mitotic cells to samples from DMSO-treated mitotic cells (x axis) and the log 2 ratio of all proteins identified by MS when comparing samples from siβTrCP-treated mitotic cells to samples from siFF-treated mitotic cells (y axis). Claspin and WEE1 are identified as a positive controls. Proteins indicated in red were increased by PLK1i and siβTrCP. (C) HCT116 cells were transfected with siRNA targeting Cullin 1, βTrCP1/2, CCNF, or firefly luciferase (siFF) as a non-targeting control for 48 h. During the final 16 h, the cells were treated with 100 ng/mL nocodazole. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-βTrCP1 (lane 2), or wild-type FLAG-βTrCP2 (lane 3). Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-βTrCP2 (lane 2), or a version of FLAG-βTrCP2 with a mutation in the substrate binding domain (WD40 Mut ; lane 3). Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 2. (F) HCT116 cells were synchronized in mitosis using 100 ng/mL nocodazole for 16 h. Following synchronization, the cells were treated with 10 mM MLN4924 for 4 h prior to harvesting. Cells were then were collected using the mitotic shake-off procedure. Endogenous AKAP2 was immunoprecipitated and eluates were analyzed by immunoblot for the indicated proteins. WCE, whole-cell extract. Asterisk denotes the heavy chain. n = 2.

Article Snippet: AKAP2 vectors including N-Myc-AKAP2 WT (pcDNA 3.1+), N-Myc-AKAP2 DSG1 (pcDNA 3.1+), N-Myc-AKAP2 DSG2 (pcDNA 3.1+), N-Myc-AKAP2 DSG3 (pcDNA 3.1+), N-FLAG-AKAP2 WT (pGenLenti), N-FLAG-AKAP2 DSG2 (pGenLenti), AKAP2 WT (pGenDONR), and AKAP2 DSG2 (pGenDONR) were purchased from GenScript.

Techniques: Western Blot, Transfection, Luciferase, Control, Expressing, Plasmid Preparation, Immunoprecipitation, Mutagenesis, Binding Assay

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) Schematic depicting AKAP2 showing the PKA binding domain and relative positions of the three putative βTrCP binding sites in AKAP2. The corresponding amino acids for each motif are 382–384 (DSG1), 472–474 (DSG2), and 502–504 (DSG3). (B) Sequence alignment of the DSG2 motif in Homo sapiens , Mus musculus , and Xenopus laevis. The CDC25B degron sequence for βTrCP is also shown, demonstrating a known example that is divergent from the canonical DSGxxS sequence. The sequence of the AKAP2 DSG2-motif mutant used in future experiments is shown below. (C) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 (WT or DSG degron mutants) together with an empty vector control or FLAG-βTrCP2. Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were treated with 100 ng/mL nocodazole for 16 h to synchronize cells in mitosis. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (F) HEK293T cells were co-transfected with the indicated plasmids for 48 h. After 48 h, the cells were collected and lysed under denaturing conditions. Ubiquitinated proteins were captured using Ni-NTA pull-down. The ubiquitination status of AKAP2 was analyzed by immunoblot. Cells were treated with 20 μM MG132 and 20 μM PR619 for 4 h prior to collection. n = 2. (G) In vitro ubiquitination reactions using TAMRA-labeled AKAP2 WT peptide or AKAP2 phospho-peptide (p-S473) as a substrate, monitored by fluorescence scanning of an SDS-PAGE gel. Representative of n = 4 independent experiments.

Article Snippet: AKAP2 vectors including N-Myc-AKAP2 WT (pcDNA 3.1+), N-Myc-AKAP2 DSG1 (pcDNA 3.1+), N-Myc-AKAP2 DSG2 (pcDNA 3.1+), N-Myc-AKAP2 DSG3 (pcDNA 3.1+), N-FLAG-AKAP2 WT (pGenLenti), N-FLAG-AKAP2 DSG2 (pGenLenti), AKAP2 WT (pGenDONR), and AKAP2 DSG2 (pGenDONR) were purchased from GenScript.

Techniques: Binding Assay, Sequencing, Mutagenesis, Transfection, Expressing, Plasmid Preparation, Control, Immunoprecipitation, Western Blot, Stable Transfection, Ubiquitin Proteomics, In Vitro, Labeling, Fluorescence, SDS Page

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) AKAP2 IP-MS schematic. Myc-AKAP2 was transfected into HEK293T cells in triplicate. AKAP2 was immunoprecipitated using anti-Myc affinity gel and samples were analyzed by LC-MS/MS. (B) AKAP2 interactome showing selected interactors and the biological processes they function in as identified by IP-MS. (C) HEK293T cells were transfected with Myc-AKAP2 or an empty pInducer20 vector (EV) control for 24 h. After 24 h, AKAP2 was immunoprecipitated using anti-Myc affinity gel, and the eluates were analyzed by immunoblot for the indicated proteins. n = 2. (D) Representative max projections of HCT116 FLAG-AKAP2 WT cells that were immunolabeled for DAPI, F-actin (phalloidin), microtubules (α-tubulin), and AKAP2. White arrows indicate areas of co-localization.

Article Snippet: AKAP2 vectors including N-Myc-AKAP2 WT (pcDNA 3.1+), N-Myc-AKAP2 DSG1 (pcDNA 3.1+), N-Myc-AKAP2 DSG2 (pcDNA 3.1+), N-Myc-AKAP2 DSG3 (pcDNA 3.1+), N-FLAG-AKAP2 WT (pGenLenti), N-FLAG-AKAP2 DSG2 (pGenLenti), AKAP2 WT (pGenDONR), and AKAP2 DSG2 (pGenDONR) were purchased from GenScript.

Techniques: Protein-Protein interactions, Transfection, Immunoprecipitation, Liquid Chromatography with Mass Spectroscopy, Plasmid Preparation, Control, Western Blot, Immunolabeling

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) Representative images of a single z plane of HCT116 FLAG-AKAP2 WT and FLAG-AKAP2 DSG2 cells that were immunolabeled for DAPI, F-actin (phalloidin), microtubules (α-tubulin), and AKAP2, which are quantified in (B)–(D). (B) Quantification of F-actin via phalloidin immunostaining during metaphase. Phalloidin intensity was normalized to cell area. Statistical analysis was performed by two-tailed t test: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 43; AKAP2 DSG2 , 33. (C) Quantification of mitotic spindle length during metaphase. Statistical analysis was performed by two-tailed t test: * p % 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 37; AKAP2 DSG2 , 34. (D) Quantification of mitotic spindle orientation during metaphase. Statistical analysis was performed by two-tailed t test: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 37; AKAP2 DSG2 , 34.

Article Snippet: AKAP2 vectors including N-Myc-AKAP2 WT (pcDNA 3.1+), N-Myc-AKAP2 DSG1 (pcDNA 3.1+), N-Myc-AKAP2 DSG2 (pcDNA 3.1+), N-Myc-AKAP2 DSG3 (pcDNA 3.1+), N-FLAG-AKAP2 WT (pGenLenti), N-FLAG-AKAP2 DSG2 (pGenLenti), AKAP2 WT (pGenDONR), and AKAP2 DSG2 (pGenDONR) were purchased from GenScript.

Techniques: Immunolabeling, Immunostaining, Two Tailed Test

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet:

Article Snippet: AKAP2 vectors including N-Myc-AKAP2 WT (pcDNA 3.1+), N-Myc-AKAP2 DSG1 (pcDNA 3.1+), N-Myc-AKAP2 DSG2 (pcDNA 3.1+), N-Myc-AKAP2 DSG3 (pcDNA 3.1+), N-FLAG-AKAP2 WT (pGenLenti), N-FLAG-AKAP2 DSG2 (pGenLenti), AKAP2 WT (pGenDONR), and AKAP2 DSG2 (pGenDONR) were purchased from GenScript.

Techniques: Virus, Recombinant, Infection, Transfection, Western Blot, Saline, Sequencing, Plasmid Preparation, Mutagenesis, Bicinchoninic Acid Protein Assay, Staining, Expressing, Luciferase, Software, Mass Spectrometry