Journal: Aging

Article Title: Copper metabolism-related risk score identifies hepatocellular carcinoma subtypes and SLC27A5 as a potential regulator of cuproptosis.

doi: 10.18632/aging.205334

Figure Lengend Snippet: Figure 8. The expression and function of SLC27A5 in HCC. (A–C) The transcriptional expression of SLC27A5 in HCC and normal tissues of TCGA-LIHC (A), GSE14520 (B) and GSE64041 (C) datasets. (D) The protein level of SLC27A5 in HCC and normal tissues. (E, F) CCK-8 assay for HepG2 (E) and LM-3 (F) cells overexpressing SL27A5. (G, H) HepG2 (G) and LM-3 (H) cells were subject to flow cytometry analysis for cell cycle. (I) HCC cells overexpressing SLC27A5 were subject to EdU staining. (J) HCC cells overexpressing SLC27A5 were subject to wound healing assay.

Article Snippet: Western blotting was performed using antibodies against FDX1 (M05441, Boster), SLC27A5 (A09287-2, Boster), GAPDH (BM3876, Boster).

Techniques: Expressing, CCK-8 Assay, Flow Cytometry, Staining, Wound Healing Assay

Journal: Aging

Article Title: Copper metabolism-related risk score identifies hepatocellular carcinoma subtypes and SLC27A5 as a potential regulator of cuproptosis.

doi: 10.18632/aging.205334

Figure Lengend Snippet: Figure 9. SLC27A5 upregulates FDX1 in HCC. (A, B) The correlation between the expression of SLC27A5 and that of FDX1 in TCGA-LIHC (A) and GSE14520 (B) datasets. (C) Dot plot showing the dependency scores for SLC27A5 and FDX1 across all tumor cell lines in the Project Achilles/Cancer Dependency Map Portal (DepMap). (D, E) The expression of and correlation between SLC27A5 and FDX1 in collected HCC tissue chip. (F, G) HepG2 (F) and LM-3 (G) cells overexpressing SLC27A5 were subject to qRT-PCR analysis. (H, I) Western blotting using lysates of HepG2 (H) and LM-3 (I) cells after overexpressing SLC27A5.

Article Snippet: Western blotting was performed using antibodies against FDX1 (M05441, Boster), SLC27A5 (A09287-2, Boster), GAPDH (BM3876, Boster).

Techniques: Expressing, Quantitative RT-PCR, Western Blot

Journal: Journal of Nanobiotechnology

Article Title: Plasma exosome miRNA-26b-3p derived from idiopathic short stature impairs longitudinal bone growth via the AKAP2/ERK1/2 axis

doi: 10.1186/s12951-023-01849-8

Figure Lengend Snippet: miR-26b-3p in exosomes inhibits chondrocytes proliferation and endochondral ossification via the AKAP2 in vitro . A mRNA microarray assays was performed to identify differentially expressed genes after overexpression of miR-26b-3p. B The results showed that 316 mRNAs were differentially expressed, with 126 upregulated and 190 downregulated mRNAs. C , D Western blot and RT-qPCR analyses confirmed that AKAP2 expression was decreased upon overexpression of miR-26b-3p. E Luciferase activity assays revealed that co-transfection of AKAP2 with its mutant fragment restored luciferase activity, indicating that AKAP2 is a direct target of miR-26b-3p. The data are presented as the mean ± SD. n = 3. Two groups were compared using T -test. **P < 0.01, ***P < 0.001 vs. control

Article Snippet: Lastly, the medium was changed to DMEM containing serum and incubated for 72 h. AKAP2 was overexpressed using recombinant AKAP2 protein (Novus, Bio-Techne, USA). siRNAs (miR-26b-3p siRNA, NC-miRNA siRNA, AKAP2 siRNA, and NC-mRNA siRNA) were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, USA).

Techniques: In Vitro, Microarray, Over Expression, Western Blot, Quantitative RT-PCR, Expressing, Luciferase, Activity Assay, Cotransfection, Mutagenesis

Journal: Journal of Nanobiotechnology

Article Title: Plasma exosome miRNA-26b-3p derived from idiopathic short stature impairs longitudinal bone growth via the AKAP2/ERK1/2 axis

doi: 10.1186/s12951-023-01849-8

Figure Lengend Snippet: Rescue experiments indicates that AKAP2 overexpression reversed the inhibition of human chondrocyte proliferation caused by overmiR-26b-3P. A AKAP2 presented downregulation after overexpression of miR-26b-3p, however, it was significantly improved in the group of miR-26b-3p upregulation + AKAP2. B , C Although CCK8 and cell cycle were inhibited in the miR-26b-3p mimic + NC group, whereas it was enhanced in the miR-26b-3p mimic + AKAP2 group. D–G Compared with the group of miR-26b-3p upregulation, the expression of marker genes of chondrocyte hypertrophic differentiation (COL10A and RUNX2) and the osteogenic genes (OCN and OPN) was also significantly improved in the group of miR-26b-3p upregulation + AKAP2 upregulation. H Although the activity of ALP in chondrocytes were suppressed after miR-26b-3p upregulation, it was reversed after AKAP2 was upregulated. The data are presented as the mean ± SD. n = 3. Two groups were compared using T -test or three groups were compared using ANOVA followed by Tukey’s test. ns, not significant, *P < 0.05, **P < 0.01, ***P < 0.001 vs. control

Article Snippet: Lastly, the medium was changed to DMEM containing serum and incubated for 72 h. AKAP2 was overexpressed using recombinant AKAP2 protein (Novus, Bio-Techne, USA). siRNAs (miR-26b-3p siRNA, NC-miRNA siRNA, AKAP2 siRNA, and NC-mRNA siRNA) were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, USA).

Techniques: Over Expression, Inhibition, Expressing, Marker, Activity Assay

Journal: Journal of Nanobiotechnology

Article Title: Plasma exosome miRNA-26b-3p derived from idiopathic short stature impairs longitudinal bone growth via the AKAP2/ERK1/2 axis

doi: 10.1186/s12951-023-01849-8

Figure Lengend Snippet: MiR-26b-3p inhibits estrogen receptor α (ER-α) via AKAP2/ERK1/2 axis in human chondrocytes. A , B The relative mRNA and protein expression levels of ER-α did not show statistical difference between the group of miR-26b-3p overexpression and control group. C The expression of p-ER-α was obviously downregulated in the group of miR-26b-3p overexpression compared with control group. D , E The expression of ERK1/2 protein and p-ERK1/2 protein. Similarly, significant differences on the relative mRNA and protein expression of ERK1/2 were not observed between the group of miR-26b-3p overexpression and control group in our study. F The expression of p-ERK1/2 protein was significantly decreased in the group of miR-26b-3p overexpression compared with control group. The data are presented as the mean ± SD. n = 3. Two groups were compared using T -test or three groups were compared using ANOVA followed by Tukey’s test. ns, not significant, **P < 0.01, ***P < 0.001 vs. control

Article Snippet: Lastly, the medium was changed to DMEM containing serum and incubated for 72 h. AKAP2 was overexpressed using recombinant AKAP2 protein (Novus, Bio-Techne, USA). siRNAs (miR-26b-3p siRNA, NC-miRNA siRNA, AKAP2 siRNA, and NC-mRNA siRNA) were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, USA).

Techniques: Expressing, Over Expression

Journal: Journal of Nanobiotechnology

Article Title: Plasma exosome miRNA-26b-3p derived from idiopathic short stature impairs longitudinal bone growth via the AKAP2/ERK1/2 axis

doi: 10.1186/s12951-023-01849-8

Figure Lengend Snippet: miR-26b-3p in exosomes can inhibit proliferation and endochondral ossification of growth plate chondrocytes via the AKAP2 axis in vivo. A – G The findings from western blotting, RT-qPCR, and immunohistochemistry revealed that AKAP2, which is the downstream target gene of miR-26b-3p, was significantly downregulated in growth plates. The data are presented as the mean ± SD. n = 3. Two groups were compared using T -test or three groups were compared using ANOVA followed by Tukey’s test. *P < 0.05, **P < 0.01, vs. control

Article Snippet: Lastly, the medium was changed to DMEM containing serum and incubated for 72 h. AKAP2 was overexpressed using recombinant AKAP2 protein (Novus, Bio-Techne, USA). siRNAs (miR-26b-3p siRNA, NC-miRNA siRNA, AKAP2 siRNA, and NC-mRNA siRNA) were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, USA).

Techniques: In Vivo, Western Blot, Quantitative RT-PCR, Immunohistochemistry

Journal: Journal of Nanobiotechnology

Article Title: Plasma exosome miRNA-26b-3p derived from idiopathic short stature impairs longitudinal bone growth via the AKAP2/ERK1/2 axis

doi: 10.1186/s12951-023-01849-8

Figure Lengend Snippet: Overexpression of miR-26b-3p suppressed the endochondral ossification of femur growth plate in the rats. A – D RUNX2, type X collagen, AKAP2, OCN, and OPN, the hallmark genes of differentiation and endochondral ossification, were downregulated. E Safranin O-fast green staining showed that the height of the femoral growth plates in the miR-26b-3p–overexpressed group was lesser than that in the NC group. F , G BrdU labeling demonstrated that the positive markers of the femoral growth plate proliferating regions in the miR-26b-3p–overexpressed group were lower than those in the NC group. H , I Calcein experiment confirmed that the new osteogenesis rate of growth plate chondrocytes in the miR-26b-3p–overexpressed group decreased significantly. The data are presented as the mean ± SD. n = 3. Two groups were compared using T -test. *P < 0.05, **P < 0.01, ***P < 0.001 vs. control

Article Snippet: Lastly, the medium was changed to DMEM containing serum and incubated for 72 h. AKAP2 was overexpressed using recombinant AKAP2 protein (Novus, Bio-Techne, USA). siRNAs (miR-26b-3p siRNA, NC-miRNA siRNA, AKAP2 siRNA, and NC-mRNA siRNA) were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, USA).

Techniques: Over Expression, Staining, Labeling

Journal: EMBO Molecular Medicine

Article Title: AKAP2 anchors PKA with aquaporin-0 to support ocular lens transparency

doi: 10.1002/emmm.201100184

Figure Lengend Snippet: Autoradiograph following 32 P-RII overlay of sheep lens homogenate. 32 P-RII overlay of lens proteins eluted following addition of PreScission protease to GST (lane 1) and GST-D/D (lane 2) lens immunoprecipitates. Annotated bovine AKAP2 primary sequence. Sheep sequences identified by MS that are identical to the bovine ortholog are underlined in red. The epitope recognized by the anti-AKAP2 antibody is depicted (bold text) in the shaded area. Anti-AKAP2 IB of sheep lens homogenate. Proteins were immunoprecipitated from sheep lens homogenate (input, lane 1) with either rabbit IgG (lane 2) or anti-AKAP2 antibody (lane 3). Co-IP of PKA RII (middle panel) and C (lower panel) subunits is shown by immunoblotting. PKI-sensitive PKA activity in sheep lens homogenate immunoprecipitated with either control rabbit IgG or anti-AKAP2 antibody. Amalgamated data from three experiments are presented.

Article Snippet: Human AKAP2 (accession BC140818) was purchased from Origene and cloned into the pET15b vector.

Techniques: Autoradiography, Sequencing, Immunoprecipitation, Co-Immunoprecipitation Assay, Western Blot, Activity Assay

Journal: EMBO Molecular Medicine

Article Title: AKAP2 anchors PKA with aquaporin-0 to support ocular lens transparency

doi: 10.1002/emmm.201100184

Figure Lengend Snippet: A. Schematic of lens cellular architecture. Hexagonal fibre cells are visible in equatorial sections; migrating nuclei at the equator are depicted in axial sections. Epithelial cells are continually generated at the anterior surface and migrate into the outer cortex of the lens at the equator, where they differentiate to fibre cells. Fibre cells develop an elongated hexagonal shape that facilitates packing of neighbouring cells into a lattice. As new fibre cells are added to the cortex, older fibre cells become buried into the core of the lens, where they are terminally differentiated—losing their nuclei and other organelles. B. Sheep lens homogenate (lane 1) was separated into core (lane 2) and cortex (lane 3). The cortex was subfractionated into membrane (lane 4) and supernatant (lane 5). C. Cortical membranes were incubated with LLB containing either 0 M NaCl (lanes 1 and 2) or 1 M NaCl (lanes 3 and 4) before subfractionation into membrane (lanes 1 and 3) and supernatant (lanes 2 and 4) fractions. ( B and C ) Immunoblotting against AKAP2 (upper panel) and AQP0 (lower panel) is shown for each fraction. D–F. 10× magnification imaging of axial sections of mouse lens stained with anti-AKAP2 antibody ( D , red in F ) and the nuclear marker DRAQ5 ( E , blue in F ). Three separate images were aligned to cover the lens from the anterior pole to the equator. G–J. Immunofluorescence (40×) images of equatorial lens sections are shown following staining with anti-AKAP2 antibody ( G , red in J ), membrane marker WGA ( H , green in J ) and DRAQ5 ( I , blue in J ). K–M. High-magnification images of equatorial sections of outer lens cortex are shown following staining with anti-AKAP2 antibody ( K , red in M ), WGA ( L , green in M ) and DRAQ5 (blue in L ).

Article Snippet: Human AKAP2 (accession BC140818) was purchased from Origene and cloned into the pET15b vector.

Techniques: Generated, Incubation, Western Blot, Imaging, Staining, Marker, Immunofluorescence

Journal: EMBO Molecular Medicine

Article Title: AKAP2 anchors PKA with aquaporin-0 to support ocular lens transparency

doi: 10.1002/emmm.201100184

Figure Lengend Snippet: A. Proteins from sheep lens homogenate (lane 1) were immunoprecipitated with rabbit IgG (lane 2) or anti-AKAP2 antibody (lane 3). Co-immunoprecipitation of AQP0 was detected by anti-AQP0 IB (lower panel). B–D. Immunohistochemistry showing co-distribution of AKAP2 ( B ) and AQP0 ( C ) in equatorial lens sections imaged at high magnification. A composite image ( D ) shows AKAP2 (red), AQP0 (green) and DRAQ5 (blue). E. IB of recombinant AKAP2 produced in bacteria. F. A series of immobilized 20-mer peptides, moving along the AQP0 sequence in increments of two amino acids in an N- to C- direction from residues 225–263 was synthesized by spot array. Each peptide was coupled to a PEG-amino membrane via the C-terminal carboxyl group. Coupling efficiency was assessed by UV illuminescence (left column). Binding of purified AKAP2 is shown by anti-AKAP2 IB (right column). AKAP2 binding determinants are highlighted in green. G. Proteins were immunoprecipitated from sheep lens homogenate (input) with either rabbit IgG (lane 1) or anti-AKAP2 antibody (lanes 2–4). Co-IPs were coincubated without peptide (lanes 1 and 2), with WT peptide 7 (lane 3) or with scrambled peptide 7 (lane 4). Co-IP of AQP0 is demonstrated by anti-AQP0 IB in the lower panel. H. Alanine scanning of a peptide (peptide 7) that spans the AKAP2 binding site. Peptide derivatives were overlaid with purified AKAP2. AKAP2 was detected by IB.

Article Snippet: Human AKAP2 (accession BC140818) was purchased from Origene and cloned into the pET15b vector.

Techniques: Immunoprecipitation, Immunohistochemistry, Recombinant, Produced, Sequencing, Synthesized, Binding Assay, Purification, Co-Immunoprecipitation Assay

Journal: EMBO Molecular Medicine

Article Title: AKAP2 anchors PKA with aquaporin-0 to support ocular lens transparency

doi: 10.1002/emmm.201100184

Figure Lengend Snippet: Autoradiograph (top panel) showing 32 P incorporation into purified AQP0 (anti-AQP0 IB, lower panel) following incubation with 32 P-γATP +/− PKA C subunit and +/− PKI. Product ion scan of SVSERLpSILK peptide. Neutral loss of H 3 PO 4 is strong. A series of γ-H 3 PO 4 and β-H 3 PO 4 ions were observed enabling determination of the phosphorylation site location at Ser235. Normalized intensity of SVSERLpSILK peptide with retention time during LC following incubation of AQP0 with PKA (red), without PKA (black) and with both PKA + PKI (blue). Autoradiograph (right column) following PKA phosphorylation of arrayed AQP0 233–252 peptides with 32 P-γATP. Equal spotting efficiency is demonstrated by UV illuminescence. Each serine and threonine residue was mutated to alanine as indicated. Structural representation using the coordinates of AQP0 (Gonen et al, ). Inset: location of the PKA phosphorylation site, AKAP2 binding domain (green) and helical segment (yellow) in the C-terminal domain of AQP0 (PDB ID 2B6P; Gonen et al, ). Native gel electrophoresis of CaM alone (lane 1) or in the presence of unphosphorylated (lane 2) or Ser235-phosphorylated (lane 3) AQP0 223–242 peptide. Electrostatic surface representation of the AQP0 C-terminal helix situated between residues 227 and 239 in its unphosphorylated (left) and Ser235-phosphorylated (right) states. Electrostatic surface of the CaM binding cleft. Location of the PKA recognition motif for Ser235 in WT and R233K mutant (Gu et al, ) AQP0. Phosphorylation of WT (lanes 1 and 2) and R233K mutant (lanes 3 and 4) AQP0 (223–242) peptides with 32 P-ATP was attempted in solution with PKA in the presence (lanes 2 and 4) and absence (lanes 1 and 3) of PKI.

Article Snippet: Human AKAP2 (accession BC140818) was purchased from Origene and cloned into the pET15b vector.

Techniques: Autoradiography, Purification, Incubation, Binding Assay, Nucleic Acid Electrophoresis, Mutagenesis

Journal: Molecular Cell

Article Title: DDI2 Is a Ubiquitin-Directed Endoprotease Responsible for Cleavage of Transcription Factor NRF1

doi: 10.1016/j.molcel.2020.05.035

Figure Lengend Snippet: DDI2 Cleaves Ubiquitylated NRF1 Protein In Vitro (A) Western blot analysis of NRF1 protein, isolated via GST-DSK2 chromatography, after treatment with DDI2, RAD23, and USP2, as indicated (4%–15% TGX). The mobility of NRF1 and cleaved NRF1 is shown on the right (see also arrow for cleaved NRF1). Zoomed-in images of lanes 13 and 14 and 19 and 20 are shown below. Note that large amounts of extract were used as input for GST-DSK2 purification, meaning that in relative terms, ~20× “extract equivalents” were loaded in lanes 5–20 compared to lanes 1–4. See also Figure S6 A. (B) Reprobing of the membrane from (A), with anti-ubiquitin antibodies. For simplicity, only the relevant lanes 5–9 are shown. (C) Experiment as in (A), but testing DDI2 D→N , as indicated. (D) As in (A) and (B), but testing cleavage of exogenously expressed, Myc-tagged versions of NRF1. N, normal NRF1 sequence. m, mutated sequence. Lower panel, lanes 2 and 6 are shown in the enlargement. The “dot” in lane 6 is not a cleavage band. See also independent experiment in Figure S6 B.

Article Snippet: NRF1- Myc pcDNA3.1(+)-C-Myc (NAWLVH 106 → A A AAAA ) , Genscript , This study.

Techniques: In Vitro, Western Blot, Isolation, Chromatography, Purification, Membrane, Ubiquitin Proteomics, Sequencing

Journal: Molecular Cell

Article Title: DDI2 Is a Ubiquitin-Directed Endoprotease Responsible for Cleavage of Transcription Factor NRF1

doi: 10.1016/j.molcel.2020.05.035

Figure Lengend Snippet:

Article Snippet: NRF1- Myc pcDNA3.1(+)-C-Myc (NAWLVH 106 → A A AAAA ) , Genscript , This study.

Techniques: Virus, Recombinant, Multiplex sample analysis, Ubiquitin Proteomics, Membrane, Mass Spectrometry, Western Blot, Sequencing, Plasmid Preparation, Software, Transfection

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) HCT116 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 100 nM BI6727, or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (B) HCT116 cells were transfected with siRNA targeting PLK1 or firefly luciferase (siFF) as a non-targeting control for 48 h. During the final 16 h, the cells were treated with 100 ng/mL nocodazole. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 2. (C) Wild-type or PLK1 analog-sensitive (AS) RPE-1 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 10 μM 3MB-PP1, or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-PLK1 (lane 2), or a catalytically inactive version of FLAG-PLK1 (T210A; lane 3). Twenty-four hours post-transfection, the cells were collected, and all cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-PLK1 (lane 2), or a version of FLAG-PLK1 containing a mutation within the Polo-box domain (Pincer; lane 3). Twenty-four hours post-transfection, the cells were collected, and PLK1 was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 2. (F) HCT116 cells were synchronized in mitosis using 100 ng/mL nocodazole for 16 h. Following synchronization, the cells were treated with 10 mM MLN4924 for 4 h prior to harvesting. Cells were then were collected using the mitotic shake-off procedure. Endogenous AKAP2 was immunoprecipitated and eluates were analyzed by immunoblot for the indicated proteins. WCE, whole-cell extract. n = 2. (G) Plot showing residues identified by MS on AKAP2 that were phosphorylated by PLK1 in an in vitro kinase assay. The x axis corresponds to amino acid residue numbers of AKAP2. PSM, peptide-spectrum match. Immunoprecipitated AKAP2 was incubated with three independent sources of recombinant PLK1. Each reaction was analyzed by MS with technical duplicates.

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: GGACGAATTGGCGGTGAGGTCTC , Eton Bioscience , N/A.

Techniques: Western Blot, Transfection, Luciferase, Control, Expressing, Plasmid Preparation, Mutagenesis, Immunoprecipitation, In Vitro, Kinase Assay, Residue, Incubation, Recombinant

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) HCT116 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 100 nM MLN4924, or 100 nM bortezomib for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 2. (B) Plot showing the log 2 ratio of all proteins identified by MS when comparing samples from BI2536-treated mitotic cells to samples from DMSO-treated mitotic cells (x axis) and the log 2 ratio of all proteins identified by MS when comparing samples from siβTrCP-treated mitotic cells to samples from siFF-treated mitotic cells (y axis). Claspin and WEE1 are identified as a positive controls. Proteins indicated in red were increased by PLK1i and siβTrCP. (C) HCT116 cells were transfected with siRNA targeting Cullin 1, βTrCP1/2, CCNF, or firefly luciferase (siFF) as a non-targeting control for 48 h. During the final 16 h, the cells were treated with 100 ng/mL nocodazole. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-βTrCP1 (lane 2), or wild-type FLAG-βTrCP2 (lane 3). Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-βTrCP2 (lane 2), or a version of FLAG-βTrCP2 with a mutation in the substrate binding domain (WD40 Mut ; lane 3). Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 2. (F) HCT116 cells were synchronized in mitosis using 100 ng/mL nocodazole for 16 h. Following synchronization, the cells were treated with 10 mM MLN4924 for 4 h prior to harvesting. Cells were then were collected using the mitotic shake-off procedure. Endogenous AKAP2 was immunoprecipitated and eluates were analyzed by immunoblot for the indicated proteins. WCE, whole-cell extract. Asterisk denotes the heavy chain. n = 2.

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: GGACGAATTGGCGGTGAGGTCTC , Eton Bioscience , N/A.

Techniques: Western Blot, Transfection, Luciferase, Control, Expressing, Plasmid Preparation, Immunoprecipitation, Mutagenesis, Binding Assay

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) Schematic depicting AKAP2 showing the PKA binding domain and relative positions of the three putative βTrCP binding sites in AKAP2. The corresponding amino acids for each motif are 382–384 (DSG1), 472–474 (DSG2), and 502–504 (DSG3). (B) Sequence alignment of the DSG2 motif in Homo sapiens , Mus musculus , and Xenopus laevis. The CDC25B degron sequence for βTrCP is also shown, demonstrating a known example that is divergent from the canonical DSGxxS sequence. The sequence of the AKAP2 DSG2-motif mutant used in future experiments is shown below. (C) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 (WT or DSG degron mutants) together with an empty vector control or FLAG-βTrCP2. Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 3. (D) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were treated with 100 ng/mL nocodazole for 16 h to synchronize cells in mitosis. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (E) HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2 were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3. (F) HEK293T cells were co-transfected with the indicated plasmids for 48 h. After 48 h, the cells were collected and lysed under denaturing conditions. Ubiquitinated proteins were captured using Ni-NTA pull-down. The ubiquitination status of AKAP2 was analyzed by immunoblot. Cells were treated with 20 μM MG132 and 20 μM PR619 for 4 h prior to collection. n = 2. (G) In vitro ubiquitination reactions using TAMRA-labeled AKAP2 WT peptide or AKAP2 phospho-peptide (p-S473) as a substrate, monitored by fluorescence scanning of an SDS-PAGE gel. Representative of n = 4 independent experiments.

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: GGACGAATTGGCGGTGAGGTCTC , Eton Bioscience , N/A.

Techniques: Binding Assay, Sequencing, Mutagenesis, Transfection, Expressing, Plasmid Preparation, Control, Immunoprecipitation, Western Blot, Stable Transfection, In Vitro, Labeling, Fluorescence, SDS Page

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) AKAP2 IP-MS schematic. Myc-AKAP2 was transfected into HEK293T cells in triplicate. AKAP2 was immunoprecipitated using anti-Myc affinity gel and samples were analyzed by LC-MS/MS. (B) AKAP2 interactome showing selected interactors and the biological processes they function in as identified by IP-MS. (C) HEK293T cells were transfected with Myc-AKAP2 or an empty pInducer20 vector (EV) control for 24 h. After 24 h, AKAP2 was immunoprecipitated using anti-Myc affinity gel, and the eluates were analyzed by immunoblot for the indicated proteins. n = 2. (D) Representative max projections of HCT116 FLAG-AKAP2 WT cells that were immunolabeled for DAPI, F-actin (phalloidin), microtubules (α-tubulin), and AKAP2. White arrows indicate areas of co-localization.

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: GGACGAATTGGCGGTGAGGTCTC , Eton Bioscience , N/A.

Techniques: Transfection, Immunoprecipitation, Liquid Chromatography with Mass Spectroscopy, Plasmid Preparation, Control, Western Blot, Immunolabeling

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet: (A) Representative images of a single z plane of HCT116 FLAG-AKAP2 WT and FLAG-AKAP2 DSG2 cells that were immunolabeled for DAPI, F-actin (phalloidin), microtubules (α-tubulin), and AKAP2, which are quantified in (B)–(D). (B) Quantification of F-actin via phalloidin immunostaining during metaphase. Phalloidin intensity was normalized to cell area. Statistical analysis was performed by two-tailed t test: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 43; AKAP2 DSG2 , 33. (C) Quantification of mitotic spindle length during metaphase. Statistical analysis was performed by two-tailed t test: * p % 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 37; AKAP2 DSG2 , 34. (D) Quantification of mitotic spindle orientation during metaphase. Statistical analysis was performed by two-tailed t test: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2 WT , 37; AKAP2 DSG2 , 34.

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: GGACGAATTGGCGGTGAGGTCTC , Eton Bioscience , N/A.

Techniques: Immunolabeling, Immunostaining, Two Tailed Test

Journal: Cell reports

Article Title: Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton

doi: 10.1016/j.celrep.2024.114510

Figure Lengend Snippet:

Article Snippet: AKAP2 (S479A) Mutagenesis Primer – Forward: GGACGAATTGGCGGTGAGGTCTC , Eton Bioscience , N/A.

Techniques: Virus, Recombinant, Infection, Transfection, Western Blot, Saline, Sequencing, Plasmid Preparation, Mutagenesis, Bicinchoninic Acid Protein Assay, Staining, Expressing, Luciferase, Software, Mass Spectrometry

Journal: Physiological Reports

Article Title: Mitochondrial A‐kinase anchoring proteins in cardiac ventricular myocytes

doi: 10.14814/phy2.15015

Figure Lengend Snippet: Information on antibodies used for biochemical studies

Article Snippet: D‐AKAP2 , Abnova H00011216‐M04 , , 1:100 , Eggers et al., ) .

Techniques: