Review



e coli atcc  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    ATCC e coli atcc
    E Coli Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/73182/10__3390_slash_molecules24020314-843-172-174?v=ATCC
    Average 90 stars, based on 9 article reviews
    e coli atcc - by Bioz Stars, 2026-08
    90/100 stars

    Images



    Similar Products

    90
    IEEE Access ieee access 2020, 8, 73182–73192
    Ieee Access 2020, 8, 73182–73192, supplied by IEEE Access, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/73182/pm36850612-942-0-0?v=IEEE+Access
    Average 90 stars, based on 1 article reviews
    ieee access 2020, 8, 73182–73192 - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    90
    STEMCELL Technologies Inc gsk429286a #73182
    a Immunoblotting analysis of ROCK1 and ROCK2 in lysates from control (Ctrl) siRNA or ROCK1 and ROCK2 ( ROCK1/2 ) siRNA-transfected JAK2 V617F -positive SET-2 cells. b Proliferation and cell viability of control (Ctrl) siRNA or ROCK1 and ROCK2 ( ROCK1/2 ) siRNA-transfected JAK2 V617F -positive SET-2 cells either left untreated, or treated with IFNα was measured using a WST assay. Data are expressed as percent cell viability relative to Ctrl siRNA-transfected untreated cells (Ctrl siRNA), and represent means ± SEM of five independent experiments. Each symbol on the graphs represents an independent biological replicate. c Proliferation of JAK2 V617F -positive ( left panel ) SET-2 or ( middle and right panels ) HEL cells treated with ROCK1/2 <t>inhibitor</t> <t>(GSK429286A</t> or Fasudil) and/or IFNα vs. <t>DMSO-vehicle</t> control (Ctrl) was measured using a WST assay. Each symbol on the graphs represents an independent biological replicate. Data are expressed as percent cell viability relative to Ctrl-treated cells and represent means ± SEM of four, five and three independent experiments, as indicated. d Clonogenic capability of JAK2 V617F -positive HEL cells treated with the ROCK1/2 inhibitor GSK429286A and/or IFNα vs. DMSO-vehicle control (Ctrl). Each symbol on the graphs represents an independent biological replicate. Data are expressed as percent colony formation relative to Ctrl-treated cells and represent means ± SEM of three independent experiments. e Clonogenic capability of Ctrl siRNA or ROCK1/2 siRNA-transfected peripheral blood mononuclear cells from patients with PV, either left untreated or treated with IFNα. Data are expressed as percent colony formation relative to control siRNA-transfected untreated cells (Ctrl siRNA) and represent means ± SEM of four independent experiments, using cells from four different patients with PV. f Clonogenic capability of peripheral blood mononuclear cells from patients with PV treated with the ROCK1/2 inhibitor Fasudil and/or IFNα vs. DMSO-vehicle control (Ctrl). Data are expressed as percent colony formation relative to Ctrl-treated cells and represent means ± SEM of four independent experiments, as indicated, using cells from four different patients with PV. e , f Each data point on the graphs represents an independent biological replicate and data for an individual patient is represented by the same symbol for each experimental condition. b – d Data were normalized to the control group (Ctrl siRNA or Ctrl) and statistical analyses comparing the other three groups were performed using one-way ANOVA followed by Tukey’s multiple comparisons test. Adjusted p -values are reported. e , f Data were analyzed using linear mixed effects models, with % colony formation relative to the control group as the outcome, treatment (the three remaining groups) as the fixed effect, and subject as a random effect to account for within-subject correlation between multiple conditions. Kenward-Roger degrees of freedom adjustment was used, which improves performance when sample size is small. Pairwise group comparison tests were adjusted for multiple comparisons using Tukey’s method. p -values are reported. Source data are provided as a Source Data file.
    Gsk429286a #73182, supplied by STEMCELL Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/73182/pmc08975834-320-32-38?v=STEMCELL+Technologies+Inc
    Average 90 stars, based on 1 article reviews
    gsk429286a #73182 - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    90
    ATCC e coli atcc
    a Immunoblotting analysis of ROCK1 and ROCK2 in lysates from control (Ctrl) siRNA or ROCK1 and ROCK2 ( ROCK1/2 ) siRNA-transfected JAK2 V617F -positive SET-2 cells. b Proliferation and cell viability of control (Ctrl) siRNA or ROCK1 and ROCK2 ( ROCK1/2 ) siRNA-transfected JAK2 V617F -positive SET-2 cells either left untreated, or treated with IFNα was measured using a WST assay. Data are expressed as percent cell viability relative to Ctrl siRNA-transfected untreated cells (Ctrl siRNA), and represent means ± SEM of five independent experiments. Each symbol on the graphs represents an independent biological replicate. c Proliferation of JAK2 V617F -positive ( left panel ) SET-2 or ( middle and right panels ) HEL cells treated with ROCK1/2 <t>inhibitor</t> <t>(GSK429286A</t> or Fasudil) and/or IFNα vs. <t>DMSO-vehicle</t> control (Ctrl) was measured using a WST assay. Each symbol on the graphs represents an independent biological replicate. Data are expressed as percent cell viability relative to Ctrl-treated cells and represent means ± SEM of four, five and three independent experiments, as indicated. d Clonogenic capability of JAK2 V617F -positive HEL cells treated with the ROCK1/2 inhibitor GSK429286A and/or IFNα vs. DMSO-vehicle control (Ctrl). Each symbol on the graphs represents an independent biological replicate. Data are expressed as percent colony formation relative to Ctrl-treated cells and represent means ± SEM of three independent experiments. e Clonogenic capability of Ctrl siRNA or ROCK1/2 siRNA-transfected peripheral blood mononuclear cells from patients with PV, either left untreated or treated with IFNα. Data are expressed as percent colony formation relative to control siRNA-transfected untreated cells (Ctrl siRNA) and represent means ± SEM of four independent experiments, using cells from four different patients with PV. f Clonogenic capability of peripheral blood mononuclear cells from patients with PV treated with the ROCK1/2 inhibitor Fasudil and/or IFNα vs. DMSO-vehicle control (Ctrl). Data are expressed as percent colony formation relative to Ctrl-treated cells and represent means ± SEM of four independent experiments, as indicated, using cells from four different patients with PV. e , f Each data point on the graphs represents an independent biological replicate and data for an individual patient is represented by the same symbol for each experimental condition. b – d Data were normalized to the control group (Ctrl siRNA or Ctrl) and statistical analyses comparing the other three groups were performed using one-way ANOVA followed by Tukey’s multiple comparisons test. Adjusted p -values are reported. e , f Data were analyzed using linear mixed effects models, with % colony formation relative to the control group as the outcome, treatment (the three remaining groups) as the fixed effect, and subject as a random effect to account for within-subject correlation between multiple conditions. Kenward-Roger degrees of freedom adjustment was used, which improves performance when sample size is small. Pairwise group comparison tests were adjusted for multiple comparisons using Tukey’s method. p -values are reported. Source data are provided as a Source Data file.
    E Coli Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/73182/10__3390_slash_molecules24020314-843-172-174?v=ATCC
    Average 90 stars, based on 1 article reviews
    e coli atcc - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    48s  (ATCC)
    90
    ATCC 48s
    Anti-bacterial activity of xanthone derivatives with 2-hydro-3-amino and piperazine groups.
    48s, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/73182/pmc06359477-103-0-11?v=ATCC
    Average 90 stars, based on 1 article reviews
    48s - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    90
    ATCC 128 290 44 goue 246 unknown planctomyces brasiliensis dsm 5305 conserved hypothetical protein chp00730
    Anti-bacterial activity of xanthone derivatives with 2-hydro-3-amino and piperazine groups.
    128 290 44 Goue 246 Unknown Planctomyces Brasiliensis Dsm 5305 Conserved Hypothetical Protein Chp00730, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/73182/pm23352137-102-165-198?v=ATCC
    Average 90 stars, based on 1 article reviews
    128 290 44 goue 246 unknown planctomyces brasiliensis dsm 5305 conserved hypothetical protein chp00730 - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    cel48s  (ATCC)
    90
    ATCC cel48s
    Schematic representation of the recombinant proteins used in this study. The modular notation, structure and molecular mass of each protein are indicated. Red, yellow and light blue indicate C. thermocellum -derived cohesin/dockerin, carbohydrate binding module (CBM) and enzyme-related components, respectively. Dark blue indicates A. cellulolyticus -derived cohesin/dockerin modules, and green indicates B. cellulosolvens -derived modules. ( a ) The basic chimaeric scaffoldin containing three divergent cohesins: the third cohesin of scaffoldin ScaC from A. cellulolyticus ( A ), the third cohesin of ScaB from B. cellulosolvens ( B ), the second cohesin of the CipA scaffoldin from C. thermocellum ( T ) plus a CBM3a module of the same scaffoldin ( c ). See Additional file 1: Table S1 for the molecular weights of the respective chimaeric scaffoldins. ( b ) The length of each module and its C-flanking linkers in amino acid residues. ( c ) Recombinant cellulases used in this study. In the modular notation of the enzymes, the number indicates the GH family of the catalytic domain. S, K and A indicate the original name of the enzyme <t>(Cel48S,</t> Cel9K and Cel8A, respectively). The chimaeric Cel9K includes a CBM4 and Ig domain on the N-terminal portion of the enzyme. Lowercase t, a and b indicate the source of the dockerin module ( C. thermocellum , A. cellulolyticus and B. cellulosolvens respectively).
    Cel48s, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/73182/pmc03878649-221-5-15?v=ATCC
    Average 90 stars, based on 1 article reviews
    cel48s - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    90
    ATCC ermb ram unott 21 pmtl007 cbo0365
    Bacterial strains and plasmids
    Ermb Ram Unott 21 Pmtl007 Cbo0365, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/73182/pmc03416449-56-160-196?v=ATCC
    Average 90 stars, based on 1 article reviews
    ermb ram unott 21 pmtl007 cbo0365 - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    Image Search Results


    a Immunoblotting analysis of ROCK1 and ROCK2 in lysates from control (Ctrl) siRNA or ROCK1 and ROCK2 ( ROCK1/2 ) siRNA-transfected JAK2 V617F -positive SET-2 cells. b Proliferation and cell viability of control (Ctrl) siRNA or ROCK1 and ROCK2 ( ROCK1/2 ) siRNA-transfected JAK2 V617F -positive SET-2 cells either left untreated, or treated with IFNα was measured using a WST assay. Data are expressed as percent cell viability relative to Ctrl siRNA-transfected untreated cells (Ctrl siRNA), and represent means ± SEM of five independent experiments. Each symbol on the graphs represents an independent biological replicate. c Proliferation of JAK2 V617F -positive ( left panel ) SET-2 or ( middle and right panels ) HEL cells treated with ROCK1/2 inhibitor (GSK429286A or Fasudil) and/or IFNα vs. DMSO-vehicle control (Ctrl) was measured using a WST assay. Each symbol on the graphs represents an independent biological replicate. Data are expressed as percent cell viability relative to Ctrl-treated cells and represent means ± SEM of four, five and three independent experiments, as indicated. d Clonogenic capability of JAK2 V617F -positive HEL cells treated with the ROCK1/2 inhibitor GSK429286A and/or IFNα vs. DMSO-vehicle control (Ctrl). Each symbol on the graphs represents an independent biological replicate. Data are expressed as percent colony formation relative to Ctrl-treated cells and represent means ± SEM of three independent experiments. e Clonogenic capability of Ctrl siRNA or ROCK1/2 siRNA-transfected peripheral blood mononuclear cells from patients with PV, either left untreated or treated with IFNα. Data are expressed as percent colony formation relative to control siRNA-transfected untreated cells (Ctrl siRNA) and represent means ± SEM of four independent experiments, using cells from four different patients with PV. f Clonogenic capability of peripheral blood mononuclear cells from patients with PV treated with the ROCK1/2 inhibitor Fasudil and/or IFNα vs. DMSO-vehicle control (Ctrl). Data are expressed as percent colony formation relative to Ctrl-treated cells and represent means ± SEM of four independent experiments, as indicated, using cells from four different patients with PV. e , f Each data point on the graphs represents an independent biological replicate and data for an individual patient is represented by the same symbol for each experimental condition. b – d Data were normalized to the control group (Ctrl siRNA or Ctrl) and statistical analyses comparing the other three groups were performed using one-way ANOVA followed by Tukey’s multiple comparisons test. Adjusted p -values are reported. e , f Data were analyzed using linear mixed effects models, with % colony formation relative to the control group as the outcome, treatment (the three remaining groups) as the fixed effect, and subject as a random effect to account for within-subject correlation between multiple conditions. Kenward-Roger degrees of freedom adjustment was used, which improves performance when sample size is small. Pairwise group comparison tests were adjusted for multiple comparisons using Tukey’s method. p -values are reported. Source data are provided as a Source Data file.

    Journal: Nature Communications

    Article Title: Discovery of a signaling feedback circuit that defines interferon responses in myeloproliferative neoplasms

    doi: 10.1038/s41467-022-29381-7

    Figure Lengend Snippet: a Immunoblotting analysis of ROCK1 and ROCK2 in lysates from control (Ctrl) siRNA or ROCK1 and ROCK2 ( ROCK1/2 ) siRNA-transfected JAK2 V617F -positive SET-2 cells. b Proliferation and cell viability of control (Ctrl) siRNA or ROCK1 and ROCK2 ( ROCK1/2 ) siRNA-transfected JAK2 V617F -positive SET-2 cells either left untreated, or treated with IFNα was measured using a WST assay. Data are expressed as percent cell viability relative to Ctrl siRNA-transfected untreated cells (Ctrl siRNA), and represent means ± SEM of five independent experiments. Each symbol on the graphs represents an independent biological replicate. c Proliferation of JAK2 V617F -positive ( left panel ) SET-2 or ( middle and right panels ) HEL cells treated with ROCK1/2 inhibitor (GSK429286A or Fasudil) and/or IFNα vs. DMSO-vehicle control (Ctrl) was measured using a WST assay. Each symbol on the graphs represents an independent biological replicate. Data are expressed as percent cell viability relative to Ctrl-treated cells and represent means ± SEM of four, five and three independent experiments, as indicated. d Clonogenic capability of JAK2 V617F -positive HEL cells treated with the ROCK1/2 inhibitor GSK429286A and/or IFNα vs. DMSO-vehicle control (Ctrl). Each symbol on the graphs represents an independent biological replicate. Data are expressed as percent colony formation relative to Ctrl-treated cells and represent means ± SEM of three independent experiments. e Clonogenic capability of Ctrl siRNA or ROCK1/2 siRNA-transfected peripheral blood mononuclear cells from patients with PV, either left untreated or treated with IFNα. Data are expressed as percent colony formation relative to control siRNA-transfected untreated cells (Ctrl siRNA) and represent means ± SEM of four independent experiments, using cells from four different patients with PV. f Clonogenic capability of peripheral blood mononuclear cells from patients with PV treated with the ROCK1/2 inhibitor Fasudil and/or IFNα vs. DMSO-vehicle control (Ctrl). Data are expressed as percent colony formation relative to Ctrl-treated cells and represent means ± SEM of four independent experiments, as indicated, using cells from four different patients with PV. e , f Each data point on the graphs represents an independent biological replicate and data for an individual patient is represented by the same symbol for each experimental condition. b – d Data were normalized to the control group (Ctrl siRNA or Ctrl) and statistical analyses comparing the other three groups were performed using one-way ANOVA followed by Tukey’s multiple comparisons test. Adjusted p -values are reported. e , f Data were analyzed using linear mixed effects models, with % colony formation relative to the control group as the outcome, treatment (the three remaining groups) as the fixed effect, and subject as a random effect to account for within-subject correlation between multiple conditions. Kenward-Roger degrees of freedom adjustment was used, which improves performance when sample size is small. Pairwise group comparison tests were adjusted for multiple comparisons using Tukey’s method. p -values are reported. Source data are provided as a Source Data file.

    Article Snippet: In the experiments to assess the effects of drug-targeted inhibition of ROCK1/2 on IFNα-induced anti-proliferative responses, SET-2 cells were seeded (10,000 cells/well) in quadruplicate in wells of 96-well plates and treated with vehicle-control (DMSO), GSK429286A (20 μM; #73182; StemCell Technologies), and/or human IFNα (100 IU/mL) for 5 days.

    Techniques: Western Blot, Control, Transfection, WST Assay, Comparison

    Anti-bacterial activity of xanthone derivatives with 2-hydro-3-amino and piperazine groups.

    Journal: Molecules

    Article Title: Chiral Derivatives of Xanthones with Antimicrobial Activity

    doi: 10.3390/molecules24020314

    Figure Lengend Snippet: Anti-bacterial activity of xanthone derivatives with 2-hydro-3-amino and piperazine groups.

    Article Snippet: 48S , R 1 =R 2 =R 3 =H , , ATCC 700684-28 HP 132/194-30 HP 115/168-30 , ATCC 43504-21 HP 125/180-28 HP 139/202-38 HP 143/207-36 , HP 126/181-28 HP 106/154-26.

    Techniques: Activity Assay

    Schematic representation of the recombinant proteins used in this study. The modular notation, structure and molecular mass of each protein are indicated. Red, yellow and light blue indicate C. thermocellum -derived cohesin/dockerin, carbohydrate binding module (CBM) and enzyme-related components, respectively. Dark blue indicates A. cellulolyticus -derived cohesin/dockerin modules, and green indicates B. cellulosolvens -derived modules. ( a ) The basic chimaeric scaffoldin containing three divergent cohesins: the third cohesin of scaffoldin ScaC from A. cellulolyticus ( A ), the third cohesin of ScaB from B. cellulosolvens ( B ), the second cohesin of the CipA scaffoldin from C. thermocellum ( T ) plus a CBM3a module of the same scaffoldin ( c ). See Additional file 1: Table S1 for the molecular weights of the respective chimaeric scaffoldins. ( b ) The length of each module and its C-flanking linkers in amino acid residues. ( c ) Recombinant cellulases used in this study. In the modular notation of the enzymes, the number indicates the GH family of the catalytic domain. S, K and A indicate the original name of the enzyme (Cel48S, Cel9K and Cel8A, respectively). The chimaeric Cel9K includes a CBM4 and Ig domain on the N-terminal portion of the enzyme. Lowercase t, a and b indicate the source of the dockerin module ( C. thermocellum , A. cellulolyticus and B. cellulosolvens respectively).

    Journal: Biotechnology for Biofuels

    Article Title: A synthetic biology approach for evaluating the functional contribution of designer cellulosome components to deconstruction of cellulosic substrates

    doi: 10.1186/1754-6834-6-182

    Figure Lengend Snippet: Schematic representation of the recombinant proteins used in this study. The modular notation, structure and molecular mass of each protein are indicated. Red, yellow and light blue indicate C. thermocellum -derived cohesin/dockerin, carbohydrate binding module (CBM) and enzyme-related components, respectively. Dark blue indicates A. cellulolyticus -derived cohesin/dockerin modules, and green indicates B. cellulosolvens -derived modules. ( a ) The basic chimaeric scaffoldin containing three divergent cohesins: the third cohesin of scaffoldin ScaC from A. cellulolyticus ( A ), the third cohesin of ScaB from B. cellulosolvens ( B ), the second cohesin of the CipA scaffoldin from C. thermocellum ( T ) plus a CBM3a module of the same scaffoldin ( c ). See Additional file 1: Table S1 for the molecular weights of the respective chimaeric scaffoldins. ( b ) The length of each module and its C-flanking linkers in amino acid residues. ( c ) Recombinant cellulases used in this study. In the modular notation of the enzymes, the number indicates the GH family of the catalytic domain. S, K and A indicate the original name of the enzyme (Cel48S, Cel9K and Cel8A, respectively). The chimaeric Cel9K includes a CBM4 and Ig domain on the N-terminal portion of the enzyme. Lowercase t, a and b indicate the source of the dockerin module ( C. thermocellum , A. cellulolyticus and B. cellulosolvens respectively).

    Article Snippet: The recombinant wild-type family-48 exocellulase, Cel48S (48S- t ) , was amplified from C. thermocellum ATCC 27405 genomic DNA with the following forward and reverse primers, 5′ CAGTCCATGGGTCCTACAAAGGCACCTAC 3′ and 5′ CGCGAAGCTTTTAATGGTGATGGTGATGGTGG 3′, respectively ( NcoI and HindIII restriction sites in boldface), that allow their incorporation into pET28a.

    Techniques: Recombinant, Derivative Assay, Binding Assay

    Bacterial strains and plasmids

    Journal: Applied and Environmental Microbiology

    Article Title: Involvement of Two-Component System CBO0366/CBO0365 in the Cold Shock Response and Growth of Group I (Proteolytic) Clostridium botulinum ATCC 3502 at Low Temperatures

    doi: 10.1128/AEM.00555-12

    Figure Lengend Snippet: Bacterial strains and plasmids

    Article Snippet: While constitutive expression and delicately balanced control through a phosphorelay system have been reported for most TCSs under normal growth conditions ( 18 , 19 , 24 , 30 ), induced TCS expression under cold stress conditions has been reported for B. subtilis and the psychrotrophic Y. pseudotuberculosis ( 4 , 31 ). table ft1 table-wrap mode="anchored" t5 caption a7 Strain or plasmid Relevant properties Source a (reference) Bacterial strains C. botulinum ATCC 3502 Wild type ATCC ( 34 ) C. botulinum ATCC 3502 cbo0365 ::intron- erm Insertion deletion in cbo0365 This study C. botulinum ATCC 3502 cbo0366 ::intron- erm Insertion deletion in cbo0366 This study E. coli TOP10 Electrocompetence Invitrogen, Paisley, UK E. coli CA434 Conjugation donor UNOTT ( 33 ) Plasmids pMTL82153 pBP1 g-positive replicon, catP , ColE1 g-negative replicon, tra , fdx promoter UNOTT ( 22 ) pMTL82153- cbo0366 pMTL82153 with cbo0366 under transcriptional control of fdx promoter This study pMTL007 ClosTron plasmid, catP , intron with ermB RAM UNOTT ( 21 ) pMTL007- cbo0365- 48s Derived from pMTL007 by retargeting to cbo0365 This study pMTL007- cbo0366- 267s Derived from pMTL007 by retargeting to cbo0366 This study Open in a separate window a ATCC, American Type Culture Collection; UNOTT, University of Nottingham, United Kingdom.

    Techniques: Plasmid Preparation, Conjugation Assay, Control, Derivative Assay

    Oligonucleotide primers

    Journal: Applied and Environmental Microbiology

    Article Title: Involvement of Two-Component System CBO0366/CBO0365 in the Cold Shock Response and Growth of Group I (Proteolytic) Clostridium botulinum ATCC 3502 at Low Temperatures

    doi: 10.1128/AEM.00555-12

    Figure Lengend Snippet: Oligonucleotide primers

    Article Snippet: While constitutive expression and delicately balanced control through a phosphorelay system have been reported for most TCSs under normal growth conditions ( 18 , 19 , 24 , 30 ), induced TCS expression under cold stress conditions has been reported for B. subtilis and the psychrotrophic Y. pseudotuberculosis ( 4 , 31 ). table ft1 table-wrap mode="anchored" t5 caption a7 Strain or plasmid Relevant properties Source a (reference) Bacterial strains C. botulinum ATCC 3502 Wild type ATCC ( 34 ) C. botulinum ATCC 3502 cbo0365 ::intron- erm Insertion deletion in cbo0365 This study C. botulinum ATCC 3502 cbo0366 ::intron- erm Insertion deletion in cbo0366 This study E. coli TOP10 Electrocompetence Invitrogen, Paisley, UK E. coli CA434 Conjugation donor UNOTT ( 33 ) Plasmids pMTL82153 pBP1 g-positive replicon, catP , ColE1 g-negative replicon, tra , fdx promoter UNOTT ( 22 ) pMTL82153- cbo0366 pMTL82153 with cbo0366 under transcriptional control of fdx promoter This study pMTL007 ClosTron plasmid, catP , intron with ermB RAM UNOTT ( 21 ) pMTL007- cbo0365- 48s Derived from pMTL007 by retargeting to cbo0365 This study pMTL007- cbo0366- 267s Derived from pMTL007 by retargeting to cbo0366 This study Open in a separate window a ATCC, American Type Culture Collection; UNOTT, University of Nottingham, United Kingdom.

    Techniques: Sequencing, Binding Assay, Over Expression, Plasmid Preparation, Control, Mutagenesis

    Relative expression levels of cbo0365 and cbo0366 in ATCC 3502 induced at 15°C. (A) ATCC 3502 was grown at 37°C, exposed to a temperature downshift (cold shock [gray curve]) at 15°C at an optical density at 600 nm (OD600) of 1.5, and sampled for qRT-PCR analysis before cold shock (T0) and 1 min, 30 min, 2 h, and 5 h after cold shock. A non-cold-shocked culture (black curve) served as a control. (B) Relative expression levels of cbo0365 (light gray) and cbo0366 (dark gray) in non-cold-shocked cultures calibrated at T0. (C) Relative expression levels of cbo0365 (light gray) and cbo0366 (dark gray) in cold-shocked cultures calibrated at T0. (D) Relative expression levels of cbo0365 (light gray) and cbo0366 (dark gray) in cold-shocked cultures calibrated to non-cold-shocked cultures at the corresponding time points. The normalization reference was 16S rrn. *, P < 0.05 (one-way analysis of variance). Error bars indicate standard deviations of three replicates.

    Journal: Applied and Environmental Microbiology

    Article Title: Involvement of Two-Component System CBO0366/CBO0365 in the Cold Shock Response and Growth of Group I (Proteolytic) Clostridium botulinum ATCC 3502 at Low Temperatures

    doi: 10.1128/AEM.00555-12

    Figure Lengend Snippet: Relative expression levels of cbo0365 and cbo0366 in ATCC 3502 induced at 15°C. (A) ATCC 3502 was grown at 37°C, exposed to a temperature downshift (cold shock [gray curve]) at 15°C at an optical density at 600 nm (OD600) of 1.5, and sampled for qRT-PCR analysis before cold shock (T0) and 1 min, 30 min, 2 h, and 5 h after cold shock. A non-cold-shocked culture (black curve) served as a control. (B) Relative expression levels of cbo0365 (light gray) and cbo0366 (dark gray) in non-cold-shocked cultures calibrated at T0. (C) Relative expression levels of cbo0365 (light gray) and cbo0366 (dark gray) in cold-shocked cultures calibrated at T0. (D) Relative expression levels of cbo0365 (light gray) and cbo0366 (dark gray) in cold-shocked cultures calibrated to non-cold-shocked cultures at the corresponding time points. The normalization reference was 16S rrn. *, P < 0.05 (one-way analysis of variance). Error bars indicate standard deviations of three replicates.

    Article Snippet: While constitutive expression and delicately balanced control through a phosphorelay system have been reported for most TCSs under normal growth conditions ( 18 , 19 , 24 , 30 ), induced TCS expression under cold stress conditions has been reported for B. subtilis and the psychrotrophic Y. pseudotuberculosis ( 4 , 31 ). table ft1 table-wrap mode="anchored" t5 caption a7 Strain or plasmid Relevant properties Source a (reference) Bacterial strains C. botulinum ATCC 3502 Wild type ATCC ( 34 ) C. botulinum ATCC 3502 cbo0365 ::intron- erm Insertion deletion in cbo0365 This study C. botulinum ATCC 3502 cbo0366 ::intron- erm Insertion deletion in cbo0366 This study E. coli TOP10 Electrocompetence Invitrogen, Paisley, UK E. coli CA434 Conjugation donor UNOTT ( 33 ) Plasmids pMTL82153 pBP1 g-positive replicon, catP , ColE1 g-negative replicon, tra , fdx promoter UNOTT ( 22 ) pMTL82153- cbo0366 pMTL82153 with cbo0366 under transcriptional control of fdx promoter This study pMTL007 ClosTron plasmid, catP , intron with ermB RAM UNOTT ( 21 ) pMTL007- cbo0365- 48s Derived from pMTL007 by retargeting to cbo0365 This study pMTL007- cbo0366- 267s Derived from pMTL007 by retargeting to cbo0366 This study Open in a separate window a ATCC, American Type Culture Collection; UNOTT, University of Nottingham, United Kingdom.

    Techniques: Expressing, Quantitative RT-PCR, Control

    Growth of cbo0365 and cbo0366 mutants under cold temperatures is impaired compared to ATCC 3502. ATCC 3502 wild type (black diamonds) and cbo0365 (open squares) and cbo0366 (multiplication symbols) mutants were grown in tryptose-peptone-glucose-yeast extract (TPGY) medium at 15°C, 20°C, and 37°C. Results for a negative-control sample (fresh TPGY) are marked with a dashed line. Error bars indicate standard deviations of three replicates.

    Journal: Applied and Environmental Microbiology

    Article Title: Involvement of Two-Component System CBO0366/CBO0365 in the Cold Shock Response and Growth of Group I (Proteolytic) Clostridium botulinum ATCC 3502 at Low Temperatures

    doi: 10.1128/AEM.00555-12

    Figure Lengend Snippet: Growth of cbo0365 and cbo0366 mutants under cold temperatures is impaired compared to ATCC 3502. ATCC 3502 wild type (black diamonds) and cbo0365 (open squares) and cbo0366 (multiplication symbols) mutants were grown in tryptose-peptone-glucose-yeast extract (TPGY) medium at 15°C, 20°C, and 37°C. Results for a negative-control sample (fresh TPGY) are marked with a dashed line. Error bars indicate standard deviations of three replicates.

    Article Snippet: While constitutive expression and delicately balanced control through a phosphorelay system have been reported for most TCSs under normal growth conditions ( 18 , 19 , 24 , 30 ), induced TCS expression under cold stress conditions has been reported for B. subtilis and the psychrotrophic Y. pseudotuberculosis ( 4 , 31 ). table ft1 table-wrap mode="anchored" t5 caption a7 Strain or plasmid Relevant properties Source a (reference) Bacterial strains C. botulinum ATCC 3502 Wild type ATCC ( 34 ) C. botulinum ATCC 3502 cbo0365 ::intron- erm Insertion deletion in cbo0365 This study C. botulinum ATCC 3502 cbo0366 ::intron- erm Insertion deletion in cbo0366 This study E. coli TOP10 Electrocompetence Invitrogen, Paisley, UK E. coli CA434 Conjugation donor UNOTT ( 33 ) Plasmids pMTL82153 pBP1 g-positive replicon, catP , ColE1 g-negative replicon, tra , fdx promoter UNOTT ( 22 ) pMTL82153- cbo0366 pMTL82153 with cbo0366 under transcriptional control of fdx promoter This study pMTL007 ClosTron plasmid, catP , intron with ermB RAM UNOTT ( 21 ) pMTL007- cbo0365- 48s Derived from pMTL007 by retargeting to cbo0365 This study pMTL007- cbo0366- 267s Derived from pMTL007 by retargeting to cbo0366 This study Open in a separate window a ATCC, American Type Culture Collection; UNOTT, University of Nottingham, United Kingdom.

    Techniques: Negative Control