Review



ambenonium dichloride  (Tocris)


Bioz Verified Symbol Tocris is a verified supplier
Bioz Manufacturer Symbol Tocris manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88

    Structured Review

    Tocris ambenonium dichloride
    Ambenonium Dichloride, supplied by Tocris, used in various techniques. Bioz Stars score: 88/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/0388/Ambenonium+dichloride/pm41271088-94-0-8
    Average 88 stars, based on 17 article reviews
    ambenonium dichloride - by Bioz Stars, 2026-09
    88/100 stars

    Images

    Related Articles

    other:

    Article Title: Long-Lasting Inhibitory Effects of Distigmine on Recombinant Human Acetylcholinesterase Activity.
    Article Snippet: Drugs and Reagents The following drugs were used: distigmine bromide (Torii Pharmaceutical Co., Ltd., Tokyo, Japan), neostigmine bromide (Sigma-Aldrich), pyridostigmine bromide (MP Biomedicals, Santa Ana, CA, U.S.A.), and ambenonium dichloride (Tocris Bioscience, Bristol, U.K.).

    Article Title: WaterMap-Guided Structure-Based Virtual Screening for Acetylcholinesterase Inhibitors.
    Article Snippet: Structure-based virtual screening of the Enamine database of 1.7 million compounds followed by WaterMap calculations (a molecular-dynamics-simulation-based method) was applied to identify novel acetylcholinesterase (AChE) inhibitors.. The inhibitory potency of 29 selected compounds against electric eel (ee) AChE was determined using Ellman’s method.. Three compounds were found to be active (success rate 10%).

    Article Title: M4-mediated cholinergic transmission is reduced in parkinsonian mice and its restoration alleviates motor deficits and levodopa-induced dyskinesia
    Article Snippet: Picrotoxin (1128), (+)-MK-801 maleate (0924), DNQX (0189), DHβE hydrobromide (2349), SCH 23390 hydrochloride (0925), (S)-(-)-sulpiride (0895), acetylcholine chloride (2809), oxotremorine M (1067), VU 0255035 (3727), tropicamide (0909), ambenonium dichloride (0388), and scopolamine hydrobromide (1414) were obtained from Tocris Bioscience.

    Article Title: Reduced striatal M4-cholinergic signaling following dopamine loss contributes to parkinsonian and l -DOPA–induced dyskinetic behaviors
    Article Snippet: Picrotoxin (1128), (+)-MK-801 maleate (0924), DNQX (0189), DHβE hydrobromide (2349), SCH 23390 hydrochloride (0925), (S)-(−)-sulpiride (0895), Ach chloride (2809), oxotremorine-M (1067), VU 0255035 (3727), tropicamide (0909), ambenonium dichloride (0388), and scopolamine hydrobromide (1414) were obtained from Tocris Bioscience.

    Article Title: Postsynaptic adaptations in direct pathway muscarinic M4-receptor signaling follow the temporal and regional pattern of dopaminergic degeneration
    Article Snippet: Picrotoxin, MK-801, DNQX, DHβE, SCH 23390, sulpiride, acetylcholine, oxotremorine M, and ambenonium were purchased from Tocris Bioscience.

    Article Title: Postsynaptic adaptations in direct pathway muscarinic M4-receptor signaling follow the temporal and regional pattern of dopaminergic degeneration
    Article Snippet: Picrotoxin, MK-801, DNQX, DHβE, SCH 23390, sulpiride, acetylcholine, oxotremorine M, and ambenonium were purchased from Tocris Bioscience.

    Magnetic Beads:

    Article Title: Cholinergic Interneurons Amplify Thalamostriatal Excitation of Striatal Indirect Pathway Neurons in Parkinson's Disease Models.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti tyrosine hydroxylase Sigma-Aldrich Cat#T2928; RRID: AB_477569 Anti-Mouse IgG secondary antibody Alexa 488 Molecular Probes Cat#A-21202; RRID: AB_141607 Dynal ProteinG magnetic beads Invitrogen Cat#10003D Bacterial and Virus Strains AAV9-floxed-Cre off-hEF1a-ChR2(H134R)-EYFP Virovek, Inc. N/A AAV9-CMV-Synaptophysin-GFP Virovek, Inc Addgene:26084 AAV8-Synapsin-Chronos-tdTomato UPenn vector core Addgene:62726 AAV8-EF1a-DIO-hM4D(Gi)-mCherry Virovek, Inc Addgene:50461 AAV9-EF1a-DIO-hChR2(H134R)-EYFP UPenn vector core Addgene:20298 AAV9-U6-537-chrna6-shRNA-CMV-tdTomato Virovek, Inc. N/A AAV9-U6-scrambe-shRNA-CMV-tdTomato Virovek, Inc. N/A AAV9-EF1a-DIO-Rpl22l1-Myc-DDK-2A-tdTomato Virovek, Inc N/A AAV1-CAG-ChR2-Venus UPenn vector core Addgene:20071 Chemicals, Peptides, and Recombinant Proteins SR 95531 hydrobromide supplier TOCRIS Cat#1262; CAS:104104-50-9 CGP55845 hydrochloride TOCRIS Cat#1248; CAS:149184-22-5 D-AP5 Hellobio HB0225; CAS:79055-68-8 QX314 chloride TOCRIS Cat#2313; CAS:5369-03-9 a-bungarotoxin TOCRIS Cat#2133; CAS:11032-79-4 a-conotoxin MII TOCRIS Cat#1340; CAS:175735-93-0 a-conotoxin PIA TOCRIS Cat#3121; CAS:669050-68-4 TMPH hydrochloride TOCRIS Cat#2438; CAS:849461-91-2 Methyllycaconitine citrate TOCRIS Cat#1029; CAS:112825-05-5 Dihydro-b-erythroidine hydrobromide TOCRIS Cat#2349; CAS:29734-68-7 Tetrodotoxin citrate Alomone labs Cat#T-550; CAS:18660-81-6 NBQX disodium salt TOCRIS Cat#1044; CAS:479347-86-9 4-aminopyridine TOCRIS Cat#0940; CAS:504-24-5 (-)-Quinpirole hydrochloride TOCIRS Cat#1061; CAS:85798-08-9 6-Hydroxydopamine hydrochloride Sigma-Aldrich H4381; CAS:28094-15-7 Clozapine N-oxide dihydrochloride Hellobio HB6149 Ambenonium dichloride TOCRIS Cat0388; CAS:115-79-7 (-)-Nicotine ditartrate TOCRIS Cat#3546; CAS:65-31-6 Atropine Sigma-Aldrich A0132; CAS:51-55-8 Mecamylamine hydrochloride TOCRIS Cat#2843; CAS:826-39-1 Critical Commercial Assays RNAeasy mini kit QIAGEN Cat#74104 SuperScript VILO cDNA Synthesis kit Invitrogen Cat#11754-010 TaqmanTM Universal PCR Master Mix Applied Biosystems Cat#4304437 RNAeasy plus micro kit QIAGEN Cat#74034 Experimental Models: Organisms/Strains Mouse: Tg(Grp-cre)KH288Gsat/Mmucd MMRRC RRID: MMRRC_031183_UCD Mouse: B6.Cg-Tg(Drd1a-tdTomato)6Calak/J The Jackson Laboratory RRID: IMSR_JAX:016204 Mouse: B6;FVB-Tg(Drd2-EGFP/Rpl10a)CP101Htz/J The Jackson Laboratory RRID: IMSR_JAX:030255 (Continued on next page) e1 Neuron 101, 1–15.e1–e6, February 6, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: B6;129S60-Chattm2(cre)lowl/J The Jackson Laboratory RRID: IMSR_JAX:006410 Mouse: Tg(Rbp4-cre)KL100Gsat/Mmucd MMRRC RRID: MMRRC_031125_UCD Mouse: WT:C57BL/6J The Jackson Laboratory RRID: IMSR_JAX:000664 Oligonucleotides siRNA targeting sequence: ChRNA6: CCAACGGAGTATGGCATCGAGA This paper NM021369.2 Probe for ChRNA6 Invitrogen Gene Expresion Assay ID:Mm00517533_m1 Probe for ChRNA4 Invitrogen Gene Expression Assay ID:Mm00516561_m1 Probe for ChRNB2 Invitrogen Gene Expression Assay ID:Mm00515323_m1 Probe for Gapdh Invitrogen Gene Expression Assay ID:Mm01318746_g1 Probe for hprt Invitrogen Gene Expression Assay ID:Mm99999915_g1 Recombinant DNA Mouse ribosomal protein L22 like 1 (Rpl22l1) cDNA Orogene Cat#MR200606 NM_002754 Software and Algorithms MATLAB 2017a MathWorks https://www.mathworks.com/products/matlab.html? s_tid=mlc_fx_ff_p_matlab; RRID: SCR_001622 ImageJ NIH https://imagej.nih.gov/ij/download.html; RRID: SCR_003070 Adobe IllustratorCC2017 Adobe https://www.adobe.com/; RRID: SCR_014198 Python NeuralEnsemble https://www.python.org/downloads/; RRID: SCR_000634 LimLight for open field test ACTIMETRICS http://www.actimetrics.com/products/limelight/; RRID: SCR_014254 Igor Pro 5.0 WaveMetrics https://www.wavemetrics.com/downloads/current; RRID: SCR_000325 Clampfit 10.3 Molecular Devices, Inc. https://www.moleculardevices.com/; RRID: SCR_011323 Imaris Bitplane http://www.bitplane.com/download; RRID: SCR_007370 Other Rotarod TSE systems https://www.tse-systems.com/product-details/rotarod DigiGait Mouse Specifics,Inc. https://mousespecifics.com/

    Virus:

    Article Title: Cholinergic Interneurons Amplify Thalamostriatal Excitation of Striatal Indirect Pathway Neurons in Parkinson's Disease Models.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti tyrosine hydroxylase Sigma-Aldrich Cat#T2928; RRID: AB_477569 Anti-Mouse IgG secondary antibody Alexa 488 Molecular Probes Cat#A-21202; RRID: AB_141607 Dynal ProteinG magnetic beads Invitrogen Cat#10003D Bacterial and Virus Strains AAV9-floxed-Cre off-hEF1a-ChR2(H134R)-EYFP Virovek, Inc. N/A AAV9-CMV-Synaptophysin-GFP Virovek, Inc Addgene:26084 AAV8-Synapsin-Chronos-tdTomato UPenn vector core Addgene:62726 AAV8-EF1a-DIO-hM4D(Gi)-mCherry Virovek, Inc Addgene:50461 AAV9-EF1a-DIO-hChR2(H134R)-EYFP UPenn vector core Addgene:20298 AAV9-U6-537-chrna6-shRNA-CMV-tdTomato Virovek, Inc. N/A AAV9-U6-scrambe-shRNA-CMV-tdTomato Virovek, Inc. N/A AAV9-EF1a-DIO-Rpl22l1-Myc-DDK-2A-tdTomato Virovek, Inc N/A AAV1-CAG-ChR2-Venus UPenn vector core Addgene:20071 Chemicals, Peptides, and Recombinant Proteins SR 95531 hydrobromide supplier TOCRIS Cat#1262; CAS:104104-50-9 CGP55845 hydrochloride TOCRIS Cat#1248; CAS:149184-22-5 D-AP5 Hellobio HB0225; CAS:79055-68-8 QX314 chloride TOCRIS Cat#2313; CAS:5369-03-9 a-bungarotoxin TOCRIS Cat#2133; CAS:11032-79-4 a-conotoxin MII TOCRIS Cat#1340; CAS:175735-93-0 a-conotoxin PIA TOCRIS Cat#3121; CAS:669050-68-4 TMPH hydrochloride TOCRIS Cat#2438; CAS:849461-91-2 Methyllycaconitine citrate TOCRIS Cat#1029; CAS:112825-05-5 Dihydro-b-erythroidine hydrobromide TOCRIS Cat#2349; CAS:29734-68-7 Tetrodotoxin citrate Alomone labs Cat#T-550; CAS:18660-81-6 NBQX disodium salt TOCRIS Cat#1044; CAS:479347-86-9 4-aminopyridine TOCRIS Cat#0940; CAS:504-24-5 (-)-Quinpirole hydrochloride TOCIRS Cat#1061; CAS:85798-08-9 6-Hydroxydopamine hydrochloride Sigma-Aldrich H4381; CAS:28094-15-7 Clozapine N-oxide dihydrochloride Hellobio HB6149 Ambenonium dichloride TOCRIS Cat0388; CAS:115-79-7 (-)-Nicotine ditartrate TOCRIS Cat#3546; CAS:65-31-6 Atropine Sigma-Aldrich A0132; CAS:51-55-8 Mecamylamine hydrochloride TOCRIS Cat#2843; CAS:826-39-1 Critical Commercial Assays RNAeasy mini kit QIAGEN Cat#74104 SuperScript VILO cDNA Synthesis kit Invitrogen Cat#11754-010 TaqmanTM Universal PCR Master Mix Applied Biosystems Cat#4304437 RNAeasy plus micro kit QIAGEN Cat#74034 Experimental Models: Organisms/Strains Mouse: Tg(Grp-cre)KH288Gsat/Mmucd MMRRC RRID: MMRRC_031183_UCD Mouse: B6.Cg-Tg(Drd1a-tdTomato)6Calak/J The Jackson Laboratory RRID: IMSR_JAX:016204 Mouse: B6;FVB-Tg(Drd2-EGFP/Rpl10a)CP101Htz/J The Jackson Laboratory RRID: IMSR_JAX:030255 (Continued on next page) e1 Neuron 101, 1–15.e1–e6, February 6, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: B6;129S60-Chattm2(cre)lowl/J The Jackson Laboratory RRID: IMSR_JAX:006410 Mouse: Tg(Rbp4-cre)KL100Gsat/Mmucd MMRRC RRID: MMRRC_031125_UCD Mouse: WT:C57BL/6J The Jackson Laboratory RRID: IMSR_JAX:000664 Oligonucleotides siRNA targeting sequence: ChRNA6: CCAACGGAGTATGGCATCGAGA This paper NM021369.2 Probe for ChRNA6 Invitrogen Gene Expresion Assay ID:Mm00517533_m1 Probe for ChRNA4 Invitrogen Gene Expression Assay ID:Mm00516561_m1 Probe for ChRNB2 Invitrogen Gene Expression Assay ID:Mm00515323_m1 Probe for Gapdh Invitrogen Gene Expression Assay ID:Mm01318746_g1 Probe for hprt Invitrogen Gene Expression Assay ID:Mm99999915_g1 Recombinant DNA Mouse ribosomal protein L22 like 1 (Rpl22l1) cDNA Orogene Cat#MR200606 NM_002754 Software and Algorithms MATLAB 2017a MathWorks https://www.mathworks.com/products/matlab.html? s_tid=mlc_fx_ff_p_matlab; RRID: SCR_001622 ImageJ NIH https://imagej.nih.gov/ij/download.html; RRID: SCR_003070 Adobe IllustratorCC2017 Adobe https://www.adobe.com/; RRID: SCR_014198 Python NeuralEnsemble https://www.python.org/downloads/; RRID: SCR_000634 LimLight for open field test ACTIMETRICS http://www.actimetrics.com/products/limelight/; RRID: SCR_014254 Igor Pro 5.0 WaveMetrics https://www.wavemetrics.com/downloads/current; RRID: SCR_000325 Clampfit 10.3 Molecular Devices, Inc. https://www.moleculardevices.com/; RRID: SCR_011323 Imaris Bitplane http://www.bitplane.com/download; RRID: SCR_007370 Other Rotarod TSE systems https://www.tse-systems.com/product-details/rotarod DigiGait Mouse Specifics,Inc. https://mousespecifics.com/

    Recombinant:

    Article Title: Cholinergic Interneurons Amplify Thalamostriatal Excitation of Striatal Indirect Pathway Neurons in Parkinson's Disease Models.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti tyrosine hydroxylase Sigma-Aldrich Cat#T2928; RRID: AB_477569 Anti-Mouse IgG secondary antibody Alexa 488 Molecular Probes Cat#A-21202; RRID: AB_141607 Dynal ProteinG magnetic beads Invitrogen Cat#10003D Bacterial and Virus Strains AAV9-floxed-Cre off-hEF1a-ChR2(H134R)-EYFP Virovek, Inc. N/A AAV9-CMV-Synaptophysin-GFP Virovek, Inc Addgene:26084 AAV8-Synapsin-Chronos-tdTomato UPenn vector core Addgene:62726 AAV8-EF1a-DIO-hM4D(Gi)-mCherry Virovek, Inc Addgene:50461 AAV9-EF1a-DIO-hChR2(H134R)-EYFP UPenn vector core Addgene:20298 AAV9-U6-537-chrna6-shRNA-CMV-tdTomato Virovek, Inc. N/A AAV9-U6-scrambe-shRNA-CMV-tdTomato Virovek, Inc. N/A AAV9-EF1a-DIO-Rpl22l1-Myc-DDK-2A-tdTomato Virovek, Inc N/A AAV1-CAG-ChR2-Venus UPenn vector core Addgene:20071 Chemicals, Peptides, and Recombinant Proteins SR 95531 hydrobromide supplier TOCRIS Cat#1262; CAS:104104-50-9 CGP55845 hydrochloride TOCRIS Cat#1248; CAS:149184-22-5 D-AP5 Hellobio HB0225; CAS:79055-68-8 QX314 chloride TOCRIS Cat#2313; CAS:5369-03-9 a-bungarotoxin TOCRIS Cat#2133; CAS:11032-79-4 a-conotoxin MII TOCRIS Cat#1340; CAS:175735-93-0 a-conotoxin PIA TOCRIS Cat#3121; CAS:669050-68-4 TMPH hydrochloride TOCRIS Cat#2438; CAS:849461-91-2 Methyllycaconitine citrate TOCRIS Cat#1029; CAS:112825-05-5 Dihydro-b-erythroidine hydrobromide TOCRIS Cat#2349; CAS:29734-68-7 Tetrodotoxin citrate Alomone labs Cat#T-550; CAS:18660-81-6 NBQX disodium salt TOCRIS Cat#1044; CAS:479347-86-9 4-aminopyridine TOCRIS Cat#0940; CAS:504-24-5 (-)-Quinpirole hydrochloride TOCIRS Cat#1061; CAS:85798-08-9 6-Hydroxydopamine hydrochloride Sigma-Aldrich H4381; CAS:28094-15-7 Clozapine N-oxide dihydrochloride Hellobio HB6149 Ambenonium dichloride TOCRIS Cat0388; CAS:115-79-7 (-)-Nicotine ditartrate TOCRIS Cat#3546; CAS:65-31-6 Atropine Sigma-Aldrich A0132; CAS:51-55-8 Mecamylamine hydrochloride TOCRIS Cat#2843; CAS:826-39-1 Critical Commercial Assays RNAeasy mini kit QIAGEN Cat#74104 SuperScript VILO cDNA Synthesis kit Invitrogen Cat#11754-010 TaqmanTM Universal PCR Master Mix Applied Biosystems Cat#4304437 RNAeasy plus micro kit QIAGEN Cat#74034 Experimental Models: Organisms/Strains Mouse: Tg(Grp-cre)KH288Gsat/Mmucd MMRRC RRID: MMRRC_031183_UCD Mouse: B6.Cg-Tg(Drd1a-tdTomato)6Calak/J The Jackson Laboratory RRID: IMSR_JAX:016204 Mouse: B6;FVB-Tg(Drd2-EGFP/Rpl10a)CP101Htz/J The Jackson Laboratory RRID: IMSR_JAX:030255 (Continued on next page) e1 Neuron 101, 1–15.e1–e6, February 6, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: B6;129S60-Chattm2(cre)lowl/J The Jackson Laboratory RRID: IMSR_JAX:006410 Mouse: Tg(Rbp4-cre)KL100Gsat/Mmucd MMRRC RRID: MMRRC_031125_UCD Mouse: WT:C57BL/6J The Jackson Laboratory RRID: IMSR_JAX:000664 Oligonucleotides siRNA targeting sequence: ChRNA6: CCAACGGAGTATGGCATCGAGA This paper NM021369.2 Probe for ChRNA6 Invitrogen Gene Expresion Assay ID:Mm00517533_m1 Probe for ChRNA4 Invitrogen Gene Expression Assay ID:Mm00516561_m1 Probe for ChRNB2 Invitrogen Gene Expression Assay ID:Mm00515323_m1 Probe for Gapdh Invitrogen Gene Expression Assay ID:Mm01318746_g1 Probe for hprt Invitrogen Gene Expression Assay ID:Mm99999915_g1 Recombinant DNA Mouse ribosomal protein L22 like 1 (Rpl22l1) cDNA Orogene Cat#MR200606 NM_002754 Software and Algorithms MATLAB 2017a MathWorks https://www.mathworks.com/products/matlab.html? s_tid=mlc_fx_ff_p_matlab; RRID: SCR_001622 ImageJ NIH https://imagej.nih.gov/ij/download.html; RRID: SCR_003070 Adobe IllustratorCC2017 Adobe https://www.adobe.com/; RRID: SCR_014198 Python NeuralEnsemble https://www.python.org/downloads/; RRID: SCR_000634 LimLight for open field test ACTIMETRICS http://www.actimetrics.com/products/limelight/; RRID: SCR_014254 Igor Pro 5.0 WaveMetrics https://www.wavemetrics.com/downloads/current; RRID: SCR_000325 Clampfit 10.3 Molecular Devices, Inc. https://www.moleculardevices.com/; RRID: SCR_011323 Imaris Bitplane http://www.bitplane.com/download; RRID: SCR_007370 Other Rotarod TSE systems https://www.tse-systems.com/product-details/rotarod DigiGait Mouse Specifics,Inc. https://mousespecifics.com/

    cDNA Synthesis:

    Article Title: Cholinergic Interneurons Amplify Thalamostriatal Excitation of Striatal Indirect Pathway Neurons in Parkinson's Disease Models.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti tyrosine hydroxylase Sigma-Aldrich Cat#T2928; RRID: AB_477569 Anti-Mouse IgG secondary antibody Alexa 488 Molecular Probes Cat#A-21202; RRID: AB_141607 Dynal ProteinG magnetic beads Invitrogen Cat#10003D Bacterial and Virus Strains AAV9-floxed-Cre off-hEF1a-ChR2(H134R)-EYFP Virovek, Inc. N/A AAV9-CMV-Synaptophysin-GFP Virovek, Inc Addgene:26084 AAV8-Synapsin-Chronos-tdTomato UPenn vector core Addgene:62726 AAV8-EF1a-DIO-hM4D(Gi)-mCherry Virovek, Inc Addgene:50461 AAV9-EF1a-DIO-hChR2(H134R)-EYFP UPenn vector core Addgene:20298 AAV9-U6-537-chrna6-shRNA-CMV-tdTomato Virovek, Inc. N/A AAV9-U6-scrambe-shRNA-CMV-tdTomato Virovek, Inc. N/A AAV9-EF1a-DIO-Rpl22l1-Myc-DDK-2A-tdTomato Virovek, Inc N/A AAV1-CAG-ChR2-Venus UPenn vector core Addgene:20071 Chemicals, Peptides, and Recombinant Proteins SR 95531 hydrobromide supplier TOCRIS Cat#1262; CAS:104104-50-9 CGP55845 hydrochloride TOCRIS Cat#1248; CAS:149184-22-5 D-AP5 Hellobio HB0225; CAS:79055-68-8 QX314 chloride TOCRIS Cat#2313; CAS:5369-03-9 a-bungarotoxin TOCRIS Cat#2133; CAS:11032-79-4 a-conotoxin MII TOCRIS Cat#1340; CAS:175735-93-0 a-conotoxin PIA TOCRIS Cat#3121; CAS:669050-68-4 TMPH hydrochloride TOCRIS Cat#2438; CAS:849461-91-2 Methyllycaconitine citrate TOCRIS Cat#1029; CAS:112825-05-5 Dihydro-b-erythroidine hydrobromide TOCRIS Cat#2349; CAS:29734-68-7 Tetrodotoxin citrate Alomone labs Cat#T-550; CAS:18660-81-6 NBQX disodium salt TOCRIS Cat#1044; CAS:479347-86-9 4-aminopyridine TOCRIS Cat#0940; CAS:504-24-5 (-)-Quinpirole hydrochloride TOCIRS Cat#1061; CAS:85798-08-9 6-Hydroxydopamine hydrochloride Sigma-Aldrich H4381; CAS:28094-15-7 Clozapine N-oxide dihydrochloride Hellobio HB6149 Ambenonium dichloride TOCRIS Cat0388; CAS:115-79-7 (-)-Nicotine ditartrate TOCRIS Cat#3546; CAS:65-31-6 Atropine Sigma-Aldrich A0132; CAS:51-55-8 Mecamylamine hydrochloride TOCRIS Cat#2843; CAS:826-39-1 Critical Commercial Assays RNAeasy mini kit QIAGEN Cat#74104 SuperScript VILO cDNA Synthesis kit Invitrogen Cat#11754-010 TaqmanTM Universal PCR Master Mix Applied Biosystems Cat#4304437 RNAeasy plus micro kit QIAGEN Cat#74034 Experimental Models: Organisms/Strains Mouse: Tg(Grp-cre)KH288Gsat/Mmucd MMRRC RRID: MMRRC_031183_UCD Mouse: B6.Cg-Tg(Drd1a-tdTomato)6Calak/J The Jackson Laboratory RRID: IMSR_JAX:016204 Mouse: B6;FVB-Tg(Drd2-EGFP/Rpl10a)CP101Htz/J The Jackson Laboratory RRID: IMSR_JAX:030255 (Continued on next page) e1 Neuron 101, 1–15.e1–e6, February 6, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: B6;129S60-Chattm2(cre)lowl/J The Jackson Laboratory RRID: IMSR_JAX:006410 Mouse: Tg(Rbp4-cre)KL100Gsat/Mmucd MMRRC RRID: MMRRC_031125_UCD Mouse: WT:C57BL/6J The Jackson Laboratory RRID: IMSR_JAX:000664 Oligonucleotides siRNA targeting sequence: ChRNA6: CCAACGGAGTATGGCATCGAGA This paper NM021369.2 Probe for ChRNA6 Invitrogen Gene Expresion Assay ID:Mm00517533_m1 Probe for ChRNA4 Invitrogen Gene Expression Assay ID:Mm00516561_m1 Probe for ChRNB2 Invitrogen Gene Expression Assay ID:Mm00515323_m1 Probe for Gapdh Invitrogen Gene Expression Assay ID:Mm01318746_g1 Probe for hprt Invitrogen Gene Expression Assay ID:Mm99999915_g1 Recombinant DNA Mouse ribosomal protein L22 like 1 (Rpl22l1) cDNA Orogene Cat#MR200606 NM_002754 Software and Algorithms MATLAB 2017a MathWorks https://www.mathworks.com/products/matlab.html? s_tid=mlc_fx_ff_p_matlab; RRID: SCR_001622 ImageJ NIH https://imagej.nih.gov/ij/download.html; RRID: SCR_003070 Adobe IllustratorCC2017 Adobe https://www.adobe.com/; RRID: SCR_014198 Python NeuralEnsemble https://www.python.org/downloads/; RRID: SCR_000634 LimLight for open field test ACTIMETRICS http://www.actimetrics.com/products/limelight/; RRID: SCR_014254 Igor Pro 5.0 WaveMetrics https://www.wavemetrics.com/downloads/current; RRID: SCR_000325 Clampfit 10.3 Molecular Devices, Inc. https://www.moleculardevices.com/; RRID: SCR_011323 Imaris Bitplane http://www.bitplane.com/download; RRID: SCR_007370 Other Rotarod TSE systems https://www.tse-systems.com/product-details/rotarod DigiGait Mouse Specifics,Inc. https://mousespecifics.com/

    Polymerase Chain Reaction:

    Article Title: Cholinergic Interneurons Amplify Thalamostriatal Excitation of Striatal Indirect Pathway Neurons in Parkinson's Disease Models.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti tyrosine hydroxylase Sigma-Aldrich Cat#T2928; RRID: AB_477569 Anti-Mouse IgG secondary antibody Alexa 488 Molecular Probes Cat#A-21202; RRID: AB_141607 Dynal ProteinG magnetic beads Invitrogen Cat#10003D Bacterial and Virus Strains AAV9-floxed-Cre off-hEF1a-ChR2(H134R)-EYFP Virovek, Inc. N/A AAV9-CMV-Synaptophysin-GFP Virovek, Inc Addgene:26084 AAV8-Synapsin-Chronos-tdTomato UPenn vector core Addgene:62726 AAV8-EF1a-DIO-hM4D(Gi)-mCherry Virovek, Inc Addgene:50461 AAV9-EF1a-DIO-hChR2(H134R)-EYFP UPenn vector core Addgene:20298 AAV9-U6-537-chrna6-shRNA-CMV-tdTomato Virovek, Inc. N/A AAV9-U6-scrambe-shRNA-CMV-tdTomato Virovek, Inc. N/A AAV9-EF1a-DIO-Rpl22l1-Myc-DDK-2A-tdTomato Virovek, Inc N/A AAV1-CAG-ChR2-Venus UPenn vector core Addgene:20071 Chemicals, Peptides, and Recombinant Proteins SR 95531 hydrobromide supplier TOCRIS Cat#1262; CAS:104104-50-9 CGP55845 hydrochloride TOCRIS Cat#1248; CAS:149184-22-5 D-AP5 Hellobio HB0225; CAS:79055-68-8 QX314 chloride TOCRIS Cat#2313; CAS:5369-03-9 a-bungarotoxin TOCRIS Cat#2133; CAS:11032-79-4 a-conotoxin MII TOCRIS Cat#1340; CAS:175735-93-0 a-conotoxin PIA TOCRIS Cat#3121; CAS:669050-68-4 TMPH hydrochloride TOCRIS Cat#2438; CAS:849461-91-2 Methyllycaconitine citrate TOCRIS Cat#1029; CAS:112825-05-5 Dihydro-b-erythroidine hydrobromide TOCRIS Cat#2349; CAS:29734-68-7 Tetrodotoxin citrate Alomone labs Cat#T-550; CAS:18660-81-6 NBQX disodium salt TOCRIS Cat#1044; CAS:479347-86-9 4-aminopyridine TOCRIS Cat#0940; CAS:504-24-5 (-)-Quinpirole hydrochloride TOCIRS Cat#1061; CAS:85798-08-9 6-Hydroxydopamine hydrochloride Sigma-Aldrich H4381; CAS:28094-15-7 Clozapine N-oxide dihydrochloride Hellobio HB6149 Ambenonium dichloride TOCRIS Cat0388; CAS:115-79-7 (-)-Nicotine ditartrate TOCRIS Cat#3546; CAS:65-31-6 Atropine Sigma-Aldrich A0132; CAS:51-55-8 Mecamylamine hydrochloride TOCRIS Cat#2843; CAS:826-39-1 Critical Commercial Assays RNAeasy mini kit QIAGEN Cat#74104 SuperScript VILO cDNA Synthesis kit Invitrogen Cat#11754-010 TaqmanTM Universal PCR Master Mix Applied Biosystems Cat#4304437 RNAeasy plus micro kit QIAGEN Cat#74034 Experimental Models: Organisms/Strains Mouse: Tg(Grp-cre)KH288Gsat/Mmucd MMRRC RRID: MMRRC_031183_UCD Mouse: B6.Cg-Tg(Drd1a-tdTomato)6Calak/J The Jackson Laboratory RRID: IMSR_JAX:016204 Mouse: B6;FVB-Tg(Drd2-EGFP/Rpl10a)CP101Htz/J The Jackson Laboratory RRID: IMSR_JAX:030255 (Continued on next page) e1 Neuron 101, 1–15.e1–e6, February 6, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: B6;129S60-Chattm2(cre)lowl/J The Jackson Laboratory RRID: IMSR_JAX:006410 Mouse: Tg(Rbp4-cre)KL100Gsat/Mmucd MMRRC RRID: MMRRC_031125_UCD Mouse: WT:C57BL/6J The Jackson Laboratory RRID: IMSR_JAX:000664 Oligonucleotides siRNA targeting sequence: ChRNA6: CCAACGGAGTATGGCATCGAGA This paper NM021369.2 Probe for ChRNA6 Invitrogen Gene Expresion Assay ID:Mm00517533_m1 Probe for ChRNA4 Invitrogen Gene Expression Assay ID:Mm00516561_m1 Probe for ChRNB2 Invitrogen Gene Expression Assay ID:Mm00515323_m1 Probe for Gapdh Invitrogen Gene Expression Assay ID:Mm01318746_g1 Probe for hprt Invitrogen Gene Expression Assay ID:Mm99999915_g1 Recombinant DNA Mouse ribosomal protein L22 like 1 (Rpl22l1) cDNA Orogene Cat#MR200606 NM_002754 Software and Algorithms MATLAB 2017a MathWorks https://www.mathworks.com/products/matlab.html? s_tid=mlc_fx_ff_p_matlab; RRID: SCR_001622 ImageJ NIH https://imagej.nih.gov/ij/download.html; RRID: SCR_003070 Adobe IllustratorCC2017 Adobe https://www.adobe.com/; RRID: SCR_014198 Python NeuralEnsemble https://www.python.org/downloads/; RRID: SCR_000634 LimLight for open field test ACTIMETRICS http://www.actimetrics.com/products/limelight/; RRID: SCR_014254 Igor Pro 5.0 WaveMetrics https://www.wavemetrics.com/downloads/current; RRID: SCR_000325 Clampfit 10.3 Molecular Devices, Inc. https://www.moleculardevices.com/; RRID: SCR_011323 Imaris Bitplane http://www.bitplane.com/download; RRID: SCR_007370 Other Rotarod TSE systems https://www.tse-systems.com/product-details/rotarod DigiGait Mouse Specifics,Inc. https://mousespecifics.com/



    Similar Products

    93
    Bio-Techne corporation ambenonium dichloride
    Ambenonium Dichloride, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/0388/Ambenonium+dichloride/custom%400388%4041271088
    Average 93 stars, based on 1 article reviews
    ambenonium dichloride - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    88
    Tocris ambenonium dichloride
    Ambenonium Dichloride, supplied by Tocris, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/0388/Ambenonium+dichloride/pm41271088-94-0-8
    Average 88 stars, based on 1 article reviews
    ambenonium dichloride - by Bioz Stars, 2026-09
    88/100 stars
      Buy from Supplier

    93
    Cytek Biosciences anti cd38
    Anti Cd38, supplied by Cytek Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/0388/PE+Anti-Human+CD38/pmc12318136-198-17-20
    Average 93 stars, based on 1 article reviews
    anti cd38 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    88
    Tocris ambenonium
    A Schematics of AAV9.hSyn.ACh3.0 injection into DSt of WT mice and cartoon schematic showing the principle of GRAB ACh3.0 sensor function and the bath application of ACh with <t>ambenonium.</t> B Time courses of GRAB ACh3.0 fluorescence change (mean frame) following bath application of 100 µM ACh and 100 nM ambenonium for DLS and DMS (left). Summary data for maximal ΔF/F (center). Representative images and surface plots showing the maximal changes in GRAB ACh3.0 fluorescence across striatal regions (right) (DLS n = 10, N = 5; DMS n = 7, N = 4; unpaired t test p = 0.5967). C Schematics of AAV9.hSyn.ACh3.0 and saline or 6-OHDA (LD or HD) injections into DSt and MFB in WT mice (top). Cartoon depicting how ACh released from ChIs is detected by GRAB ACh3.0 expressed in striatal cells (bottom). D Representative images and surface plots of GRAB ACh3.0 fluorescence changes (mean frame) in DLS (top) and DMS (bottom) following application of a single electrical stimulus (25 µA, 0.5 ms) in the center of the striatal region of interest (left). Quantification of ΔF/F is shown on the bar charts (right) (DLS: Saline n = 32, N = 9; 6-OHDA LD n = 27, N = 6; 6-OHDA HD n = 38, N = 9; Kruskal-Wallis p = 0.2419 / DMS: Saline n = 38, N = 9; 6-OHDA LD n = 28, N = 6; 6-OHDA HD n = 42, N = 9; Kruskal-Wallis p = 0.0019; Dunn’s post hoc test). E Representative 2P-point scanning traces and quantification of fluorescence changes of GRAB ACh3.0 (DLS: Saline n = 28, N = 6; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 34, N = 5; Kruskal-Wallis p = 0.1903 / DMS: Saline n = 31, N = 7; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 27, N = 5; Kruskal-Wallis p = 0.467). F Representative 2P-point scanning traces and summary data of GRAB ACh3.0 fluorescence changes following paired-pulse stimulation (P1 + P2), with the digitally subtracted P2 component shown on gray (DLS: Saline n = 26, N = 6; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 30, N = 5; Kruskal-Wallis p = 0.2159 / DMS: Saline n = 31, N = 7; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 28, N = 5; Kruskal-Wallis p = 0.5913). Summary data is mean ± SEM. Extended statistical data is provided in Supplementary Table . n: number of cells, N: number of mice; n.s. p > 0.05; * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.
    Ambenonium, supplied by Tocris, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/0388/Ambenonium+dichloride/pmc12219286-276-11-15
    Average 88 stars, based on 1 article reviews
    ambenonium - by Bioz Stars, 2026-09
    88/100 stars
      Buy from Supplier

    90
    STEMCELL Technologies Inc hepaticulttm organoid differentiation supplement stem cell 100-0388
    A Schematics of AAV9.hSyn.ACh3.0 injection into DSt of WT mice and cartoon schematic showing the principle of GRAB ACh3.0 sensor function and the bath application of ACh with <t>ambenonium.</t> B Time courses of GRAB ACh3.0 fluorescence change (mean frame) following bath application of 100 µM ACh and 100 nM ambenonium for DLS and DMS (left). Summary data for maximal ΔF/F (center). Representative images and surface plots showing the maximal changes in GRAB ACh3.0 fluorescence across striatal regions (right) (DLS n = 10, N = 5; DMS n = 7, N = 4; unpaired t test p = 0.5967). C Schematics of AAV9.hSyn.ACh3.0 and saline or 6-OHDA (LD or HD) injections into DSt and MFB in WT mice (top). Cartoon depicting how ACh released from ChIs is detected by GRAB ACh3.0 expressed in striatal cells (bottom). D Representative images and surface plots of GRAB ACh3.0 fluorescence changes (mean frame) in DLS (top) and DMS (bottom) following application of a single electrical stimulus (25 µA, 0.5 ms) in the center of the striatal region of interest (left). Quantification of ΔF/F is shown on the bar charts (right) (DLS: Saline n = 32, N = 9; 6-OHDA LD n = 27, N = 6; 6-OHDA HD n = 38, N = 9; Kruskal-Wallis p = 0.2419 / DMS: Saline n = 38, N = 9; 6-OHDA LD n = 28, N = 6; 6-OHDA HD n = 42, N = 9; Kruskal-Wallis p = 0.0019; Dunn’s post hoc test). E Representative 2P-point scanning traces and quantification of fluorescence changes of GRAB ACh3.0 (DLS: Saline n = 28, N = 6; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 34, N = 5; Kruskal-Wallis p = 0.1903 / DMS: Saline n = 31, N = 7; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 27, N = 5; Kruskal-Wallis p = 0.467). F Representative 2P-point scanning traces and summary data of GRAB ACh3.0 fluorescence changes following paired-pulse stimulation (P1 + P2), with the digitally subtracted P2 component shown on gray (DLS: Saline n = 26, N = 6; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 30, N = 5; Kruskal-Wallis p = 0.2159 / DMS: Saline n = 31, N = 7; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 28, N = 5; Kruskal-Wallis p = 0.5913). Summary data is mean ± SEM. Extended statistical data is provided in Supplementary Table . n: number of cells, N: number of mice; n.s. p > 0.05; * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.
    Hepaticulttm Organoid Differentiation Supplement Stem Cell 100 0388, supplied by STEMCELL Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/0388/human+hepaticulttm+organoid+growth+supplement+stem+cell+100+0389/pm39561715-462-104-110
    Average 90 stars, based on 1 article reviews
    hepaticulttm organoid differentiation supplement stem cell 100-0388 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Cytek Biosciences cd38 pe
    A Schematics of AAV9.hSyn.ACh3.0 injection into DSt of WT mice and cartoon schematic showing the principle of GRAB ACh3.0 sensor function and the bath application of ACh with <t>ambenonium.</t> B Time courses of GRAB ACh3.0 fluorescence change (mean frame) following bath application of 100 µM ACh and 100 nM ambenonium for DLS and DMS (left). Summary data for maximal ΔF/F (center). Representative images and surface plots showing the maximal changes in GRAB ACh3.0 fluorescence across striatal regions (right) (DLS n = 10, N = 5; DMS n = 7, N = 4; unpaired t test p = 0.5967). C Schematics of AAV9.hSyn.ACh3.0 and saline or 6-OHDA (LD or HD) injections into DSt and MFB in WT mice (top). Cartoon depicting how ACh released from ChIs is detected by GRAB ACh3.0 expressed in striatal cells (bottom). D Representative images and surface plots of GRAB ACh3.0 fluorescence changes (mean frame) in DLS (top) and DMS (bottom) following application of a single electrical stimulus (25 µA, 0.5 ms) in the center of the striatal region of interest (left). Quantification of ΔF/F is shown on the bar charts (right) (DLS: Saline n = 32, N = 9; 6-OHDA LD n = 27, N = 6; 6-OHDA HD n = 38, N = 9; Kruskal-Wallis p = 0.2419 / DMS: Saline n = 38, N = 9; 6-OHDA LD n = 28, N = 6; 6-OHDA HD n = 42, N = 9; Kruskal-Wallis p = 0.0019; Dunn’s post hoc test). E Representative 2P-point scanning traces and quantification of fluorescence changes of GRAB ACh3.0 (DLS: Saline n = 28, N = 6; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 34, N = 5; Kruskal-Wallis p = 0.1903 / DMS: Saline n = 31, N = 7; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 27, N = 5; Kruskal-Wallis p = 0.467). F Representative 2P-point scanning traces and summary data of GRAB ACh3.0 fluorescence changes following paired-pulse stimulation (P1 + P2), with the digitally subtracted P2 component shown on gray (DLS: Saline n = 26, N = 6; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 30, N = 5; Kruskal-Wallis p = 0.2159 / DMS: Saline n = 31, N = 7; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 28, N = 5; Kruskal-Wallis p = 0.5913). Summary data is mean ± SEM. Extended statistical data is provided in Supplementary Table . n: number of cells, N: number of mice; n.s. p > 0.05; * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.
    Cd38 Pe, supplied by Cytek Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/0388/PE+Anti-Human+CD38/pm39266726-274-22-23
    Average 93 stars, based on 1 article reviews
    cd38 pe - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    A Schematics of AAV9.hSyn.ACh3.0 injection into DSt of WT mice and cartoon schematic showing the principle of GRAB ACh3.0 sensor function and the bath application of ACh with ambenonium. B Time courses of GRAB ACh3.0 fluorescence change (mean frame) following bath application of 100 µM ACh and 100 nM ambenonium for DLS and DMS (left). Summary data for maximal ΔF/F (center). Representative images and surface plots showing the maximal changes in GRAB ACh3.0 fluorescence across striatal regions (right) (DLS n = 10, N = 5; DMS n = 7, N = 4; unpaired t test p = 0.5967). C Schematics of AAV9.hSyn.ACh3.0 and saline or 6-OHDA (LD or HD) injections into DSt and MFB in WT mice (top). Cartoon depicting how ACh released from ChIs is detected by GRAB ACh3.0 expressed in striatal cells (bottom). D Representative images and surface plots of GRAB ACh3.0 fluorescence changes (mean frame) in DLS (top) and DMS (bottom) following application of a single electrical stimulus (25 µA, 0.5 ms) in the center of the striatal region of interest (left). Quantification of ΔF/F is shown on the bar charts (right) (DLS: Saline n = 32, N = 9; 6-OHDA LD n = 27, N = 6; 6-OHDA HD n = 38, N = 9; Kruskal-Wallis p = 0.2419 / DMS: Saline n = 38, N = 9; 6-OHDA LD n = 28, N = 6; 6-OHDA HD n = 42, N = 9; Kruskal-Wallis p = 0.0019; Dunn’s post hoc test). E Representative 2P-point scanning traces and quantification of fluorescence changes of GRAB ACh3.0 (DLS: Saline n = 28, N = 6; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 34, N = 5; Kruskal-Wallis p = 0.1903 / DMS: Saline n = 31, N = 7; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 27, N = 5; Kruskal-Wallis p = 0.467). F Representative 2P-point scanning traces and summary data of GRAB ACh3.0 fluorescence changes following paired-pulse stimulation (P1 + P2), with the digitally subtracted P2 component shown on gray (DLS: Saline n = 26, N = 6; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 30, N = 5; Kruskal-Wallis p = 0.2159 / DMS: Saline n = 31, N = 7; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 28, N = 5; Kruskal-Wallis p = 0.5913). Summary data is mean ± SEM. Extended statistical data is provided in Supplementary Table . n: number of cells, N: number of mice; n.s. p > 0.05; * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.

    Journal: NPJ Parkinson's Disease

    Article Title: Postsynaptic adaptations in direct pathway muscarinic M4-receptor signaling follow the temporal and regional pattern of dopaminergic degeneration

    doi: 10.1038/s41531-025-01047-3

    Figure Lengend Snippet: A Schematics of AAV9.hSyn.ACh3.0 injection into DSt of WT mice and cartoon schematic showing the principle of GRAB ACh3.0 sensor function and the bath application of ACh with ambenonium. B Time courses of GRAB ACh3.0 fluorescence change (mean frame) following bath application of 100 µM ACh and 100 nM ambenonium for DLS and DMS (left). Summary data for maximal ΔF/F (center). Representative images and surface plots showing the maximal changes in GRAB ACh3.0 fluorescence across striatal regions (right) (DLS n = 10, N = 5; DMS n = 7, N = 4; unpaired t test p = 0.5967). C Schematics of AAV9.hSyn.ACh3.0 and saline or 6-OHDA (LD or HD) injections into DSt and MFB in WT mice (top). Cartoon depicting how ACh released from ChIs is detected by GRAB ACh3.0 expressed in striatal cells (bottom). D Representative images and surface plots of GRAB ACh3.0 fluorescence changes (mean frame) in DLS (top) and DMS (bottom) following application of a single electrical stimulus (25 µA, 0.5 ms) in the center of the striatal region of interest (left). Quantification of ΔF/F is shown on the bar charts (right) (DLS: Saline n = 32, N = 9; 6-OHDA LD n = 27, N = 6; 6-OHDA HD n = 38, N = 9; Kruskal-Wallis p = 0.2419 / DMS: Saline n = 38, N = 9; 6-OHDA LD n = 28, N = 6; 6-OHDA HD n = 42, N = 9; Kruskal-Wallis p = 0.0019; Dunn’s post hoc test). E Representative 2P-point scanning traces and quantification of fluorescence changes of GRAB ACh3.0 (DLS: Saline n = 28, N = 6; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 34, N = 5; Kruskal-Wallis p = 0.1903 / DMS: Saline n = 31, N = 7; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 27, N = 5; Kruskal-Wallis p = 0.467). F Representative 2P-point scanning traces and summary data of GRAB ACh3.0 fluorescence changes following paired-pulse stimulation (P1 + P2), with the digitally subtracted P2 component shown on gray (DLS: Saline n = 26, N = 6; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 30, N = 5; Kruskal-Wallis p = 0.2159 / DMS: Saline n = 31, N = 7; 6-OHDA LD n = 15, N = 4; 6-OHDA HD n = 28, N = 5; Kruskal-Wallis p = 0.5913). Summary data is mean ± SEM. Extended statistical data is provided in Supplementary Table . n: number of cells, N: number of mice; n.s. p > 0.05; * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.

    Article Snippet: Picrotoxin, MK-801, DNQX, DHβE, SCH 23390, sulpiride, acetylcholine, oxotremorine M, and ambenonium were purchased from Tocris Bioscience.

    Techniques: Injection, Fluorescence, Saline

    A Schematics of Cre-dependent GIRK2-encoding virus and saline or 6-OHDA (LD or HD) injections into the DSt and MFB from D1-Cre mice respectively (left). Cartoon of ChI-dMSN synapse depicting the bath application of ambenonium to block ACh hydrolysis by AChE (right). B Representative traces of electrically evoked M4-IPSCs (left) before (Basal) and after ( + Amb) bath application of ambenonium (10 nM) in DLS (top) and DMS (bottom). Quantification of net charge as absolute values (center) and normalized to control (right) (DLS: Saline n = 16, N = 4; 6-OHDA LD n = 20, N = 8; 6-OHDA HD n = 15, N = 5; Wilcoxon tests p < 0.0001 for absolute values and Kruskal-Wallis p = 0.4736 for ratio / DMS: Saline n = 10, N = 6; 6-OHDA LD n = 8, N = 6; 6-OHDA HD n = 13, N = 8; Wilcoxon test p = 0.002 for saline, paired t test p = 0.0082 for 6-OHDA LD and paired t test p = 0.0003 for 6-OHDA HD in absolute values and One-Way ANOVA p = 0.1687 for ratio). Summary data is mean ± SEM. Extended statistical data is provided in Supplementary Table . n: number of cells, N: number of mice; n.s. p > 0.05; * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.

    Journal: NPJ Parkinson's Disease

    Article Title: Postsynaptic adaptations in direct pathway muscarinic M4-receptor signaling follow the temporal and regional pattern of dopaminergic degeneration

    doi: 10.1038/s41531-025-01047-3

    Figure Lengend Snippet: A Schematics of Cre-dependent GIRK2-encoding virus and saline or 6-OHDA (LD or HD) injections into the DSt and MFB from D1-Cre mice respectively (left). Cartoon of ChI-dMSN synapse depicting the bath application of ambenonium to block ACh hydrolysis by AChE (right). B Representative traces of electrically evoked M4-IPSCs (left) before (Basal) and after ( + Amb) bath application of ambenonium (10 nM) in DLS (top) and DMS (bottom). Quantification of net charge as absolute values (center) and normalized to control (right) (DLS: Saline n = 16, N = 4; 6-OHDA LD n = 20, N = 8; 6-OHDA HD n = 15, N = 5; Wilcoxon tests p < 0.0001 for absolute values and Kruskal-Wallis p = 0.4736 for ratio / DMS: Saline n = 10, N = 6; 6-OHDA LD n = 8, N = 6; 6-OHDA HD n = 13, N = 8; Wilcoxon test p = 0.002 for saline, paired t test p = 0.0082 for 6-OHDA LD and paired t test p = 0.0003 for 6-OHDA HD in absolute values and One-Way ANOVA p = 0.1687 for ratio). Summary data is mean ± SEM. Extended statistical data is provided in Supplementary Table . n: number of cells, N: number of mice; n.s. p > 0.05; * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.

    Article Snippet: Picrotoxin, MK-801, DNQX, DHβE, SCH 23390, sulpiride, acetylcholine, oxotremorine M, and ambenonium were purchased from Tocris Bioscience.

    Techniques: Virus, Saline, Blocking Assay, Control