Review




Structured Review

Ribobio co stem-loop reverse transcription
Stem Loop Reverse Transcription, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stem+loop+reverse+transcription/stem+loop+reverse+transcriptase+primer+kit/pm39504594-69-3-16
Average 90 stars, based on 1 article reviews
stem-loop reverse transcription - by Bioz Stars, 2026-10
90/100 stars

Images

Related Articles

Reverse Transcription:

Article Title: Signal-On Fluorescence Biosensor for Detection of miRNA-21 Based on ROX labeled Specific Stem-Loop Probe.
Article Snippet: The stem-loop reverse transcription (RT) primers and amplification primers for U6 were sourced from Ribobio Co., Ltd., in Guangzhou, China.

Article Title: Comprehensive analysis of BUBs gene family in lung adenocarcinoma with immunological analysis.
Article Snippet: The stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to realize the reverse transcription of the mRNA samples.

Article Title: Bioinspired Nanovesicles Convert the Skeletal Endothelium-Associated Secretory Phenotype to Treat Osteoporosis.
Article Snippet: Recently, bone marrow endothelial cells (BMECs) were found to play an important role in regulating bone homeostasis.. However, few studies utilized BMECs to treat bone metabolic diseases including osteoporosis.. Here, we reported bioinspired nanovesicles (BNVs) prepared from human induced pluripotent stem cells-derived endothelial cells under hypoxia culture through an extrusion approach.

Article Title: Placental extracellular vesicles induce ovarian tumour cell death in an ex vivo explant model: Possible therapeutic potential.
Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-519a-5p, miRNA-512–3p, and miRNA143–3p were purchased from RiboBio (Guangzhou, China).

Article Title: Circulating miRNA-155 as a Potential Biomarker for Coronary Slow Flow
Article Snippet: The stem-loop reverse transcription primers and PCR primers for the miRNA-155 (mature miRNA sequence UUAAUGCUAAUCGUGAUAGGGGUU) of interest were purchased from Ribobio (Guangzhou, China).

Article Title: Placental extracellular vesicles promoted cervical tumour tissue undergoing death.
Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-143-3p, miRNA-519a-5p, and miRNA-199a-3p were purchased from RiboBio (Guangzhou, China).

Article Title: Magnetofection of miR-21 promoted by electromagnetic field and iron oxide nanoparticles via the p38 MAPK pathway contributes to osteogenesis and angiogenesis for intervertebral fusion
Article Snippet: The extracted RNA was reverse-transcribed into cDNA with the stem-loop reverse transcriptase primer Kit (Ribobio, Guangzhou, China).

Article Title: Exosomal Manf originated from endothelium regulated osteoclast differentiation by down-regulating NF-κB signaling pathway.
Article Snippet: Subsequently, a stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to reverse-transcribe miRNA samples.

Amplification:

Article Title: Signal-On Fluorescence Biosensor for Detection of miRNA-21 Based on ROX labeled Specific Stem-Loop Probe.
Article Snippet: The stem-loop reverse transcription (RT) primers and amplification primers for U6 were sourced from Ribobio Co., Ltd., in Guangzhou, China.

Article Title: Comprehensive analysis of BUBs gene family in lung adenocarcinoma with immunological analysis.
Article Snippet: The stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to realize the reverse transcription of the mRNA samples.

Article Title: Bioinspired Nanovesicles Convert the Skeletal Endothelium-Associated Secretory Phenotype to Treat Osteoporosis.
Article Snippet: Recently, bone marrow endothelial cells (BMECs) were found to play an important role in regulating bone homeostasis.. However, few studies utilized BMECs to treat bone metabolic diseases including osteoporosis.. Here, we reported bioinspired nanovesicles (BNVs) prepared from human induced pluripotent stem cells-derived endothelial cells under hypoxia culture through an extrusion approach.

Article Title: Placental extracellular vesicles induce ovarian tumour cell death in an ex vivo explant model: Possible therapeutic potential.
Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-519a-5p, miRNA-512–3p, and miRNA143–3p were purchased from RiboBio (Guangzhou, China).

Article Title: Circulating miRNA-155 as a Potential Biomarker for Coronary Slow Flow
Article Snippet: The stem-loop reverse transcription primers and PCR primers for the miRNA-155 (mature miRNA sequence UUAAUGCUAAUCGUGAUAGGGGUU) of interest were purchased from Ribobio (Guangzhou, China).

Article Title: Placental extracellular vesicles promoted cervical tumour tissue undergoing death.
Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-143-3p, miRNA-519a-5p, and miRNA-199a-3p were purchased from RiboBio (Guangzhou, China).

Article Title: Magnetofection of miR-21 promoted by electromagnetic field and iron oxide nanoparticles via the p38 MAPK pathway contributes to osteogenesis and angiogenesis for intervertebral fusion
Article Snippet: The extracted RNA was reverse-transcribed into cDNA with the stem-loop reverse transcriptase primer Kit (Ribobio, Guangzhou, China).

Article Title: Exosomal Manf originated from endothelium regulated osteoclast differentiation by down-regulating NF-κB signaling pathway.
Article Snippet: Subsequently, a stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to reverse-transcribe miRNA samples.

Polymerase Chain Reaction:

Article Title: Signal-On Fluorescence Biosensor for Detection of miRNA-21 Based on ROX labeled Specific Stem-Loop Probe.
Article Snippet: The stem-loop reverse transcription (RT) primers and amplification primers for U6 were sourced from Ribobio Co., Ltd., in Guangzhou, China.

Article Title: Comprehensive analysis of BUBs gene family in lung adenocarcinoma with immunological analysis.
Article Snippet: The stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to realize the reverse transcription of the mRNA samples.

Article Title: Bioinspired Nanovesicles Convert the Skeletal Endothelium-Associated Secretory Phenotype to Treat Osteoporosis.
Article Snippet: Recently, bone marrow endothelial cells (BMECs) were found to play an important role in regulating bone homeostasis.. However, few studies utilized BMECs to treat bone metabolic diseases including osteoporosis.. Here, we reported bioinspired nanovesicles (BNVs) prepared from human induced pluripotent stem cells-derived endothelial cells under hypoxia culture through an extrusion approach.

Article Title: Placental extracellular vesicles induce ovarian tumour cell death in an ex vivo explant model: Possible therapeutic potential.
Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-519a-5p, miRNA-512–3p, and miRNA143–3p were purchased from RiboBio (Guangzhou, China).

Article Title: Circulating miRNA-155 as a Potential Biomarker for Coronary Slow Flow
Article Snippet: The stem-loop reverse transcription primers and PCR primers for the miRNA-155 (mature miRNA sequence UUAAUGCUAAUCGUGAUAGGGGUU) of interest were purchased from Ribobio (Guangzhou, China).

Article Title: Placental extracellular vesicles promoted cervical tumour tissue undergoing death.
Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-143-3p, miRNA-519a-5p, and miRNA-199a-3p were purchased from RiboBio (Guangzhou, China).

Article Title: Magnetofection of miR-21 promoted by electromagnetic field and iron oxide nanoparticles via the p38 MAPK pathway contributes to osteogenesis and angiogenesis for intervertebral fusion
Article Snippet: The extracted RNA was reverse-transcribed into cDNA with the stem-loop reverse transcriptase primer Kit (Ribobio, Guangzhou, China).

Article Title: Exosomal Manf originated from endothelium regulated osteoclast differentiation by down-regulating NF-κB signaling pathway.
Article Snippet: Subsequently, a stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to reverse-transcribe miRNA samples.

Sequencing:

Article Title: Signal-On Fluorescence Biosensor for Detection of miRNA-21 Based on ROX labeled Specific Stem-Loop Probe.
Article Snippet: The stem-loop reverse transcription (RT) primers and amplification primers for U6 were sourced from Ribobio Co., Ltd., in Guangzhou, China.

Article Title: Comprehensive analysis of BUBs gene family in lung adenocarcinoma with immunological analysis.
Article Snippet: The stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to realize the reverse transcription of the mRNA samples.

Article Title: Bioinspired Nanovesicles Convert the Skeletal Endothelium-Associated Secretory Phenotype to Treat Osteoporosis.
Article Snippet: Recently, bone marrow endothelial cells (BMECs) were found to play an important role in regulating bone homeostasis.. However, few studies utilized BMECs to treat bone metabolic diseases including osteoporosis.. Here, we reported bioinspired nanovesicles (BNVs) prepared from human induced pluripotent stem cells-derived endothelial cells under hypoxia culture through an extrusion approach.

Article Title: Placental extracellular vesicles induce ovarian tumour cell death in an ex vivo explant model: Possible therapeutic potential.
Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-519a-5p, miRNA-512–3p, and miRNA143–3p were purchased from RiboBio (Guangzhou, China).

Article Title: Circulating miRNA-155 as a Potential Biomarker for Coronary Slow Flow
Article Snippet: The stem-loop reverse transcription primers and PCR primers for the miRNA-155 (mature miRNA sequence UUAAUGCUAAUCGUGAUAGGGGUU) of interest were purchased from Ribobio (Guangzhou, China).

Article Title: Placental extracellular vesicles promoted cervical tumour tissue undergoing death.
Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-143-3p, miRNA-519a-5p, and miRNA-199a-3p were purchased from RiboBio (Guangzhou, China).

Article Title: Magnetofection of miR-21 promoted by electromagnetic field and iron oxide nanoparticles via the p38 MAPK pathway contributes to osteogenesis and angiogenesis for intervertebral fusion
Article Snippet: The extracted RNA was reverse-transcribed into cDNA with the stem-loop reverse transcriptase primer Kit (Ribobio, Guangzhou, China).

Article Title: Exosomal Manf originated from endothelium regulated osteoclast differentiation by down-regulating NF-κB signaling pathway.
Article Snippet: Subsequently, a stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to reverse-transcribe miRNA samples.

DNA Synthesis:

Article Title: Signal-On Fluorescence Biosensor for Detection of miRNA-21 Based on ROX labeled Specific Stem-Loop Probe.
Article Snippet: The stem-loop reverse transcription (RT) primers and amplification primers for U6 were sourced from Ribobio Co., Ltd., in Guangzhou, China.

Article Title: Comprehensive analysis of BUBs gene family in lung adenocarcinoma with immunological analysis.
Article Snippet: The stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to realize the reverse transcription of the mRNA samples.

Article Title: Bioinspired Nanovesicles Convert the Skeletal Endothelium-Associated Secretory Phenotype to Treat Osteoporosis.
Article Snippet: Recently, bone marrow endothelial cells (BMECs) were found to play an important role in regulating bone homeostasis.. However, few studies utilized BMECs to treat bone metabolic diseases including osteoporosis.. Here, we reported bioinspired nanovesicles (BNVs) prepared from human induced pluripotent stem cells-derived endothelial cells under hypoxia culture through an extrusion approach.

Article Title: Placental extracellular vesicles induce ovarian tumour cell death in an ex vivo explant model: Possible therapeutic potential.
Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-519a-5p, miRNA-512–3p, and miRNA143–3p were purchased from RiboBio (Guangzhou, China).

Article Title: Circulating miRNA-155 as a Potential Biomarker for Coronary Slow Flow
Article Snippet: The stem-loop reverse transcription primers and PCR primers for the miRNA-155 (mature miRNA sequence UUAAUGCUAAUCGUGAUAGGGGUU) of interest were purchased from Ribobio (Guangzhou, China).

Article Title: Placental extracellular vesicles promoted cervical tumour tissue undergoing death.
Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-143-3p, miRNA-519a-5p, and miRNA-199a-3p were purchased from RiboBio (Guangzhou, China).

Article Title: Magnetofection of miR-21 promoted by electromagnetic field and iron oxide nanoparticles via the p38 MAPK pathway contributes to osteogenesis and angiogenesis for intervertebral fusion
Article Snippet: The extracted RNA was reverse-transcribed into cDNA with the stem-loop reverse transcriptase primer Kit (Ribobio, Guangzhou, China).

Article Title: Exosomal Manf originated from endothelium regulated osteoclast differentiation by down-regulating NF-κB signaling pathway.
Article Snippet: Subsequently, a stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to reverse-transcribe miRNA samples.



Similar Products

98
Vazyme Biotech Co stem loop reverse transcription
Stem Loop Reverse Transcription, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stem+loop+reverse+transcription/miRNA+1st+Strand+cDNA+Synthesis+Kit/pmc12825305-152-12-17
Average 98 stars, based on 1 article reviews
stem loop reverse transcription - by Bioz Stars, 2026-10
98/100 stars
  Buy from Supplier

90
Thermo Fisher sequence-specific stem-loop rt primers taqman microrna reverse transcription kit
Sequence Specific Stem Loop Rt Primers Taqman Microrna Reverse Transcription Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stem+loop+reverse+transcription/sequence+specific+stem+loop+rt+primers+taqman+microrna+reverse+transcription+kit/pm40412229-94-1-12
Average 90 stars, based on 1 article reviews
sequence-specific stem-loop rt primers taqman microrna reverse transcription kit - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Thermo Fisher mir-specific stem-loop structure and reverse transcription primers
Mir Specific Stem Loop Structure And Reverse Transcription Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stem+loop+reverse+transcription/mir+specific+stem+loop+structure+and+reverse+transcription+primers/pm40250483-50-15-18
Average 90 stars, based on 1 article reviews
mir-specific stem-loop structure and reverse transcription primers - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Sangon Biotech mirna stem loop reverse transcription kit
Mirna Stem Loop Reverse Transcription Kit, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stem+loop+reverse+transcription/mirna+specific+reverse+transcription+and+pcr+detection+primers/pmc11786202-96-13-19
Average 90 stars, based on 1 article reviews
mirna stem loop reverse transcription kit - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Thermo Fisher taqman-based specific pcr primers with a stem-loop sequence for reverse transcription
Taqman Based Specific Pcr Primers With A Stem Loop Sequence For Reverse Transcription, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stem+loop+reverse+transcription/taqman+based+specific+pcr+primers+with+a+stem+loop+sequence+for+reverse+transcription/pmc11698891-62-20-24
Average 90 stars, based on 1 article reviews
taqman-based specific pcr primers with a stem-loop sequence for reverse transcription - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Ribobio co reagents for stem-loop reverse transcription
Reagents For Stem Loop Reverse Transcription, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stem+loop+reverse+transcription/stem+loop+reverse+transcriptase+primer+kit/pm39752926-88-3-16
Average 90 stars, based on 1 article reviews
reagents for stem-loop reverse transcription - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Ribobio co stem-loop reverse transcription
Stem Loop Reverse Transcription, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stem+loop+reverse+transcription/stem+loop+reverse+transcriptase+primer+kit/pm39504594-69-3-16
Average 90 stars, based on 1 article reviews
stem-loop reverse transcription - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Ribobio co reagents for stem-loop reverse transcription and primers of mirna-143-3p, mirna-519a-5p, and mirna-199a-3p
Reagents For Stem Loop Reverse Transcription And Primers Of Mirna 143 3p, Mirna 519a 5p, And Mirna 199a 3p, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stem+loop+reverse+transcription/mir+199a+5p+mimic/pm39504594-69-12-16
Average 90 stars, based on 1 article reviews
reagents for stem-loop reverse transcription and primers of mirna-143-3p, mirna-519a-5p, and mirna-199a-3p - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

98
Vazyme Biotech Co stem loop reverse transcription kit
Stem Loop Reverse Transcription Kit, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stem+loop+reverse+transcription/miRNA+1st+Strand+cDNA+Synthesis+Kit/pmc11489463-166-4-9
Average 98 stars, based on 1 article reviews
stem loop reverse transcription kit - by Bioz Stars, 2026-10
98/100 stars
  Buy from Supplier

90
Thermo Fisher gene-specific stem-loop reverse transcription primers
Gene Specific Stem Loop Reverse Transcription Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stem+loop+reverse+transcription/pmc11467329-250-14-19
Average 90 stars, based on 1 article reviews
gene-specific stem-loop reverse transcription primers - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results