Review



zen lite 3 4 9 software image processing computer software  (Carl Zeiss)


Bioz Verified Symbol Carl Zeiss is a verified supplier
Bioz Manufacturer Symbol Carl Zeiss manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Carl Zeiss zen lite 3 4 9 software image processing computer software
    Zen Lite 3 4 9 Software Image Processing Computer Software, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 96/100, based on 1043 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software+processing+module/pmc10942853-93-17-28
    Average 96 stars, based on 1043 article reviews
    zen lite 3 4 9 software image processing computer software - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Microscopy:

    Article Title: Therapeutic Potential of Mesenchymal Stem Cell and Tenocyte Secretomes for Tendon Repair: Proteomic Profiling and Functional Characterization In Vitro and In Ovo.
    Article Snippet: To detect proteoglycans, the sections were stained with 0.1% toluidine blue solution (Merck/Sigma-Aldrich, Buchs, Switzerland). .. Microscopic documentation was carried out using a Zeiss Axio Vert.A1 brightfield microscope with ZEN 2.6 lite software (Carl Zeiss Microscopy, Oberkochen, Germany). ..

    Article Title: Synergistic Effects of Insulin-like Growth Factor-1 and Platelet-Derived Growth Factor-BB in Tendon Healing.
    Article Snippet: .. On days 0 (EDD7), 2 (EDD9), 4 (EDD11), and 7 (EDD14), pictures were taken using a Zeiss Axio Vert.A1 brightfield microscope with ZEN 2.6 lite software (Carl Zeiss Microscopy, Oberkochen, Germany). ..

    Article Title: Intercellular adhesion molecule-1 protects against adipose tissue inflammation and insulin resistance but promotes liver inflammation and hepatic fibrosis in mice
    Article Snippet: .. Images were acquired using an Axioplan2 microscope (Carl Zeiss Microscopy, Oberkochen, Germany) and Zen lite 3.2 software (Carl Zeiss Microscopy, Oberkochen, Germany). ..

    Software:

    Article Title: Therapeutic Potential of Mesenchymal Stem Cell and Tenocyte Secretomes for Tendon Repair: Proteomic Profiling and Functional Characterization In Vitro and In Ovo.
    Article Snippet: To detect proteoglycans, the sections were stained with 0.1% toluidine blue solution (Merck/Sigma-Aldrich, Buchs, Switzerland). .. Microscopic documentation was carried out using a Zeiss Axio Vert.A1 brightfield microscope with ZEN 2.6 lite software (Carl Zeiss Microscopy, Oberkochen, Germany). ..

    Article Title: Uncovering biomarkers for chronic toxoplasmosis detection highlights alternative pathways shaping parasite dormancy.
    Article Snippet: D. Soldati Mouse anti-HA Roche RRID: AB_2314622 Rabbit anti-HA Cell Signaling Technology RRID: AB_1549585 Rabbit polyclonal anti-QRS Antunes et al, 2024 Rabbit polyclonal anti-BCLA Dard et al, 2021 Mouse anti-FLAG Cell Signaling Technology Cat♯8146 Rabbit anti-FLAG Cell Signaling Technology RRID: AB_2798687 Rabbit polyclonal anti-BSM Eurogentec custom antibody Alexa Fluor 488 Recombinant Rabbit Monoclonal Antibody Invitrogen A11008 Alexa Fluor 488 Recombinant Mouse Monoclonal Antibody Invitrogen A11001 Alexa Fluor 594 Recombinant Rabbit Monoclonal Antibody Invitrogen A11012 Alexa Fluor 594 Recombinant Mouse Monoclonal Antibody Invitrogen A11005 Anti-Mouse IgG, AP Conjugate Promega S3721 Anti-Rabbit IgG, AP Conjugate Promega S3731 Anti-His-tag chimeric human monoclonal antibody Sigma-Aldrich SAB5600096 Anti-Mouse IgG (Fc specific)–Peroxidase antibody Sigma-Aldrich Cat# A0168 Anti-Human IgG (Fc specific)−Peroxidase antibody Sigma-Aldrich Cat# A0170 Oligonucleotides and other sequence-based reagents Oligonucleotide LIC-216140-Fwd Sigma-Aldrich TACTTCCAATCCAATTTAGCtccgaagaccatccatgaatattcatgg Oligonucleotide LIC-216140-Rev Sigma-Aldrich TCCTCCACTTCCAATTTTAGCgccgtttatctcgaccacggatggcgg Oligonucleotide LIC-BSM-Fwd Sigma-Aldrich TACTTCCAATCCAATTTAGCgatgaattaccccacagtgtgtggac Oligonucleotide LIC-BSM-Rev Sigma-Aldrich TCCTCCACTTCCAATTTTAGCagctgtgtgagaatgctgccgctcgg Oligonucleotide BSM-CRISP1-Fwd Sigma-Aldrich AAGTTGATGATACTCACTGCAGCTCG Oligonucleotide BSM-CRISP1-Rev Sigma-Aldrich AAAACGAGCTGCAGTGAGTATCATCA Oligonucleotide BSM-REV1-screen Sigma-Aldrich GAGCTGCAGTGAGTATCATC Oligonucleotide BSM-CRISP2-Fwd Sigma-Aldrich AAGTTGGAGGAAACTTTCAGCAAAGG Oligonucleotide BSM-CRISP2-Rev Sigma-Aldrich AAAACCTTTGCTGAAAGTTTCCTCCA Oligonucleotide BSM-REV2-screen Sigma-Aldrich CTTTGCTGAAAGTTTCCTCC Chemicals, enzymes, and other reagents Dulbecco’s modified Eagle’s medium Invitrogen Cat# 12491015 Fetal Bovine Serum Gibco 10270106 HEPES Gibco Cat# 15630056 L-glutamine Gibco 25030123 Pénicilline-streptomycine Gibco 15070063 Hank’s Balanced Salt Solution Gibco Cat# 14025-050 3-indoleacetic acid Sigma-Aldrich Cat# 45533 © The Author(s) EMBO Molecular Medicine 15 D ow nloaded from https://w w w .em bopress.org on M ay 22, 2025 from IP 66.96.225.158. .. Reagent/resource Reference or source Identifier or catalog number FR235222 Antunes et al, 2024 DMSO Sigma-Aldrich D2438 Bovine serum albumin Sigma-Aldrich A7030 Hoechst 33342 solution Invitrogen Cat# H1399 Complete EDTA free Roche 05056489001 NBT/BCIP 1-Step Thermo Fisher Scientific Cat# 34042 Coomassie blue R-250 Sigma-Aldrich (MERK) 1.12553.0025 TRIzol Thermo Fisher Scientific Cat# 15596026 Pyrimethamine Sigma-Aldrich (MERK) 46706 ESF921 media Expression System Cat # 96-001-01 Benzonase MERK Millipore Cat # 70746 Ni-NTA resin Qiagen Cat# 30210 SuperBlock blocking buffer Thermo Fisher Scientific Cat# 37515 Recombinant protein A/G peroxidase conjugated Thermo Fisher Scientific Cat# 32490 TMB Substrate Thermo Fisher Scientific Cat# 34029 Software ZEN 2 lite 9 Carl Zeiss GraphPad Prism 8 https://www.graphpad.com/features Xcalibur 2.8 Thermo Fisher Scientific Mascot v2.8.3 Matrix Science Proline v2.2.0 ProFI Proteomics Astra Wyatt Technologies FastQC www.bioinformatics.babraham.ac.uk/projects/ fastqc/ MultiQC Seqera iDEP.96 http://bioinformatics.sdstate.edu/idep96/ Minimap2 https://github.com/lh3/minimap2 GuppY v4.09 Integrated Genome Browser (IGB) v9.1.8 https://www.bioviz.org/ Deeptools v3.5.1 https://deeptools.readthedocs.io/en/3.5.2/ index.html BOWTIE2 software (V2.1.0) https://github.com/ MACS v2.2 https://github.com/ nf-core Chip-Seq v2.0.0 https://github.com/ Samtools v1.4 https://www.htslib.org/ Bamtools v2.5.1 https://github.com/ Other QiAamp DNA mini kit Qiagen Cat# 51304 TaqManTM MicroRNA Reverse Transcription Kit Applied Biosystems Cat# 4366596 ABI 7500 real-time PCR system Applied Biosystems Ultimate 3000 RSLCnano Thermo Fisher Scientific Q-Exactive Plus Thermo Fisher Scientific BTX ECM 630 Harvard Apparatus ӒKTA pureTM chromatography system Cytiva 16 EMBO Molecular Medicine © The Author(s) D ow nloaded from https://w w w .em bopress.org on M ay 22, 2025 from IP 66.96.225.158. .. Parasites and human cell culture Human primary fibroblasts (HFFs, ATCC® CCL-171TM) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Invitrogen), 10 mM (4-(2-hydroxyethyl)-1-piperazine ethane sulphonic acid) (HEPES) buffer pH 7.2, 2 mM L-glutamine, and 50 μg/mL of penicillin and streptomycin (Invitrogen).

    Article Title: Synergistic Effects of Insulin-like Growth Factor-1 and Platelet-Derived Growth Factor-BB in Tendon Healing.
    Article Snippet: .. On days 0 (EDD7), 2 (EDD9), 4 (EDD11), and 7 (EDD14), pictures were taken using a Zeiss Axio Vert.A1 brightfield microscope with ZEN 2.6 lite software (Carl Zeiss Microscopy, Oberkochen, Germany). ..

    Article Title: A framework for evaluating predicted sperm trajectories in crowded microscopy videos
    Article Snippet: .. Videos were recorded continuously for two minutes at nine frames per second using Zeiss Zen Lite acquisition software with accompanying time-series data collection module. ..

    Article Title: FoxO3 controls cardiomyocyte proliferation and heart regeneration by regulating Sfrp2 expression in postnatal mice.
    Article Snippet: To quantify the cell size, 5 independent hearts per group (at least 300 cells) were captured near apex with laser-scanning confocal microscope (LSM 700, Zeiss). .. ZEN 2012 lite software (Zeiss) was used to quantify the size of each cell. .. For EdU labeling experiments, neonatal mice were subcutaneously injected with 50μl of a 2mg/ml solution of EdU (RiboBio, Guangzhou, China) dissolved in sterile water.

    Article Title: Intercellular adhesion molecule-1 protects against adipose tissue inflammation and insulin resistance but promotes liver inflammation and hepatic fibrosis in mice
    Article Snippet: .. Images were acquired using an Axioplan2 microscope (Carl Zeiss Microscopy, Oberkochen, Germany) and Zen lite 3.2 software (Carl Zeiss Microscopy, Oberkochen, Germany). ..

    Article Title: A framework for evaluating predicted sperm trajectories in crowded microscopy videos.
    Article Snippet: .. Videos were recorded continuously for two minutes at nine frames per second using Zeiss Zen Lite acquisition software with accompanying time-series data collection module. ..

    Blocking Assay:

    Article Title: Uncovering biomarkers for chronic toxoplasmosis detection highlights alternative pathways shaping parasite dormancy.
    Article Snippet: D. Soldati Mouse anti-HA Roche RRID: AB_2314622 Rabbit anti-HA Cell Signaling Technology RRID: AB_1549585 Rabbit polyclonal anti-QRS Antunes et al, 2024 Rabbit polyclonal anti-BCLA Dard et al, 2021 Mouse anti-FLAG Cell Signaling Technology Cat♯8146 Rabbit anti-FLAG Cell Signaling Technology RRID: AB_2798687 Rabbit polyclonal anti-BSM Eurogentec custom antibody Alexa Fluor 488 Recombinant Rabbit Monoclonal Antibody Invitrogen A11008 Alexa Fluor 488 Recombinant Mouse Monoclonal Antibody Invitrogen A11001 Alexa Fluor 594 Recombinant Rabbit Monoclonal Antibody Invitrogen A11012 Alexa Fluor 594 Recombinant Mouse Monoclonal Antibody Invitrogen A11005 Anti-Mouse IgG, AP Conjugate Promega S3721 Anti-Rabbit IgG, AP Conjugate Promega S3731 Anti-His-tag chimeric human monoclonal antibody Sigma-Aldrich SAB5600096 Anti-Mouse IgG (Fc specific)–Peroxidase antibody Sigma-Aldrich Cat# A0168 Anti-Human IgG (Fc specific)−Peroxidase antibody Sigma-Aldrich Cat# A0170 Oligonucleotides and other sequence-based reagents Oligonucleotide LIC-216140-Fwd Sigma-Aldrich TACTTCCAATCCAATTTAGCtccgaagaccatccatgaatattcatgg Oligonucleotide LIC-216140-Rev Sigma-Aldrich TCCTCCACTTCCAATTTTAGCgccgtttatctcgaccacggatggcgg Oligonucleotide LIC-BSM-Fwd Sigma-Aldrich TACTTCCAATCCAATTTAGCgatgaattaccccacagtgtgtggac Oligonucleotide LIC-BSM-Rev Sigma-Aldrich TCCTCCACTTCCAATTTTAGCagctgtgtgagaatgctgccgctcgg Oligonucleotide BSM-CRISP1-Fwd Sigma-Aldrich AAGTTGATGATACTCACTGCAGCTCG Oligonucleotide BSM-CRISP1-Rev Sigma-Aldrich AAAACGAGCTGCAGTGAGTATCATCA Oligonucleotide BSM-REV1-screen Sigma-Aldrich GAGCTGCAGTGAGTATCATC Oligonucleotide BSM-CRISP2-Fwd Sigma-Aldrich AAGTTGGAGGAAACTTTCAGCAAAGG Oligonucleotide BSM-CRISP2-Rev Sigma-Aldrich AAAACCTTTGCTGAAAGTTTCCTCCA Oligonucleotide BSM-REV2-screen Sigma-Aldrich CTTTGCTGAAAGTTTCCTCC Chemicals, enzymes, and other reagents Dulbecco’s modified Eagle’s medium Invitrogen Cat# 12491015 Fetal Bovine Serum Gibco 10270106 HEPES Gibco Cat# 15630056 L-glutamine Gibco 25030123 Pénicilline-streptomycine Gibco 15070063 Hank’s Balanced Salt Solution Gibco Cat# 14025-050 3-indoleacetic acid Sigma-Aldrich Cat# 45533 © The Author(s) EMBO Molecular Medicine 15 D ow nloaded from https://w w w .em bopress.org on M ay 22, 2025 from IP 66.96.225.158. .. Reagent/resource Reference or source Identifier or catalog number FR235222 Antunes et al, 2024 DMSO Sigma-Aldrich D2438 Bovine serum albumin Sigma-Aldrich A7030 Hoechst 33342 solution Invitrogen Cat# H1399 Complete EDTA free Roche 05056489001 NBT/BCIP 1-Step Thermo Fisher Scientific Cat# 34042 Coomassie blue R-250 Sigma-Aldrich (MERK) 1.12553.0025 TRIzol Thermo Fisher Scientific Cat# 15596026 Pyrimethamine Sigma-Aldrich (MERK) 46706 ESF921 media Expression System Cat # 96-001-01 Benzonase MERK Millipore Cat # 70746 Ni-NTA resin Qiagen Cat# 30210 SuperBlock blocking buffer Thermo Fisher Scientific Cat# 37515 Recombinant protein A/G peroxidase conjugated Thermo Fisher Scientific Cat# 32490 TMB Substrate Thermo Fisher Scientific Cat# 34029 Software ZEN 2 lite 9 Carl Zeiss GraphPad Prism 8 https://www.graphpad.com/features Xcalibur 2.8 Thermo Fisher Scientific Mascot v2.8.3 Matrix Science Proline v2.2.0 ProFI Proteomics Astra Wyatt Technologies FastQC www.bioinformatics.babraham.ac.uk/projects/ fastqc/ MultiQC Seqera iDEP.96 http://bioinformatics.sdstate.edu/idep96/ Minimap2 https://github.com/lh3/minimap2 GuppY v4.09 Integrated Genome Browser (IGB) v9.1.8 https://www.bioviz.org/ Deeptools v3.5.1 https://deeptools.readthedocs.io/en/3.5.2/ index.html BOWTIE2 software (V2.1.0) https://github.com/ MACS v2.2 https://github.com/ nf-core Chip-Seq v2.0.0 https://github.com/ Samtools v1.4 https://www.htslib.org/ Bamtools v2.5.1 https://github.com/ Other QiAamp DNA mini kit Qiagen Cat# 51304 TaqManTM MicroRNA Reverse Transcription Kit Applied Biosystems Cat# 4366596 ABI 7500 real-time PCR system Applied Biosystems Ultimate 3000 RSLCnano Thermo Fisher Scientific Q-Exactive Plus Thermo Fisher Scientific BTX ECM 630 Harvard Apparatus ӒKTA pureTM chromatography system Cytiva 16 EMBO Molecular Medicine © The Author(s) D ow nloaded from https://w w w .em bopress.org on M ay 22, 2025 from IP 66.96.225.158. .. Parasites and human cell culture Human primary fibroblasts (HFFs, ATCC® CCL-171TM) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Invitrogen), 10 mM (4-(2-hydroxyethyl)-1-piperazine ethane sulphonic acid) (HEPES) buffer pH 7.2, 2 mM L-glutamine, and 50 μg/mL of penicillin and streptomycin (Invitrogen).

    Recombinant:

    Article Title: Uncovering biomarkers for chronic toxoplasmosis detection highlights alternative pathways shaping parasite dormancy.
    Article Snippet: D. Soldati Mouse anti-HA Roche RRID: AB_2314622 Rabbit anti-HA Cell Signaling Technology RRID: AB_1549585 Rabbit polyclonal anti-QRS Antunes et al, 2024 Rabbit polyclonal anti-BCLA Dard et al, 2021 Mouse anti-FLAG Cell Signaling Technology Cat♯8146 Rabbit anti-FLAG Cell Signaling Technology RRID: AB_2798687 Rabbit polyclonal anti-BSM Eurogentec custom antibody Alexa Fluor 488 Recombinant Rabbit Monoclonal Antibody Invitrogen A11008 Alexa Fluor 488 Recombinant Mouse Monoclonal Antibody Invitrogen A11001 Alexa Fluor 594 Recombinant Rabbit Monoclonal Antibody Invitrogen A11012 Alexa Fluor 594 Recombinant Mouse Monoclonal Antibody Invitrogen A11005 Anti-Mouse IgG, AP Conjugate Promega S3721 Anti-Rabbit IgG, AP Conjugate Promega S3731 Anti-His-tag chimeric human monoclonal antibody Sigma-Aldrich SAB5600096 Anti-Mouse IgG (Fc specific)–Peroxidase antibody Sigma-Aldrich Cat# A0168 Anti-Human IgG (Fc specific)−Peroxidase antibody Sigma-Aldrich Cat# A0170 Oligonucleotides and other sequence-based reagents Oligonucleotide LIC-216140-Fwd Sigma-Aldrich TACTTCCAATCCAATTTAGCtccgaagaccatccatgaatattcatgg Oligonucleotide LIC-216140-Rev Sigma-Aldrich TCCTCCACTTCCAATTTTAGCgccgtttatctcgaccacggatggcgg Oligonucleotide LIC-BSM-Fwd Sigma-Aldrich TACTTCCAATCCAATTTAGCgatgaattaccccacagtgtgtggac Oligonucleotide LIC-BSM-Rev Sigma-Aldrich TCCTCCACTTCCAATTTTAGCagctgtgtgagaatgctgccgctcgg Oligonucleotide BSM-CRISP1-Fwd Sigma-Aldrich AAGTTGATGATACTCACTGCAGCTCG Oligonucleotide BSM-CRISP1-Rev Sigma-Aldrich AAAACGAGCTGCAGTGAGTATCATCA Oligonucleotide BSM-REV1-screen Sigma-Aldrich GAGCTGCAGTGAGTATCATC Oligonucleotide BSM-CRISP2-Fwd Sigma-Aldrich AAGTTGGAGGAAACTTTCAGCAAAGG Oligonucleotide BSM-CRISP2-Rev Sigma-Aldrich AAAACCTTTGCTGAAAGTTTCCTCCA Oligonucleotide BSM-REV2-screen Sigma-Aldrich CTTTGCTGAAAGTTTCCTCC Chemicals, enzymes, and other reagents Dulbecco’s modified Eagle’s medium Invitrogen Cat# 12491015 Fetal Bovine Serum Gibco 10270106 HEPES Gibco Cat# 15630056 L-glutamine Gibco 25030123 Pénicilline-streptomycine Gibco 15070063 Hank’s Balanced Salt Solution Gibco Cat# 14025-050 3-indoleacetic acid Sigma-Aldrich Cat# 45533 © The Author(s) EMBO Molecular Medicine 15 D ow nloaded from https://w w w .em bopress.org on M ay 22, 2025 from IP 66.96.225.158. .. Reagent/resource Reference or source Identifier or catalog number FR235222 Antunes et al, 2024 DMSO Sigma-Aldrich D2438 Bovine serum albumin Sigma-Aldrich A7030 Hoechst 33342 solution Invitrogen Cat# H1399 Complete EDTA free Roche 05056489001 NBT/BCIP 1-Step Thermo Fisher Scientific Cat# 34042 Coomassie blue R-250 Sigma-Aldrich (MERK) 1.12553.0025 TRIzol Thermo Fisher Scientific Cat# 15596026 Pyrimethamine Sigma-Aldrich (MERK) 46706 ESF921 media Expression System Cat # 96-001-01 Benzonase MERK Millipore Cat # 70746 Ni-NTA resin Qiagen Cat# 30210 SuperBlock blocking buffer Thermo Fisher Scientific Cat# 37515 Recombinant protein A/G peroxidase conjugated Thermo Fisher Scientific Cat# 32490 TMB Substrate Thermo Fisher Scientific Cat# 34029 Software ZEN 2 lite 9 Carl Zeiss GraphPad Prism 8 https://www.graphpad.com/features Xcalibur 2.8 Thermo Fisher Scientific Mascot v2.8.3 Matrix Science Proline v2.2.0 ProFI Proteomics Astra Wyatt Technologies FastQC www.bioinformatics.babraham.ac.uk/projects/ fastqc/ MultiQC Seqera iDEP.96 http://bioinformatics.sdstate.edu/idep96/ Minimap2 https://github.com/lh3/minimap2 GuppY v4.09 Integrated Genome Browser (IGB) v9.1.8 https://www.bioviz.org/ Deeptools v3.5.1 https://deeptools.readthedocs.io/en/3.5.2/ index.html BOWTIE2 software (V2.1.0) https://github.com/ MACS v2.2 https://github.com/ nf-core Chip-Seq v2.0.0 https://github.com/ Samtools v1.4 https://www.htslib.org/ Bamtools v2.5.1 https://github.com/ Other QiAamp DNA mini kit Qiagen Cat# 51304 TaqManTM MicroRNA Reverse Transcription Kit Applied Biosystems Cat# 4366596 ABI 7500 real-time PCR system Applied Biosystems Ultimate 3000 RSLCnano Thermo Fisher Scientific Q-Exactive Plus Thermo Fisher Scientific BTX ECM 630 Harvard Apparatus ӒKTA pureTM chromatography system Cytiva 16 EMBO Molecular Medicine © The Author(s) D ow nloaded from https://w w w .em bopress.org on M ay 22, 2025 from IP 66.96.225.158. .. Parasites and human cell culture Human primary fibroblasts (HFFs, ATCC® CCL-171TM) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Invitrogen), 10 mM (4-(2-hydroxyethyl)-1-piperazine ethane sulphonic acid) (HEPES) buffer pH 7.2, 2 mM L-glutamine, and 50 μg/mL of penicillin and streptomycin (Invitrogen).

    Magnetic Cell Separation:

    Article Title: Uncovering biomarkers for chronic toxoplasmosis detection highlights alternative pathways shaping parasite dormancy.
    Article Snippet: D. Soldati Mouse anti-HA Roche RRID: AB_2314622 Rabbit anti-HA Cell Signaling Technology RRID: AB_1549585 Rabbit polyclonal anti-QRS Antunes et al, 2024 Rabbit polyclonal anti-BCLA Dard et al, 2021 Mouse anti-FLAG Cell Signaling Technology Cat♯8146 Rabbit anti-FLAG Cell Signaling Technology RRID: AB_2798687 Rabbit polyclonal anti-BSM Eurogentec custom antibody Alexa Fluor 488 Recombinant Rabbit Monoclonal Antibody Invitrogen A11008 Alexa Fluor 488 Recombinant Mouse Monoclonal Antibody Invitrogen A11001 Alexa Fluor 594 Recombinant Rabbit Monoclonal Antibody Invitrogen A11012 Alexa Fluor 594 Recombinant Mouse Monoclonal Antibody Invitrogen A11005 Anti-Mouse IgG, AP Conjugate Promega S3721 Anti-Rabbit IgG, AP Conjugate Promega S3731 Anti-His-tag chimeric human monoclonal antibody Sigma-Aldrich SAB5600096 Anti-Mouse IgG (Fc specific)–Peroxidase antibody Sigma-Aldrich Cat# A0168 Anti-Human IgG (Fc specific)−Peroxidase antibody Sigma-Aldrich Cat# A0170 Oligonucleotides and other sequence-based reagents Oligonucleotide LIC-216140-Fwd Sigma-Aldrich TACTTCCAATCCAATTTAGCtccgaagaccatccatgaatattcatgg Oligonucleotide LIC-216140-Rev Sigma-Aldrich TCCTCCACTTCCAATTTTAGCgccgtttatctcgaccacggatggcgg Oligonucleotide LIC-BSM-Fwd Sigma-Aldrich TACTTCCAATCCAATTTAGCgatgaattaccccacagtgtgtggac Oligonucleotide LIC-BSM-Rev Sigma-Aldrich TCCTCCACTTCCAATTTTAGCagctgtgtgagaatgctgccgctcgg Oligonucleotide BSM-CRISP1-Fwd Sigma-Aldrich AAGTTGATGATACTCACTGCAGCTCG Oligonucleotide BSM-CRISP1-Rev Sigma-Aldrich AAAACGAGCTGCAGTGAGTATCATCA Oligonucleotide BSM-REV1-screen Sigma-Aldrich GAGCTGCAGTGAGTATCATC Oligonucleotide BSM-CRISP2-Fwd Sigma-Aldrich AAGTTGGAGGAAACTTTCAGCAAAGG Oligonucleotide BSM-CRISP2-Rev Sigma-Aldrich AAAACCTTTGCTGAAAGTTTCCTCCA Oligonucleotide BSM-REV2-screen Sigma-Aldrich CTTTGCTGAAAGTTTCCTCC Chemicals, enzymes, and other reagents Dulbecco’s modified Eagle’s medium Invitrogen Cat# 12491015 Fetal Bovine Serum Gibco 10270106 HEPES Gibco Cat# 15630056 L-glutamine Gibco 25030123 Pénicilline-streptomycine Gibco 15070063 Hank’s Balanced Salt Solution Gibco Cat# 14025-050 3-indoleacetic acid Sigma-Aldrich Cat# 45533 © The Author(s) EMBO Molecular Medicine 15 D ow nloaded from https://w w w .em bopress.org on M ay 22, 2025 from IP 66.96.225.158. .. Reagent/resource Reference or source Identifier or catalog number FR235222 Antunes et al, 2024 DMSO Sigma-Aldrich D2438 Bovine serum albumin Sigma-Aldrich A7030 Hoechst 33342 solution Invitrogen Cat# H1399 Complete EDTA free Roche 05056489001 NBT/BCIP 1-Step Thermo Fisher Scientific Cat# 34042 Coomassie blue R-250 Sigma-Aldrich (MERK) 1.12553.0025 TRIzol Thermo Fisher Scientific Cat# 15596026 Pyrimethamine Sigma-Aldrich (MERK) 46706 ESF921 media Expression System Cat # 96-001-01 Benzonase MERK Millipore Cat # 70746 Ni-NTA resin Qiagen Cat# 30210 SuperBlock blocking buffer Thermo Fisher Scientific Cat# 37515 Recombinant protein A/G peroxidase conjugated Thermo Fisher Scientific Cat# 32490 TMB Substrate Thermo Fisher Scientific Cat# 34029 Software ZEN 2 lite 9 Carl Zeiss GraphPad Prism 8 https://www.graphpad.com/features Xcalibur 2.8 Thermo Fisher Scientific Mascot v2.8.3 Matrix Science Proline v2.2.0 ProFI Proteomics Astra Wyatt Technologies FastQC www.bioinformatics.babraham.ac.uk/projects/ fastqc/ MultiQC Seqera iDEP.96 http://bioinformatics.sdstate.edu/idep96/ Minimap2 https://github.com/lh3/minimap2 GuppY v4.09 Integrated Genome Browser (IGB) v9.1.8 https://www.bioviz.org/ Deeptools v3.5.1 https://deeptools.readthedocs.io/en/3.5.2/ index.html BOWTIE2 software (V2.1.0) https://github.com/ MACS v2.2 https://github.com/ nf-core Chip-Seq v2.0.0 https://github.com/ Samtools v1.4 https://www.htslib.org/ Bamtools v2.5.1 https://github.com/ Other QiAamp DNA mini kit Qiagen Cat# 51304 TaqManTM MicroRNA Reverse Transcription Kit Applied Biosystems Cat# 4366596 ABI 7500 real-time PCR system Applied Biosystems Ultimate 3000 RSLCnano Thermo Fisher Scientific Q-Exactive Plus Thermo Fisher Scientific BTX ECM 630 Harvard Apparatus ӒKTA pureTM chromatography system Cytiva 16 EMBO Molecular Medicine © The Author(s) D ow nloaded from https://w w w .em bopress.org on M ay 22, 2025 from IP 66.96.225.158. .. Parasites and human cell culture Human primary fibroblasts (HFFs, ATCC® CCL-171TM) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Invitrogen), 10 mM (4-(2-hydroxyethyl)-1-piperazine ethane sulphonic acid) (HEPES) buffer pH 7.2, 2 mM L-glutamine, and 50 μg/mL of penicillin and streptomycin (Invitrogen).

    Reverse Transcription:

    Article Title: Uncovering biomarkers for chronic toxoplasmosis detection highlights alternative pathways shaping parasite dormancy.
    Article Snippet: D. Soldati Mouse anti-HA Roche RRID: AB_2314622 Rabbit anti-HA Cell Signaling Technology RRID: AB_1549585 Rabbit polyclonal anti-QRS Antunes et al, 2024 Rabbit polyclonal anti-BCLA Dard et al, 2021 Mouse anti-FLAG Cell Signaling Technology Cat♯8146 Rabbit anti-FLAG Cell Signaling Technology RRID: AB_2798687 Rabbit polyclonal anti-BSM Eurogentec custom antibody Alexa Fluor 488 Recombinant Rabbit Monoclonal Antibody Invitrogen A11008 Alexa Fluor 488 Recombinant Mouse Monoclonal Antibody Invitrogen A11001 Alexa Fluor 594 Recombinant Rabbit Monoclonal Antibody Invitrogen A11012 Alexa Fluor 594 Recombinant Mouse Monoclonal Antibody Invitrogen A11005 Anti-Mouse IgG, AP Conjugate Promega S3721 Anti-Rabbit IgG, AP Conjugate Promega S3731 Anti-His-tag chimeric human monoclonal antibody Sigma-Aldrich SAB5600096 Anti-Mouse IgG (Fc specific)–Peroxidase antibody Sigma-Aldrich Cat# A0168 Anti-Human IgG (Fc specific)−Peroxidase antibody Sigma-Aldrich Cat# A0170 Oligonucleotides and other sequence-based reagents Oligonucleotide LIC-216140-Fwd Sigma-Aldrich TACTTCCAATCCAATTTAGCtccgaagaccatccatgaatattcatgg Oligonucleotide LIC-216140-Rev Sigma-Aldrich TCCTCCACTTCCAATTTTAGCgccgtttatctcgaccacggatggcgg Oligonucleotide LIC-BSM-Fwd Sigma-Aldrich TACTTCCAATCCAATTTAGCgatgaattaccccacagtgtgtggac Oligonucleotide LIC-BSM-Rev Sigma-Aldrich TCCTCCACTTCCAATTTTAGCagctgtgtgagaatgctgccgctcgg Oligonucleotide BSM-CRISP1-Fwd Sigma-Aldrich AAGTTGATGATACTCACTGCAGCTCG Oligonucleotide BSM-CRISP1-Rev Sigma-Aldrich AAAACGAGCTGCAGTGAGTATCATCA Oligonucleotide BSM-REV1-screen Sigma-Aldrich GAGCTGCAGTGAGTATCATC Oligonucleotide BSM-CRISP2-Fwd Sigma-Aldrich AAGTTGGAGGAAACTTTCAGCAAAGG Oligonucleotide BSM-CRISP2-Rev Sigma-Aldrich AAAACCTTTGCTGAAAGTTTCCTCCA Oligonucleotide BSM-REV2-screen Sigma-Aldrich CTTTGCTGAAAGTTTCCTCC Chemicals, enzymes, and other reagents Dulbecco’s modified Eagle’s medium Invitrogen Cat# 12491015 Fetal Bovine Serum Gibco 10270106 HEPES Gibco Cat# 15630056 L-glutamine Gibco 25030123 Pénicilline-streptomycine Gibco 15070063 Hank’s Balanced Salt Solution Gibco Cat# 14025-050 3-indoleacetic acid Sigma-Aldrich Cat# 45533 © The Author(s) EMBO Molecular Medicine 15 D ow nloaded from https://w w w .em bopress.org on M ay 22, 2025 from IP 66.96.225.158. .. Reagent/resource Reference or source Identifier or catalog number FR235222 Antunes et al, 2024 DMSO Sigma-Aldrich D2438 Bovine serum albumin Sigma-Aldrich A7030 Hoechst 33342 solution Invitrogen Cat# H1399 Complete EDTA free Roche 05056489001 NBT/BCIP 1-Step Thermo Fisher Scientific Cat# 34042 Coomassie blue R-250 Sigma-Aldrich (MERK) 1.12553.0025 TRIzol Thermo Fisher Scientific Cat# 15596026 Pyrimethamine Sigma-Aldrich (MERK) 46706 ESF921 media Expression System Cat # 96-001-01 Benzonase MERK Millipore Cat # 70746 Ni-NTA resin Qiagen Cat# 30210 SuperBlock blocking buffer Thermo Fisher Scientific Cat# 37515 Recombinant protein A/G peroxidase conjugated Thermo Fisher Scientific Cat# 32490 TMB Substrate Thermo Fisher Scientific Cat# 34029 Software ZEN 2 lite 9 Carl Zeiss GraphPad Prism 8 https://www.graphpad.com/features Xcalibur 2.8 Thermo Fisher Scientific Mascot v2.8.3 Matrix Science Proline v2.2.0 ProFI Proteomics Astra Wyatt Technologies FastQC www.bioinformatics.babraham.ac.uk/projects/ fastqc/ MultiQC Seqera iDEP.96 http://bioinformatics.sdstate.edu/idep96/ Minimap2 https://github.com/lh3/minimap2 GuppY v4.09 Integrated Genome Browser (IGB) v9.1.8 https://www.bioviz.org/ Deeptools v3.5.1 https://deeptools.readthedocs.io/en/3.5.2/ index.html BOWTIE2 software (V2.1.0) https://github.com/ MACS v2.2 https://github.com/ nf-core Chip-Seq v2.0.0 https://github.com/ Samtools v1.4 https://www.htslib.org/ Bamtools v2.5.1 https://github.com/ Other QiAamp DNA mini kit Qiagen Cat# 51304 TaqManTM MicroRNA Reverse Transcription Kit Applied Biosystems Cat# 4366596 ABI 7500 real-time PCR system Applied Biosystems Ultimate 3000 RSLCnano Thermo Fisher Scientific Q-Exactive Plus Thermo Fisher Scientific BTX ECM 630 Harvard Apparatus ӒKTA pureTM chromatography system Cytiva 16 EMBO Molecular Medicine © The Author(s) D ow nloaded from https://w w w .em bopress.org on M ay 22, 2025 from IP 66.96.225.158. .. Parasites and human cell culture Human primary fibroblasts (HFFs, ATCC® CCL-171TM) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Invitrogen), 10 mM (4-(2-hydroxyethyl)-1-piperazine ethane sulphonic acid) (HEPES) buffer pH 7.2, 2 mM L-glutamine, and 50 μg/mL of penicillin and streptomycin (Invitrogen).

    Real-time Polymerase Chain Reaction:

    Article Title: Uncovering biomarkers for chronic toxoplasmosis detection highlights alternative pathways shaping parasite dormancy.
    Article Snippet: D. Soldati Mouse anti-HA Roche RRID: AB_2314622 Rabbit anti-HA Cell Signaling Technology RRID: AB_1549585 Rabbit polyclonal anti-QRS Antunes et al, 2024 Rabbit polyclonal anti-BCLA Dard et al, 2021 Mouse anti-FLAG Cell Signaling Technology Cat♯8146 Rabbit anti-FLAG Cell Signaling Technology RRID: AB_2798687 Rabbit polyclonal anti-BSM Eurogentec custom antibody Alexa Fluor 488 Recombinant Rabbit Monoclonal Antibody Invitrogen A11008 Alexa Fluor 488 Recombinant Mouse Monoclonal Antibody Invitrogen A11001 Alexa Fluor 594 Recombinant Rabbit Monoclonal Antibody Invitrogen A11012 Alexa Fluor 594 Recombinant Mouse Monoclonal Antibody Invitrogen A11005 Anti-Mouse IgG, AP Conjugate Promega S3721 Anti-Rabbit IgG, AP Conjugate Promega S3731 Anti-His-tag chimeric human monoclonal antibody Sigma-Aldrich SAB5600096 Anti-Mouse IgG (Fc specific)–Peroxidase antibody Sigma-Aldrich Cat# A0168 Anti-Human IgG (Fc specific)−Peroxidase antibody Sigma-Aldrich Cat# A0170 Oligonucleotides and other sequence-based reagents Oligonucleotide LIC-216140-Fwd Sigma-Aldrich TACTTCCAATCCAATTTAGCtccgaagaccatccatgaatattcatgg Oligonucleotide LIC-216140-Rev Sigma-Aldrich TCCTCCACTTCCAATTTTAGCgccgtttatctcgaccacggatggcgg Oligonucleotide LIC-BSM-Fwd Sigma-Aldrich TACTTCCAATCCAATTTAGCgatgaattaccccacagtgtgtggac Oligonucleotide LIC-BSM-Rev Sigma-Aldrich TCCTCCACTTCCAATTTTAGCagctgtgtgagaatgctgccgctcgg Oligonucleotide BSM-CRISP1-Fwd Sigma-Aldrich AAGTTGATGATACTCACTGCAGCTCG Oligonucleotide BSM-CRISP1-Rev Sigma-Aldrich AAAACGAGCTGCAGTGAGTATCATCA Oligonucleotide BSM-REV1-screen Sigma-Aldrich GAGCTGCAGTGAGTATCATC Oligonucleotide BSM-CRISP2-Fwd Sigma-Aldrich AAGTTGGAGGAAACTTTCAGCAAAGG Oligonucleotide BSM-CRISP2-Rev Sigma-Aldrich AAAACCTTTGCTGAAAGTTTCCTCCA Oligonucleotide BSM-REV2-screen Sigma-Aldrich CTTTGCTGAAAGTTTCCTCC Chemicals, enzymes, and other reagents Dulbecco’s modified Eagle’s medium Invitrogen Cat# 12491015 Fetal Bovine Serum Gibco 10270106 HEPES Gibco Cat# 15630056 L-glutamine Gibco 25030123 Pénicilline-streptomycine Gibco 15070063 Hank’s Balanced Salt Solution Gibco Cat# 14025-050 3-indoleacetic acid Sigma-Aldrich Cat# 45533 © The Author(s) EMBO Molecular Medicine 15 D ow nloaded from https://w w w .em bopress.org on M ay 22, 2025 from IP 66.96.225.158. .. Reagent/resource Reference or source Identifier or catalog number FR235222 Antunes et al, 2024 DMSO Sigma-Aldrich D2438 Bovine serum albumin Sigma-Aldrich A7030 Hoechst 33342 solution Invitrogen Cat# H1399 Complete EDTA free Roche 05056489001 NBT/BCIP 1-Step Thermo Fisher Scientific Cat# 34042 Coomassie blue R-250 Sigma-Aldrich (MERK) 1.12553.0025 TRIzol Thermo Fisher Scientific Cat# 15596026 Pyrimethamine Sigma-Aldrich (MERK) 46706 ESF921 media Expression System Cat # 96-001-01 Benzonase MERK Millipore Cat # 70746 Ni-NTA resin Qiagen Cat# 30210 SuperBlock blocking buffer Thermo Fisher Scientific Cat# 37515 Recombinant protein A/G peroxidase conjugated Thermo Fisher Scientific Cat# 32490 TMB Substrate Thermo Fisher Scientific Cat# 34029 Software ZEN 2 lite 9 Carl Zeiss GraphPad Prism 8 https://www.graphpad.com/features Xcalibur 2.8 Thermo Fisher Scientific Mascot v2.8.3 Matrix Science Proline v2.2.0 ProFI Proteomics Astra Wyatt Technologies FastQC www.bioinformatics.babraham.ac.uk/projects/ fastqc/ MultiQC Seqera iDEP.96 http://bioinformatics.sdstate.edu/idep96/ Minimap2 https://github.com/lh3/minimap2 GuppY v4.09 Integrated Genome Browser (IGB) v9.1.8 https://www.bioviz.org/ Deeptools v3.5.1 https://deeptools.readthedocs.io/en/3.5.2/ index.html BOWTIE2 software (V2.1.0) https://github.com/ MACS v2.2 https://github.com/ nf-core Chip-Seq v2.0.0 https://github.com/ Samtools v1.4 https://www.htslib.org/ Bamtools v2.5.1 https://github.com/ Other QiAamp DNA mini kit Qiagen Cat# 51304 TaqManTM MicroRNA Reverse Transcription Kit Applied Biosystems Cat# 4366596 ABI 7500 real-time PCR system Applied Biosystems Ultimate 3000 RSLCnano Thermo Fisher Scientific Q-Exactive Plus Thermo Fisher Scientific BTX ECM 630 Harvard Apparatus ӒKTA pureTM chromatography system Cytiva 16 EMBO Molecular Medicine © The Author(s) D ow nloaded from https://w w w .em bopress.org on M ay 22, 2025 from IP 66.96.225.158. .. Parasites and human cell culture Human primary fibroblasts (HFFs, ATCC® CCL-171TM) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Invitrogen), 10 mM (4-(2-hydroxyethyl)-1-piperazine ethane sulphonic acid) (HEPES) buffer pH 7.2, 2 mM L-glutamine, and 50 μg/mL of penicillin and streptomycin (Invitrogen).

    Chromatography:

    Article Title: Uncovering biomarkers for chronic toxoplasmosis detection highlights alternative pathways shaping parasite dormancy.
    Article Snippet: D. Soldati Mouse anti-HA Roche RRID: AB_2314622 Rabbit anti-HA Cell Signaling Technology RRID: AB_1549585 Rabbit polyclonal anti-QRS Antunes et al, 2024 Rabbit polyclonal anti-BCLA Dard et al, 2021 Mouse anti-FLAG Cell Signaling Technology Cat♯8146 Rabbit anti-FLAG Cell Signaling Technology RRID: AB_2798687 Rabbit polyclonal anti-BSM Eurogentec custom antibody Alexa Fluor 488 Recombinant Rabbit Monoclonal Antibody Invitrogen A11008 Alexa Fluor 488 Recombinant Mouse Monoclonal Antibody Invitrogen A11001 Alexa Fluor 594 Recombinant Rabbit Monoclonal Antibody Invitrogen A11012 Alexa Fluor 594 Recombinant Mouse Monoclonal Antibody Invitrogen A11005 Anti-Mouse IgG, AP Conjugate Promega S3721 Anti-Rabbit IgG, AP Conjugate Promega S3731 Anti-His-tag chimeric human monoclonal antibody Sigma-Aldrich SAB5600096 Anti-Mouse IgG (Fc specific)–Peroxidase antibody Sigma-Aldrich Cat# A0168 Anti-Human IgG (Fc specific)−Peroxidase antibody Sigma-Aldrich Cat# A0170 Oligonucleotides and other sequence-based reagents Oligonucleotide LIC-216140-Fwd Sigma-Aldrich TACTTCCAATCCAATTTAGCtccgaagaccatccatgaatattcatgg Oligonucleotide LIC-216140-Rev Sigma-Aldrich TCCTCCACTTCCAATTTTAGCgccgtttatctcgaccacggatggcgg Oligonucleotide LIC-BSM-Fwd Sigma-Aldrich TACTTCCAATCCAATTTAGCgatgaattaccccacagtgtgtggac Oligonucleotide LIC-BSM-Rev Sigma-Aldrich TCCTCCACTTCCAATTTTAGCagctgtgtgagaatgctgccgctcgg Oligonucleotide BSM-CRISP1-Fwd Sigma-Aldrich AAGTTGATGATACTCACTGCAGCTCG Oligonucleotide BSM-CRISP1-Rev Sigma-Aldrich AAAACGAGCTGCAGTGAGTATCATCA Oligonucleotide BSM-REV1-screen Sigma-Aldrich GAGCTGCAGTGAGTATCATC Oligonucleotide BSM-CRISP2-Fwd Sigma-Aldrich AAGTTGGAGGAAACTTTCAGCAAAGG Oligonucleotide BSM-CRISP2-Rev Sigma-Aldrich AAAACCTTTGCTGAAAGTTTCCTCCA Oligonucleotide BSM-REV2-screen Sigma-Aldrich CTTTGCTGAAAGTTTCCTCC Chemicals, enzymes, and other reagents Dulbecco’s modified Eagle’s medium Invitrogen Cat# 12491015 Fetal Bovine Serum Gibco 10270106 HEPES Gibco Cat# 15630056 L-glutamine Gibco 25030123 Pénicilline-streptomycine Gibco 15070063 Hank’s Balanced Salt Solution Gibco Cat# 14025-050 3-indoleacetic acid Sigma-Aldrich Cat# 45533 © The Author(s) EMBO Molecular Medicine 15 D ow nloaded from https://w w w .em bopress.org on M ay 22, 2025 from IP 66.96.225.158. .. Reagent/resource Reference or source Identifier or catalog number FR235222 Antunes et al, 2024 DMSO Sigma-Aldrich D2438 Bovine serum albumin Sigma-Aldrich A7030 Hoechst 33342 solution Invitrogen Cat# H1399 Complete EDTA free Roche 05056489001 NBT/BCIP 1-Step Thermo Fisher Scientific Cat# 34042 Coomassie blue R-250 Sigma-Aldrich (MERK) 1.12553.0025 TRIzol Thermo Fisher Scientific Cat# 15596026 Pyrimethamine Sigma-Aldrich (MERK) 46706 ESF921 media Expression System Cat # 96-001-01 Benzonase MERK Millipore Cat # 70746 Ni-NTA resin Qiagen Cat# 30210 SuperBlock blocking buffer Thermo Fisher Scientific Cat# 37515 Recombinant protein A/G peroxidase conjugated Thermo Fisher Scientific Cat# 32490 TMB Substrate Thermo Fisher Scientific Cat# 34029 Software ZEN 2 lite 9 Carl Zeiss GraphPad Prism 8 https://www.graphpad.com/features Xcalibur 2.8 Thermo Fisher Scientific Mascot v2.8.3 Matrix Science Proline v2.2.0 ProFI Proteomics Astra Wyatt Technologies FastQC www.bioinformatics.babraham.ac.uk/projects/ fastqc/ MultiQC Seqera iDEP.96 http://bioinformatics.sdstate.edu/idep96/ Minimap2 https://github.com/lh3/minimap2 GuppY v4.09 Integrated Genome Browser (IGB) v9.1.8 https://www.bioviz.org/ Deeptools v3.5.1 https://deeptools.readthedocs.io/en/3.5.2/ index.html BOWTIE2 software (V2.1.0) https://github.com/ MACS v2.2 https://github.com/ nf-core Chip-Seq v2.0.0 https://github.com/ Samtools v1.4 https://www.htslib.org/ Bamtools v2.5.1 https://github.com/ Other QiAamp DNA mini kit Qiagen Cat# 51304 TaqManTM MicroRNA Reverse Transcription Kit Applied Biosystems Cat# 4366596 ABI 7500 real-time PCR system Applied Biosystems Ultimate 3000 RSLCnano Thermo Fisher Scientific Q-Exactive Plus Thermo Fisher Scientific BTX ECM 630 Harvard Apparatus ӒKTA pureTM chromatography system Cytiva 16 EMBO Molecular Medicine © The Author(s) D ow nloaded from https://w w w .em bopress.org on M ay 22, 2025 from IP 66.96.225.158. .. Parasites and human cell culture Human primary fibroblasts (HFFs, ATCC® CCL-171TM) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Invitrogen), 10 mM (4-(2-hydroxyethyl)-1-piperazine ethane sulphonic acid) (HEPES) buffer pH 7.2, 2 mM L-glutamine, and 50 μg/mL of penicillin and streptomycin (Invitrogen).



    Similar Products

    processing module in chenomx nmr suite 8.1 software  (Chenomx Inc)
    90
    Chenomx Inc processing module in chenomx nmr suite 8.1 software
    Processing Module In Chenomx Nmr Suite 8.1 Software, supplied by Chenomx Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software+processing+module/processing+module+chenomx+nmr+suite+8+1/pm40192930-58-12-15
    Average 90 stars, based on 1 article reviews
    processing module in chenomx nmr suite 8.1 software - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    zen software tile scanning module  (Carl Zeiss)
    94
    Carl Zeiss zen software tile scanning module
    Zen Software Tile Scanning Module, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software+processing+module/bio_rxiv__2025__02__20__639284-212-29-28
    Average 94 stars, based on 1 article reviews
    zen software tile scanning module - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    zen lite 3 8 image processing software  (Carl Zeiss)
    96
    Carl Zeiss zen lite 3 8 image processing software
    Zen Lite 3 8 Image Processing Software, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software+processing+module/10__1002_slash_admt__202401204-371-3-9
    Average 96 stars, based on 1 article reviews
    zen lite 3 8 image processing software - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    ptr module of the tofware post-processing software  (Tofwerk AG)
    90
    Tofwerk AG ptr module of the tofware post-processing software
    Ptr Module Of The Tofware Post Processing Software, supplied by Tofwerk AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software+processing+module/ptr+module+of+the+tofware+post+processing+software/pm39521289-68-9-18
    Average 90 stars, based on 1 article reviews
    ptr module of the tofware post-processing software - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    digital imaging processing software 3d module version 2.4 kodak dental imaging software  (Kodak)
    90
    Kodak digital imaging processing software 3d module version 2.4 kodak dental imaging software
    Digital Imaging Processing Software 3d Module Version 2.4 Kodak Dental Imaging Software, supplied by Kodak, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software+processing+module/integrated+image+processing+software+kodak+dental+imaging+software+3d+module+v2+4/pmc11595794-112-15-23
    Average 90 stars, based on 1 article reviews
    digital imaging processing software 3d module version 2.4 kodak dental imaging software - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    zen lite 2012 image processing software  (Carl Zeiss)
    96
    Carl Zeiss zen lite 2012 image processing software
    Zen Lite 2012 Image Processing Software, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software+processing+module/10__1016_slash_j__ifset__2024__103745-105-22-28
    Average 96 stars, based on 1 article reviews
    zen lite 2012 image processing software - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    zeiss image processing software  (Carl Zeiss)
    95
    Carl Zeiss zeiss image processing software
    Zeiss Image Processing Software, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software+processing+module/ZEN+Module+Image+Analysis/pmc12203386-87-35-43
    Average 95 stars, based on 1 article reviews
    zeiss image processing software - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    zen lite 3 4 9 software image processing computer software  (Carl Zeiss)
    96
    Carl Zeiss zen lite 3 4 9 software image processing computer software
    Zen Lite 3 4 9 Software Image Processing Computer Software, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software+processing+module/pmc10942853-93-17-28
    Average 96 stars, based on 1 article reviews
    zen lite 3 4 9 software image processing computer software - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    module of epitools 2.1.6 image processing software  (MathWorks Inc)
    90
    MathWorks Inc module of epitools 2.1.6 image processing software
    Module Of Epitools 2.1.6 Image Processing Software, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software+processing+module/pmc10815341-147-11-6
    Average 90 stars, based on 1 article reviews
    module of epitools 2.1.6 image processing software - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    processing module of keyence software  (KEYENCE)
    90
    KEYENCE processing module of keyence software
    Processing Module Of Keyence Software, supplied by KEYENCE, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/software+processing+module/processing+module+of+keyence+software/pmc10761119-455-25-28
    Average 90 stars, based on 1 article reviews
    processing module of keyence software - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results