Review



pgl3basic vectors  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Promega pgl3basic vectors
    Pgl3basic Vectors, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3basic+vector/pgl3+basic/pm40253379-413-25-27
    Average 90 stars, based on 1 article reviews
    pgl3basic vectors - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Luciferase:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    Activity Assay:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    Plasmid Preparation:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    Control:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    other:

    Article Title:
    Article Snippet: The plasmids for enhancer activity analysis were generated from pNL1.1 (Promega, N1001) (Supplemental Fig. S9B), and the plasmid served as the internal reference was generated from pGL4.10 (Promega, E6651) by insert a promoter of BmNPV ie-1 before luc2 (Supplemental Fig. S9A), which enables stable expression of the reference luciferase in BmN cells.

    Article Title: Egr-1 promotes the proliferation and migration of vascular smooth muscle cells by transcriptionally activating Egr-2 in arteriovenous fistulas
    Article Snippet: Rat EGR1 promoter (~1.3 Kb; PCR-amplified from rat VSMCs) cloned into pGL3-basic luciferase rep plasmid (Promega Corporation) to form EGR1 luciferase reporters.

    Article Title: Folie 1
    Article Snippet: Vendor Bulk anti-TGFB1,2,3 In Vivo 1D11.1 Human, Mouse, Bovine, Chicken Mouse IgG1 10μg/gBW AB_292143 6 Ichorbio Mouse IgG1 Isotype Control HKSP - Mouse IgG1 10μg/gBW AB_292138 2 Ichorbio Anti-mouse CD8 in vivo YTS169 Mouse Rat IgG2b 12,5μg/g BW AB_292144 5 Ichorbio Anti-mouse CD4 in vivo GK1.5 Mouse Rat IgG2b 12,5μg/g BW AB_292144 4 Ichorbio Rat IgG2b Isotype Control in vivo 1-2 - Rat IgG2b 12,5μg/g BW AB_292137 8 Ichorbio Supplementary Table S3: Primers used for RT-qPCR Target gene Direction Sequence (5’3’) GC [%] Length TM hu-TGF-β1 Fwd ATTCCTGGCGATACCTCAGC 55 20 59,4 hu-TGF-β1 Rev CGGTAGTGAACCCGTTGATG 55 20 59,4 hu-GAPDH Fwd GTCAGTGGTGGACCTGACCT 60 20 61,4 hu-GAPDH Rev TGAGCTTGACAAAGTGGTCG 50 20 57,3 Supplementary Table S4: Expression vectors Name Backbone Insert (cDNA) Selection marker RRID/parentage pMIG pMSCV empty IRES-GFP RRID:Addgene_ 9044 pMIG-CALRWT pMSCV Human CALRWT IRES-GFP Provided by Ann Mullally pMIG-CALRins5 pMSCV Human CALRins5 IRES-GFP Provided by Ann Mullally 9 pMIG-CALRdel52 pMSCV Human CALRdel52 IRES-GFP Provided by Ann Mullally pMSCV-MPL pMSCV Human MPL PKG- hygromycin resistance gene Provided by Ann Mullally pMIG-JAK2WT pMSCV Human JAK2WT IRES-GFP Provided by Justus Duyster pMIG-JAK2V617F pMSCV Human JAK2V617F IRES-GFP Provided by Justus Duyster pMSCV-EpoR pMSCV Human EPOR neomycin resistance gene In-house pMIG-STAT3WT pMX Human STAT3WT IRES-GFP In-house pMIGSTAT3V640F pMX Human STAT3V640F IRES-GFP In-house pGL4.73[ hRluc/SV40] pGL4 SV40 early enhancer, rRluc renilla luciferase Promega (E691A) pGL3-TGFb1 pGL3 Human TGFb1 promoter luciferase RRID:Addgene_ 101762 References: 1.

    Article Title:
    Article Snippet: RIG-I ubiquitination assays Purification of GST-RIG-I 2CARD from mammalian cells was done as previously described (8, 11). pEBGRIG-I 2CARD (4 μg) and pcDNA4 carrying indicated gene or pCAGGS-NS1 (Influenza A virus, 10 μg) (7) and pGL4.45[luc2P/ISRE/Hygro] (Promega) (100 ng) were transfected with Mirus TransIT-LT1 into 5x106 HEK293T cells in a 10 cm2 dish in DMEM high glucose with 5% FBS per manufacturer guidelines.

    Article Title:
    Article Snippet: The constructed pGL3-ELO11 reporter plasmid was cotransfected 211 with the pac-dsxM or pac-dsxF expression plasmid by FuGENE HD Transfection Reagent 212 (Promega) into Sf9 cells.

    Article Title:
    Article Snippet: A total of 24 h after gene KD in 6-well culture plates, 2 μg TOPFlash and 0.5 μg pRL (Promega, E2261) plasmids were transfected into SH-SY5Y cells (7.5×105) using FuGENE HD Transfection Reagent (Promega).

    Article Title:
    Article Snippet: A total of 2 μg of DKK1 promoter and 0.5 μg of pRL (Promega, E2261) plasmids were transfected into SH-SY5Y cells (7.5×105) using FuGENE HD Transfection Reagent (Promega) in a 6-well culture plate.



    Similar Products

    renilla luciferase reporter vectors  (Addgene inc)
    93
    Addgene inc renilla luciferase reporter vectors
    Piezo1 suppresses Lcn2 expression and secretion via the inhibition of Ccl2-evoked NF-κB activation. BMMSCs were isolated from femurs and tibias of 10-week-old male PDGFRα-Piezo1 KO mice and WT controls. a Gene expression of Ccr2 in BMMSCs, as determined by real-time PCR. b–g Recombinant mouse Ccl2 protein (rmCcl2, 100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) was added to the adipogenic and osteogenic induction medium during BMMSC differentiation. The expression levels of osteogenic genes ( b–d ) and adipogenic genes ( e–g ) were determined via real-time qPCR. h–n WT and KO BMMSCs were treated with rmCcl2 (100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) for 24 h. h Sonicated BMMSCs were subjected to chromatin immunoprecipitation (ChIP) using an anti-p65 antibody. The ChIP DNA samples were then subjected to qPCR amplification using specific primers against the promoter region of Lcn2, as shown in supplementary Fig. . Representative gel images of end-point ChIP-qPCR products are shown. i Quantitative results are shown as the percentage of input DNA: % of Input = 2^(CT Input −CT IP )/dilution factor × 100%. j <t>Luciferase</t> reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Lcn2 promoter (Lcn2-WT) or the mutated Lcn2 promoter with mutations in the NF-κB binding motif (Lcn2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to <t>Renilla</t> luciferase activity. k Schematic diagram illustrating the actions of rmCcl2, the CCR2 antagonist, and the NF-κB-specific inhibitor QNZ on NF-κB translocation and Lcn2 expression; created with BioRender ( https://BioRender.com ). l ELISA analysis of total p65 in the nucleus and cytoplasm of BMMSCs. m Representative immunofluorescence images of intracellular p65 localization. Nuclei were stained with DAPI (blue). Scale bar, 50 μm. n P65 nuclear translocation was quantified by ImageJ software via Pearson’s correlation coefficient (PCC) between the p65 immunofluorescence signal and DAPI staining across segmented nuclear regions. o , p WT and KO BMMSCs were treated with the NF-κB-specific inhibitor QNZ (10 nM) for another 2 h after 24-h treatment of rmCcl2 (100 ng/mL) and INCB3344 (10 nM). o The mRNA level of Lcn2 . p Lcn2 levels in the culture medium were determined by ELISA. q Illustration of how the AP-1 inhibitor modulates Ccl2 gene expression; created with BioRender ( https://BioRender.com ). r–u WT and KO BMMSCs were treated with the AP-1-specific inhibitor T-5224 (10 μM) for 24 h. r Sonicated BMMSCs were subjected to ChIP assay using an anti-c-Jun antibody. Representative gel images of end-point ChIP-qPCR products are shown. s Quantitative results are shown as the percentage of input DNA. t The mRNA level of Ccl2 . u Ccl2 levels in the culture medium were determined by ELISA. v Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Ccl2 promoter (Ccl2-WT) or the mutated Ccl2 promoter with mutations in the c-Jun binding motif (Ccl2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. n = 5 for each group. The data are presented as the means ± SEMs; * p < 0.05, ** p < 0.01, *** p < 0.001. See also supplementary Figs. –
    Renilla Luciferase Reporter Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3basic+vector/pGL3basic+luciferase+and+renilla_polyA+(Plasmid+%23128046)/pmc12559722-356-13-17
    Average 93 stars, based on 1 article reviews
    renilla luciferase reporter vectors - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    pgl3basic vectors  (Promega)
    90
    Promega pgl3basic vectors
    Piezo1 suppresses Lcn2 expression and secretion via the inhibition of Ccl2-evoked NF-κB activation. BMMSCs were isolated from femurs and tibias of 10-week-old male PDGFRα-Piezo1 KO mice and WT controls. a Gene expression of Ccr2 in BMMSCs, as determined by real-time PCR. b–g Recombinant mouse Ccl2 protein (rmCcl2, 100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) was added to the adipogenic and osteogenic induction medium during BMMSC differentiation. The expression levels of osteogenic genes ( b–d ) and adipogenic genes ( e–g ) were determined via real-time qPCR. h–n WT and KO BMMSCs were treated with rmCcl2 (100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) for 24 h. h Sonicated BMMSCs were subjected to chromatin immunoprecipitation (ChIP) using an anti-p65 antibody. The ChIP DNA samples were then subjected to qPCR amplification using specific primers against the promoter region of Lcn2, as shown in supplementary Fig. . Representative gel images of end-point ChIP-qPCR products are shown. i Quantitative results are shown as the percentage of input DNA: % of Input = 2^(CT Input −CT IP )/dilution factor × 100%. j <t>Luciferase</t> reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Lcn2 promoter (Lcn2-WT) or the mutated Lcn2 promoter with mutations in the NF-κB binding motif (Lcn2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to <t>Renilla</t> luciferase activity. k Schematic diagram illustrating the actions of rmCcl2, the CCR2 antagonist, and the NF-κB-specific inhibitor QNZ on NF-κB translocation and Lcn2 expression; created with BioRender ( https://BioRender.com ). l ELISA analysis of total p65 in the nucleus and cytoplasm of BMMSCs. m Representative immunofluorescence images of intracellular p65 localization. Nuclei were stained with DAPI (blue). Scale bar, 50 μm. n P65 nuclear translocation was quantified by ImageJ software via Pearson’s correlation coefficient (PCC) between the p65 immunofluorescence signal and DAPI staining across segmented nuclear regions. o , p WT and KO BMMSCs were treated with the NF-κB-specific inhibitor QNZ (10 nM) for another 2 h after 24-h treatment of rmCcl2 (100 ng/mL) and INCB3344 (10 nM). o The mRNA level of Lcn2 . p Lcn2 levels in the culture medium were determined by ELISA. q Illustration of how the AP-1 inhibitor modulates Ccl2 gene expression; created with BioRender ( https://BioRender.com ). r–u WT and KO BMMSCs were treated with the AP-1-specific inhibitor T-5224 (10 μM) for 24 h. r Sonicated BMMSCs were subjected to ChIP assay using an anti-c-Jun antibody. Representative gel images of end-point ChIP-qPCR products are shown. s Quantitative results are shown as the percentage of input DNA. t The mRNA level of Ccl2 . u Ccl2 levels in the culture medium were determined by ELISA. v Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Ccl2 promoter (Ccl2-WT) or the mutated Ccl2 promoter with mutations in the c-Jun binding motif (Ccl2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. n = 5 for each group. The data are presented as the means ± SEMs; * p < 0.05, ** p < 0.01, *** p < 0.001. See also supplementary Figs. –
    Pgl3basic Vectors, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3basic+vector/pgl3+basic/pm40253379-413-25-27
    Average 90 stars, based on 1 article reviews
    pgl3basic vectors - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    pgl3basic vector 212936 plasmid  (Addgene inc)
    93
    Addgene inc pgl3basic vector 212936 plasmid
    Piezo1 suppresses Lcn2 expression and secretion via the inhibition of Ccl2-evoked NF-κB activation. BMMSCs were isolated from femurs and tibias of 10-week-old male PDGFRα-Piezo1 KO mice and WT controls. a Gene expression of Ccr2 in BMMSCs, as determined by real-time PCR. b–g Recombinant mouse Ccl2 protein (rmCcl2, 100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) was added to the adipogenic and osteogenic induction medium during BMMSC differentiation. The expression levels of osteogenic genes ( b–d ) and adipogenic genes ( e–g ) were determined via real-time qPCR. h–n WT and KO BMMSCs were treated with rmCcl2 (100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) for 24 h. h Sonicated BMMSCs were subjected to chromatin immunoprecipitation (ChIP) using an anti-p65 antibody. The ChIP DNA samples were then subjected to qPCR amplification using specific primers against the promoter region of Lcn2, as shown in supplementary Fig. . Representative gel images of end-point ChIP-qPCR products are shown. i Quantitative results are shown as the percentage of input DNA: % of Input = 2^(CT Input −CT IP )/dilution factor × 100%. j <t>Luciferase</t> reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Lcn2 promoter (Lcn2-WT) or the mutated Lcn2 promoter with mutations in the NF-κB binding motif (Lcn2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to <t>Renilla</t> luciferase activity. k Schematic diagram illustrating the actions of rmCcl2, the CCR2 antagonist, and the NF-κB-specific inhibitor QNZ on NF-κB translocation and Lcn2 expression; created with BioRender ( https://BioRender.com ). l ELISA analysis of total p65 in the nucleus and cytoplasm of BMMSCs. m Representative immunofluorescence images of intracellular p65 localization. Nuclei were stained with DAPI (blue). Scale bar, 50 μm. n P65 nuclear translocation was quantified by ImageJ software via Pearson’s correlation coefficient (PCC) between the p65 immunofluorescence signal and DAPI staining across segmented nuclear regions. o , p WT and KO BMMSCs were treated with the NF-κB-specific inhibitor QNZ (10 nM) for another 2 h after 24-h treatment of rmCcl2 (100 ng/mL) and INCB3344 (10 nM). o The mRNA level of Lcn2 . p Lcn2 levels in the culture medium were determined by ELISA. q Illustration of how the AP-1 inhibitor modulates Ccl2 gene expression; created with BioRender ( https://BioRender.com ). r–u WT and KO BMMSCs were treated with the AP-1-specific inhibitor T-5224 (10 μM) for 24 h. r Sonicated BMMSCs were subjected to ChIP assay using an anti-c-Jun antibody. Representative gel images of end-point ChIP-qPCR products are shown. s Quantitative results are shown as the percentage of input DNA. t The mRNA level of Ccl2 . u Ccl2 levels in the culture medium were determined by ELISA. v Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Ccl2 promoter (Ccl2-WT) or the mutated Ccl2 promoter with mutations in the c-Jun binding motif (Ccl2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. n = 5 for each group. The data are presented as the means ± SEMs; * p < 0.05, ** p < 0.01, *** p < 0.001. See also supplementary Figs. –
    Pgl3basic Vector 212936 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3basic+vector/pRF%2B275Dux4+(Plasmid+%2321293)/pm39568000-47-5-12
    Average 93 stars, based on 1 article reviews
    pgl3basic vector 212936 plasmid - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    pgl3basic vector  (Promega)
    90
    Promega pgl3basic vector
    Piezo1 suppresses Lcn2 expression and secretion via the inhibition of Ccl2-evoked NF-κB activation. BMMSCs were isolated from femurs and tibias of 10-week-old male PDGFRα-Piezo1 KO mice and WT controls. a Gene expression of Ccr2 in BMMSCs, as determined by real-time PCR. b–g Recombinant mouse Ccl2 protein (rmCcl2, 100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) was added to the adipogenic and osteogenic induction medium during BMMSC differentiation. The expression levels of osteogenic genes ( b–d ) and adipogenic genes ( e–g ) were determined via real-time qPCR. h–n WT and KO BMMSCs were treated with rmCcl2 (100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) for 24 h. h Sonicated BMMSCs were subjected to chromatin immunoprecipitation (ChIP) using an anti-p65 antibody. The ChIP DNA samples were then subjected to qPCR amplification using specific primers against the promoter region of Lcn2, as shown in supplementary Fig. . Representative gel images of end-point ChIP-qPCR products are shown. i Quantitative results are shown as the percentage of input DNA: % of Input = 2^(CT Input −CT IP )/dilution factor × 100%. j <t>Luciferase</t> reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Lcn2 promoter (Lcn2-WT) or the mutated Lcn2 promoter with mutations in the NF-κB binding motif (Lcn2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to <t>Renilla</t> luciferase activity. k Schematic diagram illustrating the actions of rmCcl2, the CCR2 antagonist, and the NF-κB-specific inhibitor QNZ on NF-κB translocation and Lcn2 expression; created with BioRender ( https://BioRender.com ). l ELISA analysis of total p65 in the nucleus and cytoplasm of BMMSCs. m Representative immunofluorescence images of intracellular p65 localization. Nuclei were stained with DAPI (blue). Scale bar, 50 μm. n P65 nuclear translocation was quantified by ImageJ software via Pearson’s correlation coefficient (PCC) between the p65 immunofluorescence signal and DAPI staining across segmented nuclear regions. o , p WT and KO BMMSCs were treated with the NF-κB-specific inhibitor QNZ (10 nM) for another 2 h after 24-h treatment of rmCcl2 (100 ng/mL) and INCB3344 (10 nM). o The mRNA level of Lcn2 . p Lcn2 levels in the culture medium were determined by ELISA. q Illustration of how the AP-1 inhibitor modulates Ccl2 gene expression; created with BioRender ( https://BioRender.com ). r–u WT and KO BMMSCs were treated with the AP-1-specific inhibitor T-5224 (10 μM) for 24 h. r Sonicated BMMSCs were subjected to ChIP assay using an anti-c-Jun antibody. Representative gel images of end-point ChIP-qPCR products are shown. s Quantitative results are shown as the percentage of input DNA. t The mRNA level of Ccl2 . u Ccl2 levels in the culture medium were determined by ELISA. v Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Ccl2 promoter (Ccl2-WT) or the mutated Ccl2 promoter with mutations in the c-Jun binding motif (Ccl2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. n = 5 for each group. The data are presented as the means ± SEMs; * p < 0.05, ** p < 0.01, *** p < 0.001. See also supplementary Figs. –
    Pgl3basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3basic+vector/pgl3+basic/pm39009095-116-8-10
    Average 90 stars, based on 1 article reviews
    pgl3basic vector - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    dual-luciferase reporter vector pgl3basic  (Promega)
    90
    Promega dual-luciferase reporter vector pgl3basic
    Piezo1 suppresses Lcn2 expression and secretion via the inhibition of Ccl2-evoked NF-κB activation. BMMSCs were isolated from femurs and tibias of 10-week-old male PDGFRα-Piezo1 KO mice and WT controls. a Gene expression of Ccr2 in BMMSCs, as determined by real-time PCR. b–g Recombinant mouse Ccl2 protein (rmCcl2, 100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) was added to the adipogenic and osteogenic induction medium during BMMSC differentiation. The expression levels of osteogenic genes ( b–d ) and adipogenic genes ( e–g ) were determined via real-time qPCR. h–n WT and KO BMMSCs were treated with rmCcl2 (100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) for 24 h. h Sonicated BMMSCs were subjected to chromatin immunoprecipitation (ChIP) using an anti-p65 antibody. The ChIP DNA samples were then subjected to qPCR amplification using specific primers against the promoter region of Lcn2, as shown in supplementary Fig. . Representative gel images of end-point ChIP-qPCR products are shown. i Quantitative results are shown as the percentage of input DNA: % of Input = 2^(CT Input −CT IP )/dilution factor × 100%. j <t>Luciferase</t> reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Lcn2 promoter (Lcn2-WT) or the mutated Lcn2 promoter with mutations in the NF-κB binding motif (Lcn2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to <t>Renilla</t> luciferase activity. k Schematic diagram illustrating the actions of rmCcl2, the CCR2 antagonist, and the NF-κB-specific inhibitor QNZ on NF-κB translocation and Lcn2 expression; created with BioRender ( https://BioRender.com ). l ELISA analysis of total p65 in the nucleus and cytoplasm of BMMSCs. m Representative immunofluorescence images of intracellular p65 localization. Nuclei were stained with DAPI (blue). Scale bar, 50 μm. n P65 nuclear translocation was quantified by ImageJ software via Pearson’s correlation coefficient (PCC) between the p65 immunofluorescence signal and DAPI staining across segmented nuclear regions. o , p WT and KO BMMSCs were treated with the NF-κB-specific inhibitor QNZ (10 nM) for another 2 h after 24-h treatment of rmCcl2 (100 ng/mL) and INCB3344 (10 nM). o The mRNA level of Lcn2 . p Lcn2 levels in the culture medium were determined by ELISA. q Illustration of how the AP-1 inhibitor modulates Ccl2 gene expression; created with BioRender ( https://BioRender.com ). r–u WT and KO BMMSCs were treated with the AP-1-specific inhibitor T-5224 (10 μM) for 24 h. r Sonicated BMMSCs were subjected to ChIP assay using an anti-c-Jun antibody. Representative gel images of end-point ChIP-qPCR products are shown. s Quantitative results are shown as the percentage of input DNA. t The mRNA level of Ccl2 . u Ccl2 levels in the culture medium were determined by ELISA. v Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Ccl2 promoter (Ccl2-WT) or the mutated Ccl2 promoter with mutations in the c-Jun binding motif (Ccl2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. n = 5 for each group. The data are presented as the means ± SEMs; * p < 0.05, ** p < 0.01, *** p < 0.001. See also supplementary Figs. –
    Dual Luciferase Reporter Vector Pgl3basic, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3basic+vector/pgl3+basic/pm38763227-52-13-17
    Average 90 stars, based on 1 article reviews
    dual-luciferase reporter vector pgl3basic - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    pgl3basic luciferase reporter vector  (Promega)
    90
    Promega pgl3basic luciferase reporter vector
    Piezo1 suppresses Lcn2 expression and secretion via the inhibition of Ccl2-evoked NF-κB activation. BMMSCs were isolated from femurs and tibias of 10-week-old male PDGFRα-Piezo1 KO mice and WT controls. a Gene expression of Ccr2 in BMMSCs, as determined by real-time PCR. b–g Recombinant mouse Ccl2 protein (rmCcl2, 100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) was added to the adipogenic and osteogenic induction medium during BMMSC differentiation. The expression levels of osteogenic genes ( b–d ) and adipogenic genes ( e–g ) were determined via real-time qPCR. h–n WT and KO BMMSCs were treated with rmCcl2 (100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) for 24 h. h Sonicated BMMSCs were subjected to chromatin immunoprecipitation (ChIP) using an anti-p65 antibody. The ChIP DNA samples were then subjected to qPCR amplification using specific primers against the promoter region of Lcn2, as shown in supplementary Fig. . Representative gel images of end-point ChIP-qPCR products are shown. i Quantitative results are shown as the percentage of input DNA: % of Input = 2^(CT Input −CT IP )/dilution factor × 100%. j <t>Luciferase</t> reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Lcn2 promoter (Lcn2-WT) or the mutated Lcn2 promoter with mutations in the NF-κB binding motif (Lcn2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to <t>Renilla</t> luciferase activity. k Schematic diagram illustrating the actions of rmCcl2, the CCR2 antagonist, and the NF-κB-specific inhibitor QNZ on NF-κB translocation and Lcn2 expression; created with BioRender ( https://BioRender.com ). l ELISA analysis of total p65 in the nucleus and cytoplasm of BMMSCs. m Representative immunofluorescence images of intracellular p65 localization. Nuclei were stained with DAPI (blue). Scale bar, 50 μm. n P65 nuclear translocation was quantified by ImageJ software via Pearson’s correlation coefficient (PCC) between the p65 immunofluorescence signal and DAPI staining across segmented nuclear regions. o , p WT and KO BMMSCs were treated with the NF-κB-specific inhibitor QNZ (10 nM) for another 2 h after 24-h treatment of rmCcl2 (100 ng/mL) and INCB3344 (10 nM). o The mRNA level of Lcn2 . p Lcn2 levels in the culture medium were determined by ELISA. q Illustration of how the AP-1 inhibitor modulates Ccl2 gene expression; created with BioRender ( https://BioRender.com ). r–u WT and KO BMMSCs were treated with the AP-1-specific inhibitor T-5224 (10 μM) for 24 h. r Sonicated BMMSCs were subjected to ChIP assay using an anti-c-Jun antibody. Representative gel images of end-point ChIP-qPCR products are shown. s Quantitative results are shown as the percentage of input DNA. t The mRNA level of Ccl2 . u Ccl2 levels in the culture medium were determined by ELISA. v Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Ccl2 promoter (Ccl2-WT) or the mutated Ccl2 promoter with mutations in the c-Jun binding motif (Ccl2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. n = 5 for each group. The data are presented as the means ± SEMs; * p < 0.05, ** p < 0.01, *** p < 0.001. See also supplementary Figs. –
    Pgl3basic Luciferase Reporter Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3basic+vector/pgl3+basic/pm37957720-136-7-11
    Average 90 stars, based on 1 article reviews
    pgl3basic luciferase reporter vector - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Piezo1 suppresses Lcn2 expression and secretion via the inhibition of Ccl2-evoked NF-κB activation. BMMSCs were isolated from femurs and tibias of 10-week-old male PDGFRα-Piezo1 KO mice and WT controls. a Gene expression of Ccr2 in BMMSCs, as determined by real-time PCR. b–g Recombinant mouse Ccl2 protein (rmCcl2, 100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) was added to the adipogenic and osteogenic induction medium during BMMSC differentiation. The expression levels of osteogenic genes ( b–d ) and adipogenic genes ( e–g ) were determined via real-time qPCR. h–n WT and KO BMMSCs were treated with rmCcl2 (100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) for 24 h. h Sonicated BMMSCs were subjected to chromatin immunoprecipitation (ChIP) using an anti-p65 antibody. The ChIP DNA samples were then subjected to qPCR amplification using specific primers against the promoter region of Lcn2, as shown in supplementary Fig. . Representative gel images of end-point ChIP-qPCR products are shown. i Quantitative results are shown as the percentage of input DNA: % of Input = 2^(CT Input −CT IP )/dilution factor × 100%. j Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Lcn2 promoter (Lcn2-WT) or the mutated Lcn2 promoter with mutations in the NF-κB binding motif (Lcn2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. k Schematic diagram illustrating the actions of rmCcl2, the CCR2 antagonist, and the NF-κB-specific inhibitor QNZ on NF-κB translocation and Lcn2 expression; created with BioRender ( https://BioRender.com ). l ELISA analysis of total p65 in the nucleus and cytoplasm of BMMSCs. m Representative immunofluorescence images of intracellular p65 localization. Nuclei were stained with DAPI (blue). Scale bar, 50 μm. n P65 nuclear translocation was quantified by ImageJ software via Pearson’s correlation coefficient (PCC) between the p65 immunofluorescence signal and DAPI staining across segmented nuclear regions. o , p WT and KO BMMSCs were treated with the NF-κB-specific inhibitor QNZ (10 nM) for another 2 h after 24-h treatment of rmCcl2 (100 ng/mL) and INCB3344 (10 nM). o The mRNA level of Lcn2 . p Lcn2 levels in the culture medium were determined by ELISA. q Illustration of how the AP-1 inhibitor modulates Ccl2 gene expression; created with BioRender ( https://BioRender.com ). r–u WT and KO BMMSCs were treated with the AP-1-specific inhibitor T-5224 (10 μM) for 24 h. r Sonicated BMMSCs were subjected to ChIP assay using an anti-c-Jun antibody. Representative gel images of end-point ChIP-qPCR products are shown. s Quantitative results are shown as the percentage of input DNA. t The mRNA level of Ccl2 . u Ccl2 levels in the culture medium were determined by ELISA. v Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Ccl2 promoter (Ccl2-WT) or the mutated Ccl2 promoter with mutations in the c-Jun binding motif (Ccl2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. n = 5 for each group. The data are presented as the means ± SEMs; * p < 0.05, ** p < 0.01, *** p < 0.001. See also supplementary Figs. –

    Journal: Signal Transduction and Targeted Therapy

    Article Title: Piezo1 activation suppresses bone marrow adipogenesis to prevent osteoporosis by inhibiting a mechanoinflammatory autocrine loop

    doi: 10.1038/s41392-025-02455-w

    Figure Lengend Snippet: Piezo1 suppresses Lcn2 expression and secretion via the inhibition of Ccl2-evoked NF-κB activation. BMMSCs were isolated from femurs and tibias of 10-week-old male PDGFRα-Piezo1 KO mice and WT controls. a Gene expression of Ccr2 in BMMSCs, as determined by real-time PCR. b–g Recombinant mouse Ccl2 protein (rmCcl2, 100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) was added to the adipogenic and osteogenic induction medium during BMMSC differentiation. The expression levels of osteogenic genes ( b–d ) and adipogenic genes ( e–g ) were determined via real-time qPCR. h–n WT and KO BMMSCs were treated with rmCcl2 (100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) for 24 h. h Sonicated BMMSCs were subjected to chromatin immunoprecipitation (ChIP) using an anti-p65 antibody. The ChIP DNA samples were then subjected to qPCR amplification using specific primers against the promoter region of Lcn2, as shown in supplementary Fig. . Representative gel images of end-point ChIP-qPCR products are shown. i Quantitative results are shown as the percentage of input DNA: % of Input = 2^(CT Input −CT IP )/dilution factor × 100%. j Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Lcn2 promoter (Lcn2-WT) or the mutated Lcn2 promoter with mutations in the NF-κB binding motif (Lcn2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. k Schematic diagram illustrating the actions of rmCcl2, the CCR2 antagonist, and the NF-κB-specific inhibitor QNZ on NF-κB translocation and Lcn2 expression; created with BioRender ( https://BioRender.com ). l ELISA analysis of total p65 in the nucleus and cytoplasm of BMMSCs. m Representative immunofluorescence images of intracellular p65 localization. Nuclei were stained with DAPI (blue). Scale bar, 50 μm. n P65 nuclear translocation was quantified by ImageJ software via Pearson’s correlation coefficient (PCC) between the p65 immunofluorescence signal and DAPI staining across segmented nuclear regions. o , p WT and KO BMMSCs were treated with the NF-κB-specific inhibitor QNZ (10 nM) for another 2 h after 24-h treatment of rmCcl2 (100 ng/mL) and INCB3344 (10 nM). o The mRNA level of Lcn2 . p Lcn2 levels in the culture medium were determined by ELISA. q Illustration of how the AP-1 inhibitor modulates Ccl2 gene expression; created with BioRender ( https://BioRender.com ). r–u WT and KO BMMSCs were treated with the AP-1-specific inhibitor T-5224 (10 μM) for 24 h. r Sonicated BMMSCs were subjected to ChIP assay using an anti-c-Jun antibody. Representative gel images of end-point ChIP-qPCR products are shown. s Quantitative results are shown as the percentage of input DNA. t The mRNA level of Ccl2 . u Ccl2 levels in the culture medium were determined by ELISA. v Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Ccl2 promoter (Ccl2-WT) or the mutated Ccl2 promoter with mutations in the c-Jun binding motif (Ccl2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. n = 5 for each group. The data are presented as the means ± SEMs; * p < 0.05, ** p < 0.01, *** p < 0.001. See also supplementary Figs. –

    Article Snippet: The luciferase reporter assay was performed by transfecting 0.2 μg of firefly and Renilla luciferase reporter vectors (Addgene, #128046) driven by either the wild-type mouse Lcn2 or Ccl2 promoter (−1999/+1) or their respective mutants (in which the NF-κB or c-Jun DNA binding site was mutated) (Azenta) into BMMSCs seeded in 96-well plates using Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific, #L3000001).

    Techniques: Expressing, Inhibition, Activation Assay, Isolation, Gene Expression, Real-time Polymerase Chain Reaction, Recombinant, Sonication, Chromatin Immunoprecipitation, Amplification, ChIP-qPCR, Luciferase, Reporter Assay, Transfection, Construct, Binding Assay, Sequencing, Activity Assay, Translocation Assay, Enzyme-linked Immunosorbent Assay, Immunofluorescence, Staining, Software