quickchange multisite mutagenesis kit (Agilent technologies)
Agilent technologies is a verified supplier 
Agilent technologies manufactures this product 
90
Structured Review
Agilent technologies
quickchange multisite mutagenesis kit
Quickchange Multisite Mutagenesis Kit, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multisite-quickchange+kit/pmc03422271-281-9-13
Average 90 stars, based on 1 article reviews
Quickchange Multisite Mutagenesis Kit, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multisite-quickchange+kit/pmc03422271-281-9-13
Average 90 stars, based on 1 article reviews
quickchange multisite mutagenesis kit - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Mutagenesis:Article Title: Rodent Herpesvirus Peru Encodes a Secreted Chemokine Decoy Receptor Article Snippet: .. Mutagenesis was performed using a Article Title: Muscle stem cell behavior is modified by microRNA-27 regulation of Pax3 expression Article Snippet: The 3′-UTR of the Pax3 transcript was amplified by PCR by using forward 5′-AAAAGCGGCCGCGTTTAAACGAGAAGATTCTTCATGTCTA-3′ and reverse 5′-AAAACTCGAGGTTTAAACTAGGGGGTAGTTCCTCCT-3′ primers, cloned into the pGEMT-Easy vector (Promega), and the sequence was verified. .. The predicted miR-27b “seed” site was mutated with mutagenic primers 5′-GCTGATCTTGCCCCTAACCCCGAATTGTCCCAGCATGACC-3′ and 5′-GATCTTGCCCCTAACCCCCTTTTGTCCCAGCATGACC-3′ by using the Article Title: Hmgb3 Is Regulated by MicroRNA-206 during Muscle Regeneration Article Snippet: .. The predicted miR seed sites were mutated using the Article Title: Dual-Color Imaging of Nuclear Division and Mitotic Spindle Elongation in Live Cells of Aspergillus nidulans Article Snippet: .. Three oligonucleotides (M1 [ACTTGTCACTACTCTCACCTGGGGTGTTCAATGC], M2 [ATACAACTACATCTCCCACAACGTATACATCACCGCCGACAAGCAG], and M3 [ACGGCATCAAAGCCCACTTCAAGACCCGC]) were used for mutagenesis with a Stratagene Construct:Article Title: Rodent Herpesvirus Peru Encodes a Secreted Chemokine Decoy Receptor Article Snippet: .. Mutagenesis was performed using a DNA Sequencing:Article Title: Rodent Herpesvirus Peru Encodes a Secreted Chemokine Decoy Receptor Article Snippet: .. Mutagenesis was performed using a Sequencing:Article Title: Muscle stem cell behavior is modified by microRNA-27 regulation of Pax3 expression Article Snippet: The 3′-UTR of the Pax3 transcript was amplified by PCR by using forward 5′-AAAAGCGGCCGCGTTTAAACGAGAAGATTCTTCATGTCTA-3′ and reverse 5′-AAAACTCGAGGTTTAAACTAGGGGGTAGTTCCTCCT-3′ primers, cloned into the pGEMT-Easy vector (Promega), and the sequence was verified. .. The predicted miR-27b “seed” site was mutated with mutagenic primers 5′-GCTGATCTTGCCCCTAACCCCGAATTGTCCCAGCATGACC-3′ and 5′-GATCTTGCCCCTAACCCCCTTTTGTCCCAGCATGACC-3′ by using the other:Article Title: Clinical Evolution, Genetic Landscape, and Trajectories of Clonal Hematopoiesis in SAMD9/SAMD9L Syndromes Article Snippet: Here, we introduced patient-specific single (germline n=48, somatic n=7) and double ( cis germline/somatic n=6) SAMD9 or SAMD9L mutations into the vector with wildtype SAMD9 or SAMD9L cDNA by site-directed mutagenesis ( Article Title: The transcription factor GLI2 as a downstream mediator of transforming growth factor-β-induced fibroblast activation in SSc. Article Snippet: Department of Internal Medicine III and Institute for Clinical Immunology, University of Erlangen-Nuremberg, Erlangen, Germany Department of Clinical and Experimental Rheumatology, 1st Faculty of Medicine, Institute of Rheumatology, Charles University, Prague, Czech Republic Dipartimento Cardiotoracico e Vascolare, Laboratory of Respiratory Cell Biology, University of Pisa, Pisa, Italy Department of Dermatology, Venereology and Pediatric Dermatology, Medical University of Lublin, Poland Rheumaklinik, University Hospital Zurich, Zurich, Switzerland Article Title: Stereotyped antibody responses target posttranslationally modified gluten in celiac disease Article Snippet: Site-directed mutagenesis in 1E01 and 1E03 hmAbs was induced using |