aida software (Raytest GmbH)
90
Structured Review
Raytest GmbH
aida software
Aida Software, supplied by Raytest GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ms200+microarray+scanner/aida+software/pmc04021841-48-20-22
Average 90 stars, based on 1 article reviews
Aida Software, supplied by Raytest GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ms200+microarray+scanner/aida+software/pmc04021841-48-20-22
Average 90 stars, based on 1 article reviews
aida software - by Bioz Stars,
2026-11
90/100 stars
Images
Related Articles
other:Article Title: Interplay of two small RNAs fine-tunes hierarchical flagella gene expression in Campylobacter jejuni Article Snippet: In order to visualize flagellar filaments by confocal microscopy, C. jejuni NCTC11168 strains bearing a cysteine residue in a second copy of the major flagellin (FlaA S395C; described above) were labeled with the DyLight 488 maleimide stain (Thermo Scientific), adapted from a previously published protocol . Article Title: EANM'24 Abstract Book Congress Oct 19-23, 2024. Article Snippet: European Journal of Nuclear Medicine and Molecular Imaging (2024) 51 (Suppl 1): S1–S1024 This supplement was not sponsored by outside commercial interests.. It was funded entirely by the association’s own resources.. European Journal of Nuclear Medicine and Molecular Imaging (2024) 51 (Suppl 1): S1–S1024 S1 10.1007/s00259-024-06838-z Eur J Nucl Med Mol Imaging (2024) 51 (Suppl 1): S1–S1024 S2 Article Title: Stress-dependent condensate formation regulated by the ubiquitin-related modifier Urm1. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TTGCGCCTCCGCGGTGGAATGGTGAGCAAGGGCGAG This study LCO17 GCAGCCGGATCTAAGCTTCTACTTGTACAGCTCGTC This study LCO18 TGCGCCTCCGCGGTGGAATGGTAAACGTGAAAGTG This study LCO19 GCAGCCGGATCTAAGCTTTTATGTTGAAGTAAAAGA This study LCO20 CCCGGAACTAGTATGGTAAACGTGAAAGTGGA This study LCO21 CCCGGAACTAGTACCACCATGTAATGTTGAAG This study LCO22 CCCGGACTCGAGATGGCTGATATTACTGATAA This study LCO23 CCCGGAGGATCCTTAAGCTTGCTCAGTTTGTT This study LCO23 Recombinant DNA p416ADH1 Mumberg et al.90 N/A p416ADH1HIS6-URM1L96R This study pYLVC1 pEF-HIS6-URM1L96R This study EUROFINS pCU426GAL1-GFP F. den Brave Universität Bonn pCU426GAL1-20Q-GFP F. den Brave Universität Bonn pCU426GAL1-URM1-20Q-GFP This study pYLVC3 pGAL1-UBG76V-20Q-GFP This study pYLVC4 pEF-UBG76V This study EUROFINS P415GAL Mumberg et al.90 N/A p415GAL1-PGK1-GFP This study pYLVC5 p415GAL1-URM1PGK1-GFP This study pYLVC6 pEF-PGK1-GFP This study EUROFINS pEF-URM1PGK1-GFP This study EUROFINS p415GAL1-LUCDM-GFP This study pYLVC7 p415GAL1-URM1LUCDM-GFP This study pYLVC8 pET11A-T7-URM1-GFP This study pYLVC9 pET11A-T7-UBG76V-GFP This study pYLVC10 pET11A-T7-mSCARLET-UBA4 This study pYLVC11 pHUE Catanzariti et al.91 N/A pHUE-URM1 This study pYLVC12 pHUE-urm1H97F This study pYLVC13 pHUE-UBA4 This study pYLVC14 pHUE-mScarlet This study pYLVC15 pHUE-urm1DCT This study pYLVC16 p416ADH1HIS6-MNG-URM1 This study pYLVC17 pEF-HIS6-MNG-URM1 This study EUROFINS p413GAL1-CG* Park et al.71 N/A p413GAL1-URM1-CG* This study pYLVC18 pET11A-T7-HIS6-PAB1 This study pYLVC19 pGFP-HsURM1 S. Jentsch N/A p tKUUU, tEUUC,tQUUG Leidel et al.32 N/A Software and Software:Article Title: Interplay of two small RNAs fine-tunes hierarchical flagella gene expression in Campylobacter jejuni Article Snippet: A monoclonal antibody against GroEL (1:10,000; Sigma-Aldrich, #G6532-5ML) with an anti-rabbit IgG (1:10,000; GE Healthcare, #RPN4301) secondary antibody was used for normalization after FLAG/GFP detection. .. Bands were quantified using Article Title: Genetic code expansion for site-specific labeling of antibodies with radioisotopes Article Snippet: [89Zr]Zr-oxalate solution in 1 M oxalic acid (PerkinElmer, Boston, USA) was neutralized with 45 μL 2 M Na2CO3 solution and incubated for 3 min at room temperature. .. Radiochemical conversion was investigated after 90 min via radio-TLC (stationary phase: Merck Silica 60 F254 TLC plates; mobile phase: 0.1 M citrate-buffer pH 4), image plate scanner (CR35-Bio, Elysia Raytest) and Article Title: Stress-dependent condensate formation regulated by the ubiquitin-related modifier Urm1. Article Snippet: Images of blots were analyzed using either Fiji (Fiji, RRID: SCR_002285) or AIDA software (Raytest, RRID: SCR_014440). .. Images of blots were analyzed using either Fiji (Fiji, RRID: SCR_002285) or Article Title: Repeated low-intensity focused ultrasound led to microglial profile changes in TgF344-AD rats Article Snippet: Sections from each animal were immediately exposed to a phosphor imaging plate (BAS 1800II - Fujifilm) overnight (O/N). .. The resulting digital images were analyzed with the Article Title: Targeting the AKT/mTOR pathway attenuates the metastatic potential of colorectal carcinoma circulating tumor cells in a murine xenotransplantation model. Article Snippet: Western blot images were acquired using the ImageQuant LAS 4000 system (GE Healthcare Bio-Sciences, Pittsburgh, PA, USA). .. Densitometric quantification was conducted using the Thin Layer Chromatography:Article Title: Genetic code expansion for site-specific labeling of antibodies with radioisotopes Article Snippet: [89Zr]Zr-oxalate solution in 1 M oxalic acid (PerkinElmer, Boston, USA) was neutralized with 45 μL 2 M Na2CO3 solution and incubated for 3 min at room temperature. .. Radiochemical conversion was investigated after 90 min via radio-TLC (stationary phase: Merck Silica 60 F254 TLC plates; mobile phase: 0.1 M citrate-buffer pH 4), image plate scanner (CR35-Bio, Elysia Raytest) and |