Review



eef2 kinase overexpression  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    TaKaRa eef2 kinase overexpression
    Eef2 Kinase Overexpression, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 183 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/eef2+expression+vector/Kinase+Expression+Vector+Set/us08030286-505-4-23
    Average 94 stars, based on 183 article reviews
    eef2 kinase overexpression - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    other:

    Article Title: Environmental reservoir of resistance genes for the last resort antibiotic Cefiderocol
    Article Snippet: The expression vector used was pHSG299 (Takara Bio, Shiga, Japan; accession number: M19415 ).

    Article Title: A VRC13-like bNAb response is associated with complex escape pathways in HIV-1 envelope.
    Article Snippet: The rational design of HIV-1 immunogens to trigger the development of broadly neutralizing antibodies (bNAbs) requires understanding the viral evolutionary pathways influencing this process.. An acute HIV-1-infected individual exhibiting >50% plasma neutralization breadth developed neutralizing antibody specificities against the CD4-binding site (CD4bs) and V1V2 regions of Env gp120.. Comparison of pseudoviruses derived from early and late autologous env sequences demonstrated the development of >2 log resistance to VRC13 but not to other CD4bs-specific bNAbs.

    Article Title: SPMs exert anti-inflammatory and pro-resolving effects through positive allosteric modulation of the prostaglandin EP4 receptor
    Article Snippet: After purification of the PCR products, the PCR-amplified linear and receiver DNA sequences were fused using Takara Infusion HD cloning PLUS kit (Takara, 638909) following the manufacturer’s instructions to generate the final expression vector that was transformed in Stellar Cells competent E. coli from the infusion kit (Takara).

    Article Title: Biodegradation of Cyromazine by Mycobacterium sp. M15: Performance, Degradation Pathways, and Key Enzymes.
    Article Snippet: The bacterial strains, plasmids and primers used in this study Strains, plasmids and primers Feature description Source Strains Mycobacterium sp. M15 Cyromazine-degrading strain This study E. coli DH5α F- recA1 endA1 thi-1 supE44 relA1 deoR Δ(lacZYA-argF) U169Φ80dlacZΔM15 TaKaRa E. coli BL21(DE3) F-ompT hsdS(rB- mB-) gal dcm lacY1(DE3) TaKaRa Plasmids pET-29a(+) Expression vector; Km TaKaRa pET-29a(+)-criA pET-29a(+) derivative carrying criA This study pET-29a(+)-atzC pET-29a(+) derivative carrying atzC This study pET-29a(+)-criQ pET-29a(+) derivative carrying criQ This study Primers (5’ to 3’) 27-F AGAGTTTGATCCTGGCTCAG Tsingke 1492-R TACGGCTACCTTGTACGACTT Tsingke criA-r AgtggtggtggtggtggtgctcgagGAGGCTGCGCCAAGCT (XhoI) This study criA-f aactttaagaaggagatatacataATGCAAACGCTCAGCATCC This study atzC-r AgtggtggtggtggtggtgctcgagGGCAACTATAACCTCATC C(XhoI) This study atzC-f AactttaagaaggagatatacataATGAGTAAAGATTTTGATT TAATC This study criQ-r AgtggtggtggtggtggtgctcgagCTCTGGCCTTGATCCAGC G(XhoI) This study criQ-f AactttaagaaggagatatacataATGTCAATGGAAACCCATA GTTATGTAGACG This study Table S3.

    Article Title: Androgens induce renal synthesis of urinary lipocalin-family protein, a potential inter-sexual transmitter in viviparous rockfish.
    Article Snippet: In viviparous black rockfish (Sebastes schlegelii), the kidney of reproductive-phase males actively produces lipocalin-type prostaglandin D2 synthase homolog (LPGDSh) protein, which is presumably involved in intersexual communication when emitted in the urine.. The present study was undertaken to discover whether androgens and their nuclear receptors (Ars) are engaged in regulation of renal LPGDSh protein synthesis in black rockfish.. Quantitative real-time polymerase chain reaction, in conjunction with immunohistochemistry and highly sensitive enzyme-linked immunosorbent assay, revealed that intra-abdominal administration of a synthetic androgen, 17α-methyltestosterone (MT), to juvenile black rockfish induced their renal expression of LPGDSh transcript and protein.

    Article Title: Development of an optimized cell-based selection system for phage display libraries
    Article Snippet: Selected scFv fragments were amplified and integrated into the expression vector using In Fusion ® HD Cloning Kit according to the manufacturer’s protocol (Takara Bio INC., Kusatsu, Japan).

    Article Title: Promising properties of cytochrome P450 BM3 reconstituted from separate domains by split intein.
    Article Snippet: Recombinant cytochrome P450 monooxygenases possess significant potential as biocatalysts, and efforts to improve heme content, electron coupling efficiency, and catalytic activity and stability are ongoing.. Domain swapping between heme and reductase domains, whether natural or engineered, has thus received increasing attention.. Here, we successfully achieved split intein-mediated reconstitution (IMR) of the heme and reductase domains of P450 BM3 both in vitro and in vivo.

    Article Title: CD109 Attenuates Bleomycin-induced Pulmonary Fibrosis by Inhibiting TGF-β Signaling.
    Article Snippet: RESEARCH ARTICLE | FEBRUARY 09 2024 CD109 Attenuates Bleomycin-induced Pulmonary Fibrosis by Inhibiting TGF- β Signaling Hyogo Naoi; ... et. al J Immunol (2024) 212 (7): 1221–1231. https://doi.org/10.4049/jimmunol.2300285 Related Content The C3-like molecule CD109 controls Th1 versus Th17 induction in CD4+ T cells J Immunol (May,2021) The C3-like molecule CD109 controls Th1 versus Th17 induction in CD4+ T cells J Immunol (May,2020) The CD4 T cell-intrinsic C3-like molecule CD109 prevents hyper-in ammatory T cell responses J Immunol (May,2024) D ow nloaded from http://journals.aai.org/jim m unol/article-pdf/212/7/1221/1654456/ji2300285.pdf by guest on 12 M ay 2025



    Similar Products

    94
    TaKaRa eef2 kinase overexpression
    Eef2 Kinase Overexpression, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/eef2+expression+vector/Kinase+Expression+Vector+Set/us08030286-505-4-23
    Average 94 stars, based on 1 article reviews
    eef2 kinase overexpression - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    90
    Thermo Fisher eef2 expression vector
    Eef2 Expression Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/eef2+expression+vector/us10265389-424-1-27
    Average 90 stars, based on 1 article reviews
    eef2 expression vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results