Review




Structured Review

Azenta codon optimization tool
Codon Optimization Tool, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/codon+optimization+tool/codon+optimized/pmc12875667-254-12-16
Average 86 stars, based on 1 article reviews
codon optimization tool - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

Plasmid Preparation:

Article Title: Promoter and use thereof
Article Snippet: .. The codon optimization was conducted on the lacZα gene (SEQ ID NO: 39) in a pUC57 plasmid using codon optimization software (developed by Genewiz Inc. Suzhou), where the optimized lacZα gene was synthesized by Genewiz Inc. Suzhou. ..

Article Title: A fungal effector targets the chloroplast to support biotrophy by balancing disease and plant health
Article Snippet: .. The coding sequence of UmPce3, codon-optimized and synthesized for N. benthamiana (GENEWIZ), was cloned into a pCAMBIA-based vector containing the N-terminal coding sequence of luciferase (Vector 2C) using a SpeI/KpnI double-restriction digest. .. In parallel, AtRH3 was amplified using primers containing DraIII restriction sites, as detailed in Supplemental Table 5 and cloned into the pCAMBIA vector carrying the C-terminal coding sequence of luciferase (Vector 2B) and ZmRh3b (codon-optimized and synthesized for N. benthamiana by GENEWIZ) was cloned into the Vector 2B by GENEWIZ.

Article Title: Coiled-coil centrosomal proteins facilitate tubulin concentration via polyKR motifs.
Article Snippet: 1 Institute of Bioinformatics and Structural Biology, National Tsing Hua University, Hsinchu, Taiwan 2 Department of Infectious Diseases, Virology, Heidelberg University, Germany 3 Max Planck School Matter to Life, Heidelberg, Germany 4 Protein Expression and Purification Core Facility, European Molecular Biology Laboratory, Heidelberg, Germany 5 Department of Cellular and Molecular Pharmacology and Howard Hughes Medical Institute, University of California, San Francisco, CA, USA

Article Title: Conserved stem-loops of the SARS-CoV-2 5’-UTR activate OAS1
Article Snippet: .. Plasmid DNA encoding nucleotides 1-3621 from strain SARS-CoV-2/human/USA/GA-PGCoE-0083E/2024 (PQ331003.1) (Genewiz) was used as template for PCR amplification of the full 5’-SE (SL1-8) region and 3’-end truncation variants (SL-7 to SL1-3) using primers listed in ( Supplemental Table S1 ). ..

Software:

Article Title: Promoter and use thereof
Article Snippet: .. The codon optimization was conducted on the lacZα gene (SEQ ID NO: 39) in a pUC57 plasmid using codon optimization software (developed by Genewiz Inc. Suzhou), where the optimized lacZα gene was synthesized by Genewiz Inc. Suzhou. ..

Synthesized:

Article Title: Promoter and use thereof
Article Snippet: .. The codon optimization was conducted on the lacZα gene (SEQ ID NO: 39) in a pUC57 plasmid using codon optimization software (developed by Genewiz Inc. Suzhou), where the optimized lacZα gene was synthesized by Genewiz Inc. Suzhou. ..

Article Title: A fungal effector targets the chloroplast to support biotrophy by balancing disease and plant health
Article Snippet: .. The coding sequence of UmPce3, codon-optimized and synthesized for N. benthamiana (GENEWIZ), was cloned into a pCAMBIA-based vector containing the N-terminal coding sequence of luciferase (Vector 2C) using a SpeI/KpnI double-restriction digest. .. In parallel, AtRH3 was amplified using primers containing DraIII restriction sites, as detailed in Supplemental Table 5 and cloned into the pCAMBIA vector carrying the C-terminal coding sequence of luciferase (Vector 2B) and ZmRh3b (codon-optimized and synthesized for N. benthamiana by GENEWIZ) was cloned into the Vector 2B by GENEWIZ.

Article Title: Coiled-coil centrosomal proteins facilitate tubulin concentration via polyKR motifs.
Article Snippet: 1 Institute of Bioinformatics and Structural Biology, National Tsing Hua University, Hsinchu, Taiwan 2 Department of Infectious Diseases, Virology, Heidelberg University, Germany 3 Max Planck School Matter to Life, Heidelberg, Germany 4 Protein Expression and Purification Core Facility, European Molecular Biology Laboratory, Heidelberg, Germany 5 Department of Cellular and Molecular Pharmacology and Howard Hughes Medical Institute, University of California, San Francisco, CA, USA

Article Title: A fungal effector targets the chloroplast to support biotrophy by balancing disease and plant health
Article Snippet: .. For constitutive heterologous expression of UmPce3 (UMAG_05298) in Arabidopsis, a GENEWIZ-codon-optimized UmPce3 sequence was synthesized and cloned by GENEWIZ into the pBASTA-35S-3HA vector. ..

Article Title: WTR: A Toolkit for Functional Anterograde Transsynaptic Circuit Mapping
Article Snippet: EF1α-DIO-hGluc-CMV-CLuc was made from pC0037 (Addgene, #181934). .. The codon-optimized WGA (mWGA) sequence was synthesized by Genewiz Inc. (South Plainfield, NJ) and fused with a TEVp cleavage site (GAGAACCTGTACTTCCAGGGC), along with either Cre or Flpo recombinase. ..

Clone Assay:

Article Title: Genetically engineered Streptomyces viridosporus ATCC 14672 strains for the discovery of novel moenomycins.
Article Snippet: .. The codon-optimized synthetic gene plu3366, cloned into vector pUC57-kan, was ordered from Genewiz (South Plainfield, NJ); the nucleotide sequences of the natural and synthetic genes are given in Fig. S1, ESM. ..

Article Title: A fungal effector targets the chloroplast to support biotrophy by balancing disease and plant health
Article Snippet: .. The coding sequence of UmPce3, codon-optimized and synthesized for N. benthamiana (GENEWIZ), was cloned into a pCAMBIA-based vector containing the N-terminal coding sequence of luciferase (Vector 2C) using a SpeI/KpnI double-restriction digest. .. In parallel, AtRH3 was amplified using primers containing DraIII restriction sites, as detailed in Supplemental Table 5 and cloned into the pCAMBIA vector carrying the C-terminal coding sequence of luciferase (Vector 2B) and ZmRh3b (codon-optimized and synthesized for N. benthamiana by GENEWIZ) was cloned into the Vector 2B by GENEWIZ.

Article Title: Coiled-coil centrosomal proteins facilitate tubulin concentration via polyKR motifs.
Article Snippet: 1 Institute of Bioinformatics and Structural Biology, National Tsing Hua University, Hsinchu, Taiwan 2 Department of Infectious Diseases, Virology, Heidelberg University, Germany 3 Max Planck School Matter to Life, Heidelberg, Germany 4 Protein Expression and Purification Core Facility, European Molecular Biology Laboratory, Heidelberg, Germany 5 Department of Cellular and Molecular Pharmacology and Howard Hughes Medical Institute, University of California, San Francisco, CA, USA

Article Title: A fungal effector targets the chloroplast to support biotrophy by balancing disease and plant health
Article Snippet: .. For constitutive heterologous expression of UmPce3 (UMAG_05298) in Arabidopsis, a GENEWIZ-codon-optimized UmPce3 sequence was synthesized and cloned by GENEWIZ into the pBASTA-35S-3HA vector. ..

Sequencing:

Article Title: A fungal effector targets the chloroplast to support biotrophy by balancing disease and plant health
Article Snippet: .. The coding sequence of UmPce3, codon-optimized and synthesized for N. benthamiana (GENEWIZ), was cloned into a pCAMBIA-based vector containing the N-terminal coding sequence of luciferase (Vector 2C) using a SpeI/KpnI double-restriction digest. .. In parallel, AtRH3 was amplified using primers containing DraIII restriction sites, as detailed in Supplemental Table 5 and cloned into the pCAMBIA vector carrying the C-terminal coding sequence of luciferase (Vector 2B) and ZmRh3b (codon-optimized and synthesized for N. benthamiana by GENEWIZ) was cloned into the Vector 2B by GENEWIZ.

Article Title: A fungal effector targets the chloroplast to support biotrophy by balancing disease and plant health
Article Snippet: .. For constitutive heterologous expression of UmPce3 (UMAG_05298) in Arabidopsis, a GENEWIZ-codon-optimized UmPce3 sequence was synthesized and cloned by GENEWIZ into the pBASTA-35S-3HA vector. ..

Article Title: WTR: A Toolkit for Functional Anterograde Transsynaptic Circuit Mapping
Article Snippet: EF1α-DIO-hGluc-CMV-CLuc was made from pC0037 (Addgene, #181934). .. The codon-optimized WGA (mWGA) sequence was synthesized by Genewiz Inc. (South Plainfield, NJ) and fused with a TEVp cleavage site (GAGAACCTGTACTTCCAGGGC), along with either Cre or Flpo recombinase. ..

Luciferase:

Article Title: A fungal effector targets the chloroplast to support biotrophy by balancing disease and plant health
Article Snippet: .. The coding sequence of UmPce3, codon-optimized and synthesized for N. benthamiana (GENEWIZ), was cloned into a pCAMBIA-based vector containing the N-terminal coding sequence of luciferase (Vector 2C) using a SpeI/KpnI double-restriction digest. .. In parallel, AtRH3 was amplified using primers containing DraIII restriction sites, as detailed in Supplemental Table 5 and cloned into the pCAMBIA vector carrying the C-terminal coding sequence of luciferase (Vector 2B) and ZmRh3b (codon-optimized and synthesized for N. benthamiana by GENEWIZ) was cloned into the Vector 2B by GENEWIZ.

Polymerase Chain Reaction:

Article Title: Conserved stem-loops of the SARS-CoV-2 5’-UTR activate OAS1
Article Snippet: .. Plasmid DNA encoding nucleotides 1-3621 from strain SARS-CoV-2/human/USA/GA-PGCoE-0083E/2024 (PQ331003.1) (Genewiz) was used as template for PCR amplification of the full 5’-SE (SL1-8) region and 3’-end truncation variants (SL-7 to SL1-3) using primers listed in ( Supplemental Table S1 ). ..

Amplification:

Article Title: Conserved stem-loops of the SARS-CoV-2 5’-UTR activate OAS1
Article Snippet: .. Plasmid DNA encoding nucleotides 1-3621 from strain SARS-CoV-2/human/USA/GA-PGCoE-0083E/2024 (PQ331003.1) (Genewiz) was used as template for PCR amplification of the full 5’-SE (SL1-8) region and 3’-end truncation variants (SL-7 to SL1-3) using primers listed in ( Supplemental Table S1 ). ..

Expressing:

Article Title: A fungal effector targets the chloroplast to support biotrophy by balancing disease and plant health
Article Snippet: .. For constitutive heterologous expression of UmPce3 (UMAG_05298) in Arabidopsis, a GENEWIZ-codon-optimized UmPce3 sequence was synthesized and cloned by GENEWIZ into the pBASTA-35S-3HA vector. ..

Whole Genome Amplification:

Article Title: WTR: A Toolkit for Functional Anterograde Transsynaptic Circuit Mapping
Article Snippet: EF1α-DIO-hGluc-CMV-CLuc was made from pC0037 (Addgene, #181934). .. The codon-optimized WGA (mWGA) sequence was synthesized by Genewiz Inc. (South Plainfield, NJ) and fused with a TEVp cleavage site (GAGAACCTGTACTTCCAGGGC), along with either Cre or Flpo recombinase. ..



Similar Products

86
Azenta codon optimization tool
Codon Optimization Tool, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/codon+optimization+tool/codon+optimized/pmc12875667-254-12-16
Average 86 stars, based on 1 article reviews
codon optimization tool - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Dotmatics Limited codon optimization tool
Codon Optimization Tool, supplied by Dotmatics Limited, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/codon+optimization+tool/codon+optimization+tool/bio_rxiv__2025__11__17__688765-80-17-22
Average 86 stars, based on 1 article reviews
codon optimization tool - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Benchling Inc codon optimization tool
Codon Optimization Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/codon+optimization+tool/codon+optimization+tool/pm41226280-174-17-15
Average 86 stars, based on 1 article reviews
codon optimization tool - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Benchling Inc benchling codon optimization tool
Benchling Codon Optimization Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/codon+optimization+tool/codon+optimization+tool/pmc12711569-539-23-28
Average 86 stars, based on 1 article reviews
benchling codon optimization tool - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Twist Bioscience gensmart codon optimization tool
Gensmart Codon Optimization Tool, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/codon+optimization+tool/codon+gensmart+optimization+tool/pmc12507698-416-7-21
Average 86 stars, based on 1 article reviews
gensmart codon optimization tool - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Twist Bioscience codon optimization tool
Codon Optimization Tool, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/codon+optimization+tool/codon+optimized/10__1016_slash_j__molcel__2025__07__019-725-6-10
Average 86 stars, based on 1 article reviews
codon optimization tool - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results