Article Images (0)
×![]()
featured_play_listSave article to folder
X
Create new folder
Full Text
PDF
Table of Contents
Abstract
Low-Intensity Training And The C5a Complement
Materials And Methods
Conclusion
Acknowledgments
Supplemental Data
Abstract
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 ajp.amjpathol.org 63 64 65 66 67 68 69 70 71 72 73 74 75 76 Low-Intensity Training and the C5a Complement Antagonist NOX-D21 Rescue the mdx Phenotype 77 78 79 80 81 82 through Modulation of Inflammation Janek Hyzewicz,* Jun Tanihata,* Mutsuki Kuraoka,* Yuko Nitahara-Kasahara,* Teiva Beylier,* Urs T. Ruegg,y Axel Vater,z and Shin’ichi Takeda*
Q46 Q2Q3 Q7 Q9 The American Journal of Pathology, Vol. -, No. -, - 2017 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 ajp.amjpathol.org 63 64 65 66 67 68 69 70 71 72 73 74 75 76
Low-Intensity Training and the C5a Complement
Antagonist NOX-D21 Rescue the mdx Phenotype 77 78 79 80 81 82 through Modulation of Inflammation Janek Hyzewicz,* Jun Tanihata,* Mutsuki Kuraoka,* Yuko Nitahara-Kasahara,* Teiva Beylier,* Urs T. Ruegg,y Axel Vater,z and Shin’ichi Takeda* 83 84 85 From the Department of Molecular Therapy,* National Institute of Neuroscience, National Centre of Neurology and Psychiatry, Tokyo, Japan; the University of Geneva,y Geneva, Switzerland; and the NOXXON Pharma,z Berlin, Germany 86 87 88 Accepted for publication C o h 89 90 91 92 93 94 95 96 97 December 27, 2016. Address correspondence to Shin’ichi Takeda, Department of Molecular Therapy, National Institute of Neuroscience, National Center of Neurology and Psychiatry, 4-1-1 OgawaHigashi, Kodaira, Tokyo 187- 8502, Japan. E-mail: takeda@ ncnp.go.jp. 8 opyright ª 2017 American Society for Inves rg/licenses/by-nc-nd/4.0/). ttp://dx.doi.org/10.1016/j.ajpath.2016.12.019 98 99 100 101 102 103 104 Inflammatory events occurring in dystrophic muscles contribute to the progression of Duchenne muscular dystrophy (DMD). Low-intensity training (LIT) attenuates the phenotype of mdx mice, an animal model for DMD. Therefore, we postulated that LIT could have anti-inflammatory properties. We assessed levels of inflammatory cytokines and infiltrated immune cells in gastrocnemius muscle of mdx mice after LIT. We detected high levels of complement component C5a, chemokine ligand (CCL) 2, CD68þ monocytes/macrophages, and proinflammatory M1 macrophages in muscles of mdx mice. LIT decreased CCL2 levels, increased CD68þ cell numbers, and shifted the macrophage population to the regenerative M2 type. We investigated whether inhibition of C5a or CCL2 with L-aptamers could mimic the effects of LIT. Although no effect of CCL2 inhibition was detected, treatment with the C5a inhibitor, NOX-D21, rescued the phenotype of nonexercised mdx mice, but not of exercised ones. In both cases, the level of CD68þ cells increased and macrophage populations leaned toward the inflammatory M1 type. In muscles of nonexercised treated mice, the level of IL-1 Qreceptor antagonist increased, damage decreased, and fibers were switched toward the glycolytic fast type; in muscles of exercised mice, fibers were switched to the oxidative slow type. These results reveal the effects of LIT on the inflammatory status of mdx mice and suggest that NOX-D21 could be an anti-inflammatory drug for DMD. (Am J Pathol 2017, -: 1e15; http://dx.doi.org/10.1016/j.ajpath.2016.12.019) Supported Q4by a Q5National Center of Neurology and Psychiatry intramural research grant (25-5 and 28-6) Q6for Neurological and Psychiatric Disorders. Disclosures: Dr. Axel Vater is a formal employee of NOXXON Pharma, which provided the L-aptamers NOX-D21 and NOX-E36m; he holds <1% of the shares of this company. 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 Duchenne muscular dystrophy (DMD) is a lethal congenital neuromuscular disease caused by mutations in the DMD gene. A lack of dystrophin in skeletal muscle of DMD patients results in altered mechanical and signaling functions that contribute to membrane fragility, necrosis of muscle fibers, inflammation, and progressive muscle wasting.1,2 Immune cells infiltrate into dystrophic muscles during the early stage of the disease and contribute substantially to the onset and the progression of DMD. The muscular dystrophy, X-linked mouse model (mdx), has a point mutation in the dystrophin gene causing dystrophin deficiency; it is an established and most often used animal model for DMD. Immune cell infiltration begins at an age of 2 weeks, peaks around 4 to 8 weeks, and then decreases in severity by 3 months of age.3 Myeloid cells (CD11bþ) of the monocyte/ macrophage lineage (CD68þ) are the principal infiltrating tigative Pathology. Published by Elsevier Inc. T FLA 5.4.0 DTD AJPA2563_proof population and accumulate in muscle at approximately 80,000 cells/mm3 of tissue.4,5 In comparison, the second most important population, the T cells, infiltrate to a level of approximately 1200 cells/mm3.6 Differentiated macrophages (F4/80þ) are divided by functional criteria into two subpopulations, namely proinflammatory M1 [inducible nitric oxide synthase (iNOS)þ] and anti-inflammatory M2 (CD163þ, CD206þ) macrophages.7 In muscles of mdx mice as well as DMD patients,1 the balance between M1 and M2 his is an open access article under the CC BY-NC-ND license (http://creativecommons. 124 14 March 2017 6:10 pm EO: AJP16_0339 10 11 12 Hyzewicz et al 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 populations leans in favor of the M1 population, promoting muscle injury.8 Physical exercise has been shown to generate an antiinflammatory environment.9 Previous studies demonstrated that appropriate training reduces the inflammation in muscles of patients with idiopathic inflammatory myopathies.10 Chronic running also inhibits macrophage infiltration into inflamed tissues and promotes a phenotypic switch from the M1 to the M2 population in murine models characterized by an abnormal inflammation, such as the high-fat diete induced obese mice.11 Yet, the effect of training on the inflammatory status of dystrophic muscles has never been assessed in DMD patients and has given mixed results in mdx mice, as described below. Physical exercise can be either beneficial or detrimental to mdx mice, depending on the age of the animals and the intensity of training.12 Low-intensity training (LIT), such as voluntary running or swimming of mdx mice, improves muscle force and endurance,13,14 and increases the expression of mitochondrial proteins.15,16 High-intensity training, such as forced treadmill or downhill running of mdx mice, causes loss of force and necrosis17,18 as well as fibrosis.19 High-intensity training of mdx mice also worsens their inflammatory status, leading to increased mRNA expression for IL-1b and IL-6,17 decreased mRNA expression for insulin-like growth factor 120 and tumor necrosis factor-a,18 and increased protein expression of transforming growth factor-b1 in muscles.19 We postulated that LIT reduces the expression of proinflammatory factors in mdx skeletal muscle, resulting in a reduction of macrophage infiltration and a phenotypic switch from the M1 to M2 macrophage population. To test this hypothesis, we immunoblotted and stained sections from the gastrocnemius muscles of 8-week-oldmdxmice. We found an overexpression of chemokine ligand (CCL) 2 and of the complement component C5a, a high number of CD68þ cells, and a dominance of M1 macrophages in nonexercised mdx muscle. Four weeks of LIT decreased the levels of CCL2, shifted the macrophage population to the M2 subtype, but further increased the number ofCD68þ cells,which are F4/80þ mature macrophages. The level of C5a was unchanged. In a second step, we assessed the effects of inhibitors of CCL2 and C5a, mNOX-E36 and NOX-D21, respectively. Although no effect was detected from mNOX-E36 treatment, NOX-D21 rescued the phenotype of nonexercised mdx mice, but not of exercised ones. Numbers of CD68þ cells and M1 macrophages increased in both groups; however, only nonexercised mdx mice presented an increased IL-1 receptor antagonist (IL-RA) level, reduction of muscle damage, and a switch to glycolytic, fast-type muscle fibers.
Materials and Methods
Animals Groups of four to five 8-week-old male mdx mice with C57BL/6 background or age-matched wild-type C57BL/6 2 FLA 5.4.0 DTD AJPA2563_proo male control mice were used in this study. All experimental protocols were approved by The Experimental Animal Care and Use Committee of the National Institute of Neuroscience, National Center of Neurology and Psychiatry (Tokyo, Japan). Low-Intensity Training Protocol Mice underwent training when they reached 4 weeks of age. According to a previously published protocol,16 mice were introduced into a tank (40 Q; 25; 20 cm) filled with water (maintained at 35 C 1 C) to a depth enough to force them to swim. Animals underwent a 4-week program in which they exercised for 30 minutes 4 days in a week (Monday, Tuesday, Thursday, and Friday), whereas they were allowed to rest the 3 other days. Injection of NOX-D21 and mNOX-E36 Inhibitors PEGylated mixed L-RNA/DNA Spiegelmer NOX-D21 with the sequence 40 kDaPEG-aminohexyl-GCGAUG(dU)GGU GGUGAAGGGUUGUUGGG(dU)GUCGACGCA(dC)GC and the all-RNA Spiegelmer mNOX-E36 with the sequence 40 kDaPEG-aminohexyl-GGCGACAUUGGUUGGGCAU GAGGCGAGGCCCUUUGAUGAAUCCGCGGCCA were manufactured by NOXXON Pharma (Berlin, Germany). Four-week-old mice were injected s.c. Qthree times per week for 4 weeks at a dose of 20 mg/kg. In the group which exercised, injections were performed immediately after exercise. Physiological Tests For serum creatine kinase measurement, blood was taken from the tail artery and centrifuged at 3000 g for 10 minutes. The biochemical marker creatine kinase was assayed with the Fuji Drychem system (Fuji Film Medical Co Ltd, Tokyo, Japan), as previously described.16 Grip strength of both forelimb and hind limb was assessed by a grip strength meter (MK-380M; Muromachi Kikai Q), as previously described.21 At 8 weeks of age, 2 days after the last training session or the last treatment, mice were sacrificed by cervical dislocation. Gastrocnemius muscles were dissected, and minced for fluorescence-activated cell sorting (FACS) analysis or flash frozen for histological and immunohistochemical examination or stored at 80 C for cytokine array, enzyme-linked immunosorbent assay (ELISA), and Western blot analysis. Histopathology and Immunohistochemistry Transverse cryosections (20 mm thick) of gastrocnemius muscle from 8-week-old mice after 4 weeks of exercise and/or therapy were stained with hematoxylin and eosin, as previously described.21 For immunohistochemistry, cryosections (8 mm thick) were fixed in acetone for 15 minutes ajp.amjpathol.org - The American Journal of Pathology 248 f 14 March 2017 6:10 pm EO: AJP16_0339 Q13 Q14 Q15 Q16 17 18 19 20 21 22 LIT or C5a Inhibition Rescues the mdx Phenotype Q1 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 at 20 C. Sections were blocked and washed with 1% bovine serum albumin and 0.5% Triton X-100 in phosphatebuffered saline (PBS). The following antibodies were used at 1:50 to 1:100 dilutions: rabbit anti-mouse CD68 (ab125212; Abcam, Cambridge, UK) and rat anti-mouse CD206 (MR5D3; Bio-Rad Laboratories, Inc., Hercules, CA). All antibodies were diluted in PBS containing 1% bovine serum albumin and 0.5% Triton X-100 and incubated with the tissue sections for either 1 hour at room temperature or overnight at 4 C. The tissue sections were washed with PBS and incubated with corresponding secondary Alexa 488e or Alexa 594econjugated antibodies (Life Technologies, Carlsbad, CA), at 1:1000 dilution for 1 hour at room temperature. Glass slides were washed with PBS and mounted in Vectashield (Vector Laboratories, Burlingame, CA) with DAPI. Immunofluorescence was visualized using a BZ-9000 fluorescence microscope (KEYENCE, Osaka, Japan). Histochemical staining for NADH-tetrazolium reductase was performed by incubation of tissue sections for 30 minutes at 37 C in NADH-tetrazolium reductase reaction solution (0.2 mol/L Tris, 1.5 mmol/L NADH, and 1.5 mmol/L nitrotetrazolium blue), followed by dehydration through serial dilutions of acetone. Sections were mounted onto slides in Aquamount (Lerner Laboratories, Pittsburgh, PA). Flow Cytometrical Analyses Minced muscles were incubated for 3 hours at 37 C with 5 mL of RPMI 1640 (HyClone, Logan, UT) containing 1 mg/mL collagenase D and 30 mg/mL DNase I (Roche Diagnostics, Laval, QC, Canada). Samples were filtered through a cell strainer with 70 mm mesh size and centrifuged at 800 g for 5 minutes at room temperature. Pellets were washed three times in staining buffer (PBS containing 2% fetal bovine serum) and fixed in PBS containing 2% paraformaldehyde for 20 minutes on ice. Then, cells were permeabilized in staining buffer containing 0.2% saponin for 30 minutes on ice and incubated with antiePE-coupled anti-CD68 (FA-11), anti-Ly6c (RB6-8C5), or anti-F4/80 (CI:A3-1) and APC-coupled anti-CD11b (M170) (BD Biosciences, Mississauga, ON, Canada). Data were acquired with a FACSCanto II (BD Biosciences). Isotype controls or omission of primary antibodies, when appropriate, was used to set gates. Proteome Profiler Cytokine Array Muscle tissue samples were disrupted in a homogenizer (Psychotron NS-310EII; Microtec Co, Ltd, Chiba, Japan), and the protein concentrations were determined by the Bio-Rad protein assay (Bio-Rad Life Science). The relative expression of cytokines and chemokines in muscle lysates was quantified using the Proteome Profiler Array (Mouse Cytokine Array, Panel A; R&D Systems Inc., Minneapolis, MN). The array The American Journal of Pathology - ajp.amjpathol.org FLA 5.4.0 DTD AJPA2563_proof was performed according to the manufacturer’s specifications with 100 mg of total protein. To achieve maximum assay intensity, the blots were incubated overnight. The chemoluminescence signal was generated by incubation with the Super Signal West Femto Chemiluminescent Kit (Thermo Scientific Pierce, Rockford, IL) for 5 minutes. Images were captured using Image Quant LAS 4000 coupled with Image Quant TL software Q(GE Healthcare, Tokyo, Japan). ELISA Amounts of CCL2 and tissue inhibitor of metalloproteinases (TIMP)-1 in muscle lysates were determined by the Mouse CCL2 (MCP-1) ELISA Ready-SET-Go! (88-7391; eBioscience, San Diego, CA) and the TIMP1 Mouse ELISA kit (ab100745; Abcam), according to the manufacturers’ recommendations. Western Blot Proteins from gastrocnemius muscle were separated by SDS-PAGE (12% polyacrylamide) and electroblotted onto a nitrocellulose membrane. After blocking with 1% bovine serum albumin, membranes were incubated with the respective antibody at 1:500 to 1:100 dilutions as follows: rabbit anti-mouse C5a (250565; Abbiotech, San Diego, CA), rabbit anti-mouse CD68 (ab125212), rabbit anti-iNOS antibody (ab3523), rabbit anti-myeloperoxidase (ab65871), rabbit antitroponin T T1 (ab83907; Abcam), rabbit anti-CD163 (M-96), rabbit antieIL-1RA (H-110), rabbit anti-acetyl-CoA carboxylase (C83B10), rabbit anti-AMPKb1/2 Q(57C12), goat antie glyceraldehyde-3-phosphate dehydrogenase (V-18), goat anti-troponin T FS (C-18; Santa Cruz Biotechnology, Inc., Santa Cruz, CA Q), rabbit anti-MYBPC1 (LS-C144479), and rabbit anti-MYBPC2 (LS-C101947; LSBio, Seattle, WA). Membranes were developed with the Super Signal West Femto Chemiluminescent Kit (Thermo Scientific Pierce), and images were captured using Image Quant LAS 4000 coupled with Image Quant TL software Q(GE Healthcare). Statistical Analysis Values are reported as means SD. Statistically significant differences between groups were determined by analysis of variance test, followed by Tukey’s Qrange test. P < 0.05 was considered as significant for the analysis of variance test, and a result above the minimal significant difference was considered significant for the Tukey Qtest. Results Effect of Low-Intensity Training on Macrophage Infiltration in Muscle of 8-Week-Old Mice We assessed the effects of swimming exercise on immune cell populations in wild-type and mdx muscle. 3 372 14 March 2017 6:10 pm EO: AJP16_0339 ½F1 ½F2 ½F3 23 ½F4 ½F5 Hyzewicz et al 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 Immunostaining of the gastrocnemius muscle for CD68, a surface marker of monocytes/macrophages, revealed that mdx mice have higher numbers of intramuscular macrophages than wild-type mice; the highest amount was found in the exercised group. Staining for the M2 macrophage marker, CD206, did not show differences for the presence of M2 macrophages between the groups (Figure 1A and Supplemental Figure S1A). CD68 increased in nonexercised mdx muscles, compared with wild-type ones, as shown by Western blot (Figure 1B). Low-intensity training of mdx mice further increased the CD68 level, which is consistent with the findings revealed by immunohistochemistry (Figure 1A). Western blot analysis also showed that the M1 macrophage marker iNOS was increased in muscle of nonexercised mdx mice, but not in exercised wild-type or exercised mdx mice (Figure 1B). The level of M2 macrophages was assessed with the marker CD163, because antibodies against CD206 were not effective on Western blots. This level was significantly higher in muscle of mdx mice, but the differences between nonexercised and exercised mice were not significant (Figure 1B). This result is concordant with the absence of a visible difference between mdx groups in immunostainings against CD206 (Figure 1A). To set apart mature macrophages from the monocyte/ macrophage population, we performed a FACS analysis on the basis of separation of myeloid cells (CD11bþ), followed by a selection of monocytes (Ly6Cþ), macrophages (F4/80þ), and monocyte/macrophage (CD68þ) populations. In accord with the results of immunostaining and Western blot, we found an increased quantity of CD68þ/CD11bþ cells in exercised mdx muscles, compared with nonexercised ones (Figure 1C). We identified two subpopulations of Ly6C cells (namely, CD11b /Ly6Cþ and CD11bþ/Ly6Cþ) whose abundance remained unaltered by exercise. The CD11bþ/Ly6Cþ population included both monocytes and neutrophils, but we were not able to separate them. In contrast with Ly6cþ populations, the level of F4/80þ/ CD11bþ cells was significantly increased in muscle of exercised mdx mice, compared with nonexercised ones. This result suggests that CD68þ cells were mature macrophages rather than infiltrated monocytes. Effect of Low-Intensity Training on Cytokine and Chemokine Levels in Muscle of 8-Week-Old Mice Cytokine and chemokine levels in gastrocnemius muscle extracts from wild-type and mdx mice were determined by multiplex cytokine/chemokine array analysis (Figure 2, AeC). One hour after the last exercise, complement C5a, TIMP-1, and the chemokine CCL2 were found to be increased in muscle of nonexercised mdx mice, as confirmed by Western blot for C5a (Figure 2D) and ELISA for CCL2 (Figure 2E) and TIMP-1 (Figure 2F). Taken together, LIT significantly decreased the levels of CCL2 and TIMP-1 in mdx muscle. However, the level of C5a was not affected by LIT. 4 FLA 5.4.0 DTD AJPA2563_proo Inhibition of Complement C5a in Muscle of 4- to 8-Week-Old Mice Using the chemokine/cytokine panel and ELISA, we found that complement C5a and CCL2 increased in mdx muscle and that LIT decreased the level of CCL2 (Figure 2). Both molecules are chemoattracting agents playing a crucial role in coordination of the inflammatory response.22,23 We therefore hypothesized that inhibition of C5a or CCL2 would mimic LIT and hence rescue the mdx phenotype. Four-week-old mdx mice were subjected to 4 weeks of LIT while being treated with the L-aptamer inhibitors NOX-D21 or mNOX-E36 to inhibit signaling of C5a and CCL2, respectively (Figure 3A). Treatment with NOX-D21 significantly increased the grip strength and the force/weight ratio of nonexercised mdx mice, compared to untreated mdx mice (Figure 3B). Improvement of force in the treated, nonexercised mdx group was equivalent to 4 weeks of LIT in mdx mice. Interestingly, exercise and treatment together failed improving the phenotype ofmdx mice. Creatine kinase levels of treated and exercised mice were not significantly different (Figure 3C). No significant effect of CCL2 inhibition by mNOX-E36 on grip strength of mdx mice was observed. Thus, we focused on the effects of C5a inhibition by NOX-D21. State of 8-Week-Old mdx QMice after NOX-D21 Treatment or Low-Intensity Training The grip strength of mdx mice increased after treatment with NOX-D21 or LIT (Figure 3B). This improvement could be because of reduced damage in muscle or a change in fiber composition. We evaluated damage by hematoxylin and eosin and IgG staining and changes of fiber composition by NADH staining (Figure 4, A and B) and Western blot analysis of proteins involved in energy metabolism (Figure 5A) or contraction (Figure 5B). We found that the percentage of centronucleated fibers in gastrocnemius muscle was not significantly different between the mdx groups. However, the amount of necrotic fibers (IgG positive) was significantly lower in treated nonexercised mdx muscles, compared with control. Numbers of necrotic fibers tended to be lower in muscles of exercised, but non-treated mdx mice, compared with controls, but the difference was not significant. Amounts of necrotic fibers were also significantly higher in muscles of treated-exercised mdx mice, compared with exercised mdx or treated mdx ones. These results suggest that C5a complement inhibition prevents fiber damage, whereas LIT does not. Furthermore, exercise during the treatment compromises the protective effect of C5a complement inhibition. Numbers of fibers with a strong oxidative metabolism (NADH-positive fibers) tended to be lower in treated muscles and higher in treated and exercised ones, compared with control or exercised mdx mice, but the difference was not significant (Figure 4B). Likewise, Western blot analysis showed that the expression of proteins involved in energy ajp.amjpathol.org - The American Journal of Pathology 496 f 14 March 2017 6:10 pm EO: AJP16_0339 Q24 B N on ex er ci se d Wild type mdx E xe rc is ed CD68 CD206 WT Ex Ex mdx Non CD68 Non Non Ex Non Ex * * Anti-CD68 Wild type mdx Non Ex Non Ex Wild type mdx Anti-iNOS * * Non Ex Non Ex Wild type mdx Anti-CD163 * CD68 CD206 A C CD11b+ mdx mdx + Exercise Neutrophils Monocytes F4 /8 0+ Ly 6C + C D 68 + CD68+ / CD11b+ (monocytes/macrophages) mdx mdxEx * mdx mdxEx * F4/80+ / CD11b+ (mature macrophages) mdx mdxEx Ly6C+ / CD11b+ (monocytes /neutrophils) mdx mdxEx Ly6C+ / CD11b- % o f d ou bl e po si tiv e ce lls % o f d ou bl e po si tiv e ce lls % o f d ou bl e po si tiv e ce lls % o f d ou bl e po si tiv e ce lls B an d in te ns ity (A U ) B an d in te ns ity (A U ) B an d in te ns ity (A U ) iNOS CD163 GAPDH Ly6C+/CD11b+ Ly6C+/CD11b- p ri n t & w e b 4 C = F P O Figure 1 Markers Q26of immune cells in gastrocnemius muscle of 8-week-old wild-type and mdx mice after 4 weeks of low-intensity training. A: Monocyte and macrophage populations were identified by immunofluorescence staining of gastrocnemius muscle from wild-type and mdx mice, with anti-CD68 (green), antiCD206 (red) antibodies and corresponding DAPI (blue) staining. B: Expression of CD68, inducible nitric oxide synthase (iNOS), and CD163 was assessed by Western blot and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). C: Composition of monocyte and macrophage populations was confirmed by flow cytometry with the following fluorescently labeled antibodies: PE Q27-CD68, PE-Ly6C, PE-F4/80, and APC-CD11b. Data are expressed as means SD (B and C) Q28. n Z 4 to 5 mice per group Q29(). *P < 0.05 indicates a significant difference between two groups. Scale bar Z 100 mm (A). AU, arbitrary unit; Ex, exercised; Non, nonexercised. LIT or C5a Inhibition Rescues the mdx Phenotype 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 metabolism, such as ACC and AMPK b, was significantly lower in treated muscles, compared with treated and exercised ones (Figure 5A). Furthermore, levels of the fast isoform of troponin T and of myosin binding protein C were The American Journal of Pathology - ajp.amjpathol.org FLA 5.4.0 DTD AJPA2563_proof significantly higher and the level of the slow isoform of myosin binding protein C was significantly lower in treated muscles, compared with treated and exercised ones (Figure 5B). These results support the hypothesis of a 5 620 14 March 2017 6:10 pm EO: AJP16_0339 A B C D E F Figure 2 Expression Q30of cytokines and chemokines in gastrocnemius muscle of 8-week-old wild-type and mdx mice after 4 weeks of low-intensity training. Relative expression of cytokines and chemokines in muscle lysates was quantified using the Proteome Profiler array. A: Total array images. B: Cropped array images. C: Quantification of representative data. Open bars, nonexercised; closed bars, exercised mice. Expression profile of C5a complement, and CCL2 and TIMP-1 expression was confirmed by Western blot (D) and ELISA (E and F), respectively. Ponceau red staining is shown as loading control. *P < 0.05, ***P < 0.001 indicate a significant difference between two groups. Data are expressed as means SD (DeF) Q31. AU, arbitrary unit; Ex, exercised; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GM Q32-CSF, ---; IFN-g, interferon-g; Non, nonexercised; TNF-a, tumor necrosis factor-a; WT, wild type. Hyzewicz et al 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 switch toward glycolytic fast-type fibers in treated muscles. On the opposite, treated and exercised ones tended toward oxidative slow-type fibers. Fast muscles are more likely to be solicited in the grip strength test, which could be a second reason why treatment with NOX-D21 improved grip strength, whereas treatment and exercise together caused a reduction of grip strength. 6 FLA 5.4.0 DTD AJPA2563_proo Effect of NOX-D21 Treatment or Low-Intensity Training on Macrophage Infiltration Immunostaining of gastrocnemius muscle for the monocyte/macrophage marker CD68 suggested that nonexercised mdx mice had slightly more infiltration of these cells than wild-type mice. Both exercise and NOX-D21 ajp.amjpathol.org - The American Journal of Pathology 744 f 14 March 2017 6:10 pm EO: AJP16_0339 B C5a inhibition (NOX-D21) CCL2 inhibition (mNOX-E36) mdx mice WT mice Swimming WT (Nonexercised wild type) 4 weeks old 8 weeks old Non (Nonexercised mdx) D21 or E36 C5a inhibitor (NOX-D21) or CCL2 inhibitor (mNOX-E36) Ex (Exercised mdx) A (Nonexercised, treated mdx) Grip strength * * * Weight * Force/weight ** * WT mdx D21 D21Ex Ex Non WT mdx D21 D21Ex Ex Non WT mdx D21 D21Ex Ex Non Grip strength Weight Force/weight WT mdx E36 E36Ex Ex Non WT mdx E36 E36Ex Ex Non WT mdx E36 E36Ex Ex Non * * * * C5a inhibitor (NOX-D21) or CCL2 inhibitor (mNOX-E36) Swimming D21Ex or E36Ex (Exercised, treated mdx) C m g/ m m g m g/ m m /g m g/ m m g m g/ m m /g * * U ni t p er li te r U ni t p er li te r C5a inhibition (NOX-D21) CCL2 inhibition (mNOX-E36) Serum creatine kinase WT mdx E36 E36Ex Ex Non WT mdx D21 D21Ex Ex Non 0.4 0.3 0.2 0.1 0 0.4 0.3 0.2 0.1 0 0.4 0.3 0.2 0.1 0 0.4 0.3 0.2 0.1 0 , , ,, Figure 3 Force Q33and weight of mice treated with the C5a inhibitor NOX-D21, the CCL2 inhibitor mNOX-E36, or subjected to low-intensity training. A: Mice were treated with L-aptamers (C5a inhibitor NOX-D21 or CCL2 inhibitor mNOX-E36) or exercised according to the experimental plan II. B: Functional readout parameters. C: Level of serum creatine kinase. Data are expressed as means SD (B and C). Q34*P < 0.05, **P < 0.01 indicate a significant difference between two groups. LIT or C5a Inhibition Rescues the mdx Phenotype The American Journal of Pathology - ajp.amjpathol.org 7 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 FLA 5.4.0 DTD AJPA2563_proof 14 March 2017 6:10 pm EO: AJP16_0339 ½F6 W ild ty pe N on m dx E x D 21 H&E NADH IgG A B Centronucleated fibers NADH positive fibers D 21 E x WT mdx D21 D21Ex Ex Non % o f c en tro nu cl ea te d fib er s WT mdx D21 D21Ex Ex Non % o f s ta in ed a re a IgG positive fibers * * * WT mdx D21 D21Ex Ex Non % o f s ta in ed a re a * 0.5 0.5 0.25 p ri n t & w e b 4 C = F P O Figure 4 Histological Q35evaluation of muscle from mice treated with the C5a inhibitor NOX-D21 or subjected to low-intensity training. A: Hematoxylin and eosin (H&E), IgG, and NADH stainings of gastrocnemius muscles from wild-type and mdx mice. B: Corresponding ratios of centronucleated, IgG-positive, and NADH-positive fibers calculated from A. Data are expressed as means SD (B). Q36*P < 0.05 indicates a significant difference between two groups. Scale bar Z 200 mm (A). Ex, exercised; Non, nonexercised; WT, wild type. Hyzewicz et al 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 treatment further increased the number of CD68þ cells. Staining for the M2 macrophage marker CD206 showed no differences between the groups (Figure 6A and Supplemental Figure S1B). Subsequently, the presence of CD68þ, iNOSþ (M1 macrophages), and CD163þ (M2 macrophages) in gastrocnemius muscle was quantified by Western blot. As expected, both NOX-D21etreated and exercised mdx groups showed a significantly higher 8 FLA 5.4.0 DTD AJPA2563_proo amount of CD68þ cells compared to both wild-type animals and nonexercised mdx controls. The difference between the NOX-D21etreated and the exercised group was not significant (Figure 6B). Comparison of iNOS and CD163 expression between the NOX-D21etreated and the control mdx mice showed a ratio of M1/M2 macrophages in favor of M1 macrophages in animals treated with NOXD21, as well in treated-exercised mice (Figure 6B). ajp.amjpathol.org - The American Journal of Pathology 992 f 14 March 2017 6:10 pm EO: AJP16_0339 ½F7 0 1 2 3 4 5 6 7 8 9 10 0 1 2 3 0 1 2 3 4 5 6 7 0 1 2 3 4 5 6 7 A GAPDH AMPKβ ACC B WT Ex mdx D21Non Level of AMPKLevel of ACC * WT mdx D21 D21Ex Ex Non D21Ex * * A U A U WT mdx D21 D21Ex Ex Non * * * WT Ex mdx D21Non D21Ex MBPC fast Level of troponin T fast B an d in te ns ity (A U ) * ** * Level of MBPC fast B an d in te ns ity (A U ) Level of troponin T slow Level of MBPC slow B an d in te ns ity (A U ) B an d in te ns ity (A U ) * * * MBPC slow Troponin T fast Troponin T slow WT Ex mdx D21Non D21Ex mdx WT D21 D21Ex Ex Non mdx WT D21 D21Ex Ex Non mdx WT D21 D21Ex Ex Non mdx WT D21 D21Ex Ex Non * * *** ** * * * 0.5 0 0 1 2 31.5 1 p ri n t & w e b 4 C = F P O Figure 5 Expression Q37of proteins in gastrocnemius muscle of mdx mice treated with NOX-D21 and/or subjected to low-intensity training. Expression of ACC and AMPK Q38was evaluated by Western blot and normalized to glyceraldehyde-3-phosphate dehydrogenase (GADPH). A: Western blot of all three proteins was performed on the same membrane, but the positions of the bands D21 and Ex were interchanged. B: Expression of myosin binding protein C (MBPC) and troponin T, fast and slow isoforms, was evaluated by Western blot and normalized to Ponceau red staining. Data are expressed as means SD Q39. *P < 0.05, **P < 0.01, and ***P < 0.001 indicate a significant difference between two groups. AU, arbitrary unit; Ex, exercised; Non, nonexercised; WT, wild type. LIT or C5a Inhibition Rescues the mdx Phenotype 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 FACS analysis of monocyte (Ly6Cþ), macrophage (F4/80þ), and monocyte/macrophage (CD68þ) populations confirmed that CD68þ/CD11bþ cells increased in NOXD21etreated or exercised mdx muscles, compared with nonexercised ones (Figure 6C). Inhibition of C5a significantly decreased the quantity of monocytes/neutrophils (CD11bþ/Ly6Cþ) in muscle of NOX-D21etreated mdx mice, compared with control ones, which was concordant with the fact that C5a acts as a chemoattractant for these two populations.24 However, Western blot analysis for the neutrophil enzyme myeloperoxidase showed no difference of expression between groups (Figure 7F). Finally, the quantity The American Journal of Pathology - ajp.amjpathol.org FLA 5.4.0 DTD AJPA2563_proof of mature macrophages (F4/80þ/CD11bþ) was significantly increased in muscle of both treated and exercised mice, compared with nonexercised ones. This result suggests that treatment with NOX-D21 or exercise alone leads to an increased presence of differentiated F4/80þ macrophages. Cytokine and Chemokine Levels in Gastrocnemius Muscle of 8-Week-Old mdx Mice after NOX-D21 Treatment or Low-Intensity Training Cytokine and chemokine levels in gastrocnemius muscle extracts were determined by multiplex cytokine/chemokine 9 1116 14 March 2017 6:10 pm EO: AJP16_0339 Anti-CD68 Wild type C D 68 C D 20 6 Non mdx Ex D21 CD68 GAPDH iNOS CD163 WT Ex mdx D21Non A B Anti-iNOS Anti-CD163 C mdx D21 Ex Non mdx D21 Ex Non mdx D21 Ex Non mdx D21 Ex Non * * * WT mdx D21 Ex Non CD68+ / CD11b+ (monocytes/macrophages) F4/80+ / CD11b+ (mature macrophages) Ly6C+ / CD11b+ (monocytes /neutrophils) Ly6C+ / CD11b- CD11b+ F4 /8 0+ Ly 6C + C D 68 + Non D21 Ex mdx /0'&12&$--31 /0'&12&$--34 D21Ex D21Ex D21Ex WT mdx D21 Ex Non WT mdx D21 Ex Non D21Ex D21Ex B an d in te ns ity (A U ) B an d in te ns ity (A U ) B an d in te ns ity (A U ) % o f d ou bl e po si tiv e ce lls % o f d ou bl e po si tiv e ce lls % o f d ou bl e po si tiv e ce lls % o f d ou bl e po si tiv e ce lls p ri n t & w e b 4 C = F P O Figure 6 Markers Q40of immune cells in gastrocnemius muscle of mdx mice treated with NOX-D21 and/or subjected to low-intensity training. A: Monocyte and macrophage populations were identified by immunofluorescence staining of gastrocnemius muscle with anti-CD68 (green) or anti-CD206 (red) antibodies and by DAPI staining (blue). B: Expression of CD68, inducible nitric oxide synthase (iNOS), and CD163 was assessed by Western blot and normalized to glyceraldehyde-3-phosphate dehydrogenase (GADPH). Western blots were performed on the same membrane, but the positions of the bands D21 and Ex were interchanged. C: Composition of monocyte and macrophage populations was confirmed by flow cytometry with the following fluorescently labeled antibodies: PE Q41-CD68, PE-Ly6C, PE-F4/80, and APC-CD11b. Data are expressed as means SD (B and C) Q42. *P < 0.05, **P < 0.01 indicate a significant difference between two groups. Scale bar Z 100 mm (A). AU, arbitrary unit; Ex, exercised; Non, nonexercised; WT, wild type. Hyzewicz et al 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 array analysis (Figure 7, A and B), as shown in Figure 1 for untreated mice. As expected, the presence of complement C5a was not affected by treatment with NOX-D21, because the L-aptamer acts by binding its target protein and inhibits 10 FLA 5.4.0 DTD AJPA2563_proo its interaction with the receptor.25 We found that the level of IL-1RA was significantly higher in mdx gastrocnemius muscle compared to wild-type muscle (Figure 7C), as confirmed by Western blot (Figure 7D). Treatment with ajp.amjpathol.org - The American Journal of Pathology 1240 f 14 March 2017 6:10 pm EO: AJP16_0339 mdxmdx (A U ) (A U ) A D E F CB Figure 7 Differential Q43cytokine and chemokine patterns in gastrocnemius muscle of mdx mice treated with NOX-D21 and/or subjected to low-intensity training. Relative abundance of cytokines and chemokines in muscle lysates was quantified using the Proteome Profiler array. A: Array images. B: Cropped array images. C: Quantification of representative data presented in B. Expression profiles of IL-1RA and TIMP-1 were confirmed by Western blot (D) and ELISA (E). Western blots were performed on the same membrane, but the positions of the bands D21 and Ex were interchanged. F: Expression of myeloperoxida Q45se (MPO) was evaluated by Western blot and normalized to glyceraldehyde-3-phosphate dehydrogenase (GADPH). Data are expressed as means SD (CeF). Q44*P < 0.05, **P < 0.01 indicate a significant difference between two groups. AU, arbitrary unit; Ex, exercised; GM-CSF, ---; IFN-g, interferon-g; Non, nonexercised; TNF-a, tumor necrosis factor-a. LIT or C5a Inhibition Rescues the mdx Phenotype 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360 1361 1362 1363 NOX-D21 alone increased IL-1RA expression above the levels of nonexercised and exercised mdx mice. Also, the IL-RA level in muscles from treated-exercised mice was still higher compared with muscles from exercised ones (Figure 7, C and D). Finally, we analyzed the expression level of TIMP-1 by ELISA, and found a higher level in muscles of treated mdx mice, as well as from The American Journal of Pathology - ajp.amjpathol.org FLA 5.4.0 DTD AJPA2563_proof treated-exercised ones, compared with exercised mdx mice (Figure 7E). Discussion The results of our study show, for the first time, that LIT reduces the inflammatory status in skeletal muscle of mdx 11 1364 14 March 2017 6:10 pm EO: AJP16_0339 ½F8 Hyzewicz et al 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414 1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440 1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452 1453 1454 1455 1456 1457 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473 1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 mice. We hypothesized first that LIT would diminish immune cell populations as well as levels of cytokines and chemokines. We also reasoned that blockade of cytokine and chemokine action would rescue the mdx phenotype. In agreement with our first hypothesis, we found that levels of C5a, CCL2, and TIMP-1 were increased in mdx skeletal muscle and that LIT lowered levels of CCL2 and TIMP-1. In parallel, populations of CD68þ/F4/80þ macrophages and inflammatory M1 macrophages were reduced in exercised mdx muscle. Furthermore, we found that inhibition of C5a by the L-aptamer NOX-D21 rescued the mdx phenotype through a reduction of muscle damage and a shift to fast muscle fibers. Unexpectedly, NOX-D21etreated mdx mice that exercised simultaneously showed increased muscle damage and a switch to slow muscle fibers. The main results are summarized in Figure 8. Inflammatory Status of Skeletal Muscle in Nonexercised mdx Mice Muscles of mdx mice are characterized by high levels of cytokines/chemokines and infiltration of immune cells.26 In agreement with previous studies, we observed an overexpression of CCL227 and TIMP-1.28 We also report, for the first time, an overexpression of the complement cleavage product C5a (Figure 2). In contrast, levels of cytokines commonly associated with an inflammatory response in myopathies, such as IL-1b, IL-6, transforming growth factorb1, insulin-like growth factor 1, or tumor necrosis factor-a,1 remained stable. Similar results were reported in a study in which the same Proteome Profiler tool was used.2 Likely, cytokines released by the muscle itself, such as CCL2 and TIMP-1,29 are more prone to be detected in full muscle extracts than those secreted by macrophages. Still consistent with previous reports, a high concentration of CD68þ cells2,30 was observed in mdx muscle (Figure 1). Previous immunohistochemical data suggest that the macrophage population shifted from the proinflammatory M1 type in the early phase of the pathology (4-week-old), to the regenerative M2 type during the late phase (12-week-old).8 Consistent with this report, we found increased levels of both M1 and M2 populations in muscles of 8-week-old mdx mice. Impact of Low-Intensity Training on the Inflammatory Status of Exercised mdx Mice We report herein, for the first time, that LIT of 4-week-old mdx mice caused a decrease of CCL2 and TIMP-1 levels in their skeletal muscle (Figure 2). The monocyte chemoattracting protein-1 (CCL2) is one of the key chemokines that regulate the migration and the infiltration of monocytes/ macrophages.31 Thus, we expected a lower concentration of infiltrated immune cells in exercised mdx muscle. In contrast, we found a higher amount of CD68þ cells (Figure 1), predominantly differentiated F4/80þ 12 FLA 5.4.0 DTD AJPA2563_proo macrophages (Figure 1C). Interestingly, within the macrophage population, the number of M1 macrophages was decreased (Figure 1B), whereas the one of M2 macrophages remained constant (Figure 1, A and B), leading to an increased M2/M1 ratio. As reported in our previous study16 and confirmed herein, LIT of mdx mice caused an improvement of grip strength and of force/weight ratio (Figure 3). Taken together, these results suggest that LIT rescued the mdx phenotype by increasing the quantity of macrophages and a shift from M1 to M2 macrophage populations. Cytokine/Chemokine Inhibition in mdx Mice Because levels of CCL2, TIMP-1, and C5a were elevated in mdx muscle (Figure 2), we assumed that their overexpression contributed to the increased inflammatory status in the dystrophic phenotype, such as in dystrophic mice or DMD patients. We excluded TIMP-1, which has been shown to be implied in remodeling of extracellular matrix,32 and focused on CCL2 and C5a for their role as chemotactic factors.31,33 Nonexercised and exercised mdx mice were treated with inhibitors of CCL2 or C5a, the Spiegelmers mNOX-E36 and NOX-D21, respectively (Figure 3A), whereby C5a inhibition led to higher physical ability of the mice, and CCL2 inhibition did not (Figure 3B). Therefore, we focused our further investigations on the inhibition of C5a. Impact of Inhibition of C5a on mdx Muscle C5 is cleaved by the C5-convertase into C5a and C5b during the activation of the complement cascade. C5a acts as an anaphylatoxin, playing a critical role in enhancement of inflammation,33 whereas C5b binds to complement components C6, C7, C8, and C9 to form the membrane attack complex ring.34 Therapeutic blockage of C5 cleavage has been shown to rescue pathological states characterized by sterile tissue inflammation, such as myasthenia gravis35 and inflammatory myopathies.36 Furthermore, it has been shown that specific inhibition of C5a, while sparing C5b, with the Spiegelmer NOX-D20, of which NOX-D21 is a follow-up compound, was enough to improve the phenotype of a murine model of sepsis.37 C5a acts as a chemoattracting factor for cells of the myeloid lineage,24 such as mast cells, neutrophils, or the CD68þ monocytes and macrophages, whose numbers are increased in mdx muscles (Figure 1). Four weeks of treatment with NOX-D21 improved the mdx phenotype (Figure 3), reduced the number of necrotic fibers (Figure 4), and switched muscle fibers to the glycolytic fast type (Figure 5). We considered that the observed reduction of infiltrated Ly6Cþ monocytes and neutrophils (Figure 6) could be the underlying reason for these beneficial effects, as it has been shown that depletion of neutrophils reduced necrosis in dystrophic muscles.38 However, immunoblot ajp.amjpathol.org - The American Journal of Pathology 1488 f 14 March 2017 6:10 pm EO: AJP16_0339 mdxmuscle Cytokines and chemokines C5a CCL2 TIMP-1 CD68+/F4/80+ macrophages M1 macrophages (iNOS+) M2 macrophages (CD163+) Infiltration of immune cells + LIT + C5a inhibition = C5a CCL2 TIMP-1 CD68+/F4/80+ macrophages M1 macrophages (iNOS+) = M2 macrophages (CD163+) = C5a = CCL2 = TIMP-1 CD68+/F4/80+ macrophages M1 macrophages (iNOS+) = M2 macrophages (CD163+) Grip strength Muscle damages Grip strength IL-1RA + C5a inhibition and LIT = C5a = CCL2 = TIMP-1 = IL-1RA CD68+/F4/80+ macrophages M1 macrophages (iNOS+) = M2 macrophages (CD163+) + Switch to fast type fibers Muscle damages Grip strength + Switch to slow type fibers A B Figure 8 Graphical summary of the study. A: Changes in cytokine levels and immune cell populations in gastrocnemius muscle of mdx mice compared with muscle wild-type mice. B: Changes in cytokine levels, immune cell populations, and muscle damage in gastrocnemius muscle of mdx mice after low-intensity training (LIT) and/or treatment with the C5a complement inhibitor, compared with untreated mdx mice. iNOS, inducible nitric oxide synthase. LIT or C5a Inhibition Rescues the mdx Phenotype 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500 1501 1502 1503 1504 1505 1506 1507 1508 1509 1510 1511 1512 1513 1514 1515 1516 1517 1518 1519 1520 1521 1522 1523 1524 1525 1526 1527 1528 1529 1530 1531 1532 1533 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 1553 1554 1555 1556 1557 1558 1559 1560 1561 1562 1563 1564 1565 1566 1567 1568 1569 1570 1571 1572 1573 1574 1575 1576 1577 1578 1579 1580 1581 1582 1583 1584 1585 1586 1587 1588 1589 1590 1591 1592 1593 1594 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 analysis using the neutrophil marker myeloperoxidase was not supporting this hypothesis (Figure 7). Because C5a also attracts monocytes, we expected a lower amount of CD68þ cells in muscle of treated mdx mice. Yet, numbers of CD68þ/F4/80þ macrophages increased in these muscles. This could be because of proliferation of resident tissue macrophages. These cells represent a heterogeneous population of local immune cells, different from the circulating populations, which are produced by hematopoiesis.39 A recent study showed that depletion of circulating monocytes enhanced the proliferation of resident macrophages in skeletal muscle after injury.40 Thus, inhibition of C5a possibly reduced infiltration of circulating monocytes but The American Journal of Pathology - ajp.amjpathol.org FLA 5.4.0 DTD AJPA2563_proof stimulated the proliferation or differentiation of their local progenitors. Finally, C5a inhibition increased the expression of the IL-1 receptor antagonist, IL1-RA. Previous studies showed that treatment with recombinant IL1-RA improved the grip strength of mdx mice,41 which is in accordance with our results. Increased expression of IL1-RA in NOXD21etreated muscles appears paradoxical at first sight, because IL1-RA is mainly produced by neutrophils42 or M2 macrophages.43 However, a previous study showed that inhibition of another chemoattracting molecule, P-selectin, also leads to decreased neutrophil infiltration, increased numbers of macrophages, and increased 13 1612 14 March 2017 6:10 pm EO: AJP16_0339 Hyzewicz et al 1613 1614 1615 1616 1617 1618 1619 1620 1621 1622 1623 1624 1625 1626 1627 1628 1629 1630 1631 1632 1633 1634 1635 1636 1637 1638 1639 1640 1641 1642 1643 1644 1645 1646 1647 1648 1649 1650 1651 1652 1653 1654 1655 1656 1657 1658 1659 1660 1661 1662 1663 1664 1665 1666 1667 1668 1669 1670 1671 1672 1673 1674 1675 1676 1677 1678 1679 1680 1681 1682 1683 1684 1685 1686 1687 1688 1689 1690 1691 1692 1693 1694 1695 1696 1697 1698 1699 1700 1701 1702 1703 1704 1705 1706 1707 1708 1709 1710 1711 1712 1713 1714 1715 1716 1717 1718 1719 1720 1721 1722 1723 1724 1725 1726 1727 1728 1729 1730 1731 1732 1733 1734 1735 expression of IL1-RA in nerve, which is consistent with our observations.44 Impact of Inhibition of C5a on Exercised mdx Muscle The phenotype of mdx mice was improved after 4 weeks of LIT or treatment with NOX-D21. We assumed that exercise and C5a inhibition would act together to improve the quality of mdx muscle. However, treated and exercised mdx mice had lower grip strength (Figure 3), experienced muscle damage (Figure 4), and their muscles were switched toward the oxidative slow type (Figure 5). We expected that differences between treated, and treated and exercised mdx mice would be reflected by a difference in immune cell population. However, numbers of CD68þ cells increased and the balance M1/M2 macrophages leaned in favor of the M1 type (Figure 6). The only difference observed was in the level of IL-1RA, which was slightly, but not significantly, higher in nonexercised NOX-D21etreated mdx mice, compared to exercised treated ones. Thus, further investigations will be necessary to understand the reason for the discrepancy between LIT and C5a inhibition.
Conclusion
In this study, we have used immunoblotting, FACS, and immunochemistry to assess the effects of 4 weeks of LIT on expression of cytokine/chemokine levels and on populations of macrophages in gastrocnemius muscle of 8-week-old mdx mice. We observed that the inflammatory mediators CCL2 and C5a were overexpressed, the number of CD68þ monocytes/macrophages was increased, and that the macrophage population shifted to the proinflammatory M1 type. LIT reduced the expression of CCL2, increased the concentration of CD68þ/F4/80þ cells, and shifted the macrophage population to the regenerative M2 type. Furthermore, we demonstrated that inhibition of C5a complement rescued the mdx phenotype, possibly by promoting IL-1RA expression, reducing muscle damage and switching muscle fibers toward the fast glycolytic type. However, simultaneous LIT and pharmacological C5a inhibition with NOX-D21 counteracted each other and led to a switch toward slow fiber type. The present results reveal the effects of LIT on the inflammatory status of mdx mice and suggest that NOX-D21 could become an anti-inflammatory drug for DMD patients.
Acknowledgments
We thank Drs. Yoshitsugu Aoki and Shouta Miyatake as well as the members of the Department of Molecular Therapy, National Institute of Neuroscience, National Center of Neurology and Psychiatry, for support and useful discussions; the members of the small animal facility, National Institute of Neuroscience, for technical assistance; 14 FLA 5.4.0 DTD AJPA2563_proo and Benjamin Raveney (National Institute of Neuroscience) for discussions.
Supplemental Data
Supplemental material for this article can be found at http://dx.doi.org/10.1016/j.ajpath.2016.12.019.
Article Images (0)
×![]()
Bioz is the world’s most comprehensive AI search engine for scientific experimentation. The Bioz search engine offers researchers billions of data-driven product, technique, and protocol recommendations. Bioz taps into the latest advances in Artificial Intelligence (AI) – including Natural Language Processing (NLP), Machine Learning (ML) and Generative AI to mine and structure hundreds of millions of pages of complex and unstructured scientific papers. By harnessing the power of AI, Bioz provides researchers with an unprecedented amount of summarized scientific experimentation knowledge right at their fingertips, ultimately helping to speed up drug discovery and the rate of success in finding cures for diseases. Bioz is used by over 15 Million researchers from over 17,000 different universities and companies in 196 countries.
