Article Images (0)
×![]()
featured_play_listSave article to folder
X
Create new folder
Full Text
PDF
Table of Contents
Abstract
Summary
Results
Discussion
Experimental Procedures
Bactericidal Assay
SDS-PAGE And Western Blotting
Yeast Two-Hybrid Assays
Pull-Down Assays And Dot Blots
Comparative Genomics And Prediction Of GIs
Identification Of Genes
Quantitative Real-Time PCR (QRT-PCR) Analysis
Ethics Statement
Acknowledgments
Funding
Figure Legends
Abstract
through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/cmi.12724 This article is protected by copyright. All rights reserved. Pathogenic Streptococcus strains employ novel escape strategy to inhibit bacteriostatic effect mediated by mammalian peptidoglycan recognition protein
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/cmi.12724 This article is protected by copyright. All rights reserved. Pathogenic Streptococcus strains employ novel escape strategy to inhibit bacteriostatic effect mediated by mammalian peptidoglycan recognition protein Jing Wang 1#* , Youjun Feng 2# , Changjun Wang 4 , Swaminath Srinivas 2,6 , Chen Chen 5 , Hui Liao 1 , Elaine He 8 , Shibo Jiang 7 , Jiaqi Tang 3* 1 Translational Medicine Center, PLA Hospital No. 454, Nanjing 210002, China 2 Department of Medical Microbiology Parasitology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058, China 3 PLA Research Institute of Clinical Laboratory Medicine, Nanjing General Hospital, Nanjing Military Command, Nanjing 210002, China 4 Department of Epidemiology, Medicinal Research Institute, Nanjing Military Command, Nanjing 210002, China 5 Chinese Center for Disease Control and Prevention, Beijing 102206, China 6 Department of Biochemistry, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801, USA 7 Lindsley F. Kimball Research Institute, New York Blood Center, New York, NY 10065, USA 8 The Warren Alpert Medical School of Brown University，Providence, RI, 02912, USA. # these authors contributed equally to this work. *Corresponding authors: E-mail: wj6373@hotmail.com (JW); tjq85@hotmail.com (JT). Running title: Pathogenic Streptococcus escapes PGRP killing This article is protected by copyright. All rights reserved.
Summary
Pathogenic streptococcal species are responsible for some of the most lethal and prevalent animal and human infections. Previous reports have identified a candidate pathogenicity island (PAI) in two highly virulent clinical isolates of Streptococcus suis type 2 (SS2), a causative agent of high-mortality streptococcal toxic shock syndrome (STSS). This PAI contains a Type-IVC secretion system C subgroup (Type-IVC secretion system) that is involved in the secretion of unknown pathogenic effectors that are responsible for STSS caused by highly virulent strains of SS2. Both virulence protein B4 (VirB4) and virulence protein D4 (VirD4) were demonstrated to be key components of this Type-IVC secretion system. In this study, we identify a new PAI family across 3 streptococcal species, streptococcus genomic island contains type IV secretion system (S4GI), which contains a GI-type IVC secretion system and a novel PPIase molecule, SP1. SP1 is shown to interact with a component of innate immunity, peptidoglycan recognition protein (PGLYRP-1), and to perturb the PGLYRP-1-mediated bacteriostatic effect by interacting with protein PGLYRP-1. Our study elucidates a novel mechanism by which bacteria escape by components of the innate immune system by secretion of the SP1 protein in pathogenic streptococci, which then interacts with PGLYRP-1 from the host. Our results provide potential targets for the development of new antimicrobial drugs against bacteria with resistance to innate host immunity. Keywords: Streptococcus, PAI, PGRP, GI-type IVC secretion system This article is protected by copyright. All rights reserved. Mobile Genetic elements, such as plasmids, bacteriophages, transposons, integrative (Int)/conjugative elements, and genomic islands (GIs), encompass genes that afford bacteria with a competitive and adaptive advantage by providing traits that may increase fitness under different environmental conditions (Juhas et al., 2009) and defeat host immune system defenses under extreme environmental conditions (Tuanyok et al., 2008). GIs are usually transferred by horizontal gene transfer and are sub-classified on the basis of the function they perform like symbiosis, antimicrobial resistance or pathogenesis (Dobrindt et al., 2004). Those involved in pathogenesis are called Pathogenicity Islands (PAIs). It is well accepted that PAIs may contribute to the virulence of a wide variety of pathogenic bacteria such as E. coli (Middendorf et al. 2001), Salmonella(Cabello et al., 1997), E. faecalis (Nallapareddy et al., 2005), S. aureus (Lindsay et al., 1998), S. pneumoniae (Brown et al., 2001) and S. suis (Tang et al., 2006). In the present study, we focus on three pathogenic species of Streptococcus: S. suis, S. pneumoniae and S. agalactiae. S. suis is responsible for a variety of diseases in pigs, including meningitis, septicemia, arthritis, and pneumonia. It is also a severe zoonotic pathogen that has caused occasional cases of meningitis and sepsis in humans (Segura et al.,, 2014) and several outbreaks of streptococcal toxic shock syndrome (STSS) in China (Tang et al.,, 2006). S. pneumoniae is a lethal bacterial pathogen that is the leading cause of community-acquired pneumonia, sepsis, and meningitis, which collectively results in over one million deaths each year worldwide (Krone et al.,, 2014; van der Poll et al.,, 2009) and causes ~10% of all deaths in children in the first 5 years of life (Okumura et al., 2014). S. agalactiae is a Lancefield Group B Streptococcus (GBS) and is the leading cause of meningitis and sepsis in newborns. Additionally, this pathogen is the cause of serious infections in immunocompromised adults. Clinical manifestations of infection include urinary tract and soft tissue infections, as well as life-threatening sepsis and meningitis (Cotton et al., 2012; Chang et al., 2014). The ability of some streptococci to escape the human innate immune response is very complex, and most examples are not well characterized (Okumura et al., 2014). In our previous efforts, an 89-kb pathogenicity-island (89K PAI)-like structure had been This article is protected by copyright. All rights reserved. identified in the highly virulent Chinese strain of Streptococcus suis serotype 2, 05ZYH335. This 89K PAI structure included a specific Type-IVC secretion system that is common in the genus Streptococcus (Chen et al., 2007; Zhang et al., 2012). It was further demonstrated that VirB1 (SSU05_0968), VirB4 (SSU05_0969) and VirD4 (SSU05_0973) are the minimal key components of the Type-IVC secretion system and that VirB4 and VirD4 of the highly virulent Chinese strains are essential for the secretion of several unknown pathogenic effectors responsible for high-mortality STSS caused by the highly virulent strains (Li et al., 2011; Zhao et al., 2011). In the present study, we evaluated six genomes from these three species of Streptococcus. The results revealed a new PAI family with a structure similar to that of the 89K PAI in S. suis strain S4GI, which caused the STSS epidemic. This PAI is also characterized by a novel GI-type IVC secretion system, as well as a novel molecule, SP1 (SSU05_0942,Fig. S1), that is distributed throughout the genus Streptococcus and may play an important role in bacterial escape from the host innate immune system response. Upon further investigation, we found that the secretion of SP1 depends on this GI-type IVC secretion system and that SP1 can interact with the innate immunity protein PGLYRP-1. PGLYRP-1 is mainly present in polymorphonuclear leukocyte granules and is directly bactericidal to both Gram-positive and Gram-negative bacteria (Dziarski et al., 2010; Royet et al., 2007). Most importantly, our data suggests that SP1 blocks the bacteriostatic defense function of PGLYRP-1, thus revealing a hitherto unknown strategy that enables the escape of pathogenic Streptococcus from the innate immune response. This article is protected by copyright. All rights reserved.
Results
Distribution and structural features of the S4GI family In order to resolve the structural features of GIs across the boundaries of different streptococcal subspecies, a study was conducted using the model provided by Vernikos and Parkhill (Vernikos et al., 2008). 67 streptococcal genomes across 12 different genera found on public databases, including the NCBI and Sanger Institute databases were analyzed and then compared side-by-side using the Artemis Comparison Tool (ACT) (Carver et al., 2008), which enabled genomic alignment and visualization of BLASTN results. Intriguingly, 6 reference strains in three different genera displayed structurally similar GIs (Table S1). The sequence of 15-bp direct repeats from the 3’- end of sequences of the highly conserved ribosome l7/l12 genes are predicted to be involved in the integration of all 15S GIs. To the best of our knowledge, this is the first report of such l7/l12-specific recombination. Structurally, though the S4GIs share the 15-bp direct repeats in common, they also share variant G+C content with their host bacteria. Large arrays of proven and putative GIs or PAIs from Gram-positive bacteria have generally had a low G+C content, although a few have had higher G+C contents. Among the 6 reference streptococcal strains, the G+C contents of the S4GIs in S. pneumoniae ATCC700669 and CGSP14, as well as those in S. suis 05ZYH33 and BM407, were significantly lower than the overall G+C content of their hosts. On the other hand, the G+C contents of the S4GIs in S. agalactiae 2603V/R and NEM316 were higher (Table S1, Fig. 1). Moreover, we found that these S4GIs contained mobility genes that 1) encode a site-specific recombinase/integrase downstream of attL and 2) encode a replication initiator located upstream of attR. Distribution analyses of these S4GIs using bacterial genomes downloaded from GenBank indicated that they were not related to the serotypes of streptococcal subspecies (Fig. S2). By comparing the genes carried by these S4GIs, the same GI-type IVC secretion system and a novel protein, SP1, were identified (Table S2). These S4GIs were structurally similar to the previously described 89K PAI, which was found to be specific to the strains of S. suis that caused the STSS epidemic. This article is protected by copyright. All rights reserved.
SP1 interacts with PGLYRP-1
To understand the roles of proteins encoded in the 89K PAI of S. suis serotype 2 in the development of STSS, we focused on SP1 from the 89K PAI, a molecule of unknown function predicted to be a member of the PPIase family (Fig. S1). A human-yeast two-hybrid leukocyte cDNA library was screened using the SP1 protein from strain 05ZYH33 as bait. Clones that grew in the absence of tryptophan, leucine, histidine and adenine were processed for a β-galactosidase assay, blue colonies were picked, and 13 colonies were selected for further analysis. The nucleotide sequences of the clones from the cDNA library were analyzed, and the full-length sequences were obtained using Vector NTI Advance 11 and a BLAST database homology search (http://www.ncbi.nlm.nih.gov/). These clones were sequenced, revealing 4 different genes. Of these 4 genes, only pglyrp-1, which encodes the PGLYRP-1 protein, does not belong to the potential of false positive clones (neither a transcription factor nor a transcriptional regulator). To confirm the protein-protein interaction between SP1 and PGLYRP-1, experiments were performed in yeast. Yeast strain AH109, containing a pGBKT7-SP1 plasmid, was mated with strain Y187, containing pGADT7-PGLYRP-1. The diploid yeast cells were plated on quadruple dropout (QDO) medium (Fig. 2A). The blue colonies were lifted onto a filter and measured for β-galactosidase activity using a colony-lift filter assay (Fig. 2B). The yeast two-hybrid experiments demonstrated that SP1 bound to PGLYRP-1. We expressed and purified soluble rSP1 and PGLYRP-1 using E. coli and HEK293T cells (Fig 2C). We further demonstrated that SP1 from 6 reference streptococcal strains could interact with PGLYRP-1 in a pull-down assay (Fig. 2D). To predict which domain of SP1 binds to PGLYRP-1, we constructed pET-32 plasmids harboring SP1 C-terminal truncates that were generated by PCR from pET-32-SP1 (1-212 aa). The dot blot results indicated that the truncated mutant of SP-1 (residues 1-162) showed PGLYRP-1-binding activity, and the region (residues 50-162) of SP-1 showed weak PGLYRP-1-binding activity (Fig. 2E). In ELISA, the apparent dissociation constant (KD) of SP1 binding to immobilized PGLYRP-1 (KD≈0.9 to 2.5 nmol/Lfor SP1 and residues 50-212) was 30- to 80-fold higher than that of the fragments of SP-1, (KD≈75 nmol/L for residues 1-112，50-112 and 100-212). This article is protected by copyright. All rights reserved. SP1 inhibit the bacteriostatic function of PGLYRP-1 To further understand the role of SP1 protein against PGLYRP-1-mediated killing of bacteria, the sp1 gene was knocked out, and the mutants were treated with human PGLYRP-1. A comparison of basic biological characteristics, including growth rates, length of chains, thickness of capsular material, and hemolytic activity, did not reveal any noticeable differences between the mutants and their WT strains. However, these knockout mutants were much more sensitive to the bacteriostatic activity of human PGLYRP-1. Although PGLYRP-1 was ineffective against other WT streptococcal strains, it maintained high bacterial activity against their ∆sp1 mutants. Moreover, added rSP-1 could effectively inhibit PGLYRP-1-mediated bacteriostatic function of SP-1-negative mutants (Fig. 3AB). Extracellular secretion of SP1 depends on Type-IVC secretion system transport It was previously demonstrated by us that deletion of either virD4 or virB4 of the Type-IVC secretion system leads to loss of the lethality of the highly virulent S. suis serotype 2 in infected mice (Zhao et al., 2011). Therefore, it was expected that the Type-IVC secretion system induced the transfer of pathogenic effectors. The reactivity bands of SP1 were stronger in the cell of WT strains than ∆virB4 mutants (Fig. 4A). This means that out, missing ΔVirB4 will significantly affect the SP1 protein transport from the intracellular to extracellular. Although SP1 was detected inbacterial culture supernatant, its concentration was significantly higher in the WT strains compared to both ∆virB4 and ∆virD4 mutants (Fig. 4B). The six different Streptococcus strains produce roughly the same amount of SP1 and show roughly the same reduction upon mutation of VirB4/D4. For this reason we believe that maybe the secretion of SP1 in these six strains of Streptococcus depends on Type-IVC secretion system transport to deal with the same concentration PGLYRP-1 under the same culture conditions as used in vitro. To further determine the SP1 protein concentrations secreted by the different Streptococcus This article is protected by copyright. All rights reserved. strains are specifically related to corresponding ∆virB4 / D4 mutants, we used excess of anti-SP-1 resin adsorption to the culture supernatant, followed SP1 were undetectable by ELISA and Western blot (Data no shown). These results indicate that both the VirD4 and VirB4 components of the Type-IVC secretion system are necessary for the extracellular secretion of SP1, providing further evidence that SP1 can interfere with PGLYRP-1-mediated bacterial killing. PGLYRP-1 induced synthesis of sp1 mRNA Previous research indicates that PGRPs rapidly induce high levels of htrA mRNA in WT B. subtilis and cpxP mRNA in WT E. coli by activating regulators via a sensor (Kashyap et al., 2011). To identify the stress response reaction in PGLYRP-1-treated streptococcal strains, we measured sp1 mRNA levels using quantitative reverse transcription real-time polymerase chain reaction (qRT-PCR). We observed that sp1 mRNA accumulated rapidly in 6 streptococcal strains during exponential growth, which occurred concomitantly with an increase in sp1 mRNA stability that was proportional to the concentration of PGLYRP-1 in the culture medium (Fig. 5).
Discussion
GIs with structural similarity to the 89K PAI of S. suis serotype 2 which was responsible for the outbreaks of STSS in China (Tang et al., 2006) were in six genomes from three species of Streptococcus. These GIs share two 15-bp direct repeats in two respective attachment sites, attL and attR, of the streptococcal genome, where they integrate in a site-specific manner. GIs often carry genes that confer a selective advantage to the host bacterium in a specific environment (Vernikos et al., 2008). This study reveals the presence of genes belonging to the 3 species of the genus Streptococcus in the six S4GIs, with only a few genes in the S4GIs being found in any single strain or species (Fig. S2). However, by comparing protein sequences encoded by genes in all the S4GIs, a range of G+C deviations content could be observed (Table S1). In addition, the genomic positions of these GIs were not random. Generally, approximately 75% of currently known GIs are inserted at the 3’-end of a tRNA locus (Vernikos et al., 2008; Jain et al., 2011). A few other genes may also act as This article is protected by copyright. All rights reserved. integration sites for GIs, such as Salmonella genomic island 1 (SGI1), which exhibits site-specific integration into S. enterica, E. coli, or P. mirabilis chromosomes at the 3' end of the thdF gene (Doublet et al., 2008). The results of analyses performed in the present study indicated that 6 strains of 3 species of pathogenic streptococci comprising S. suis, S. pneumoniae and S. agalactiae, also carried a PAI similar in structure to the 89K PAI in S. suis serotype 2. Phylogenetic analyses and the distributions of homologous genes revealed no obvious species specificity for the S4GIs. In other words, the genes of the S4GIs have similar sources, except for the basic structure of GIs (Figs. S2 and S3). The most conserved genes located on S4GIs are those for the Type-IVC secretion system, a novel gene sp1, as well as the mobility genes often located on GIs (e.g., integrase and replication initiator protein A). S. suis, S. pneumoniae and S. agalactiae are known to be highly successful pathogens in both human and animal hosts (Toivanen et al., 2010; Pan et al., 2014). It is well established that bacterial type IV secretion systems (T4SS) are evolutionarily related to conjugation systems, play a pivotal role in infection, and are vital to bacterial survival (Kubori et al., 2014; Low et al., 2014). We describe a new PAI family containing a GI-Type IVC secretion system and a sp1 gene that might serve to explain how these three streptococcal species escape from the host immune system. The key components of the system involved in highly pathogenic S. suis type 2 mortality are highly correlated (Skippington et al., 2011). The GI-type IVC secretion system is versatile and secretes a wide variety of substrates, from single proteins to protein-protein and protein-DNA complexes in pathogenic bacteria (Zhang et al., 2012). Protein molecules transported across the bacterial membrane via T4SS include numerous virulence factors (Kubori et al., 2014) which could play a role in overcoming the host innate immune system. We have demonstrated that SP1 is a secreted protein and is partially dependent on the GI-type IVC secretion system; more importantly, we further identified that the SP1 protein can interact with the bactericidal innate immunity protein PGLYRP-1. The bactericidal activity of PGLYRPs depends on its interaction with peptidoglycan found in the cell wall and particularly in cell separation sites where its binding activates the CssR-CssS two-component system, which senses extracytoplasmic misfolded proteins. CssR-CssS triggers membrane depolarization and [OH] - production, which results in the This article is protected by copyright. All rights reserved. inhibition of macromolecule synthesis and bacterial death (Kashyap et al., 2011; Royet et al., 2011; Dziarski et al., 2012; Kashyap et al., 2014). However, the mechanisms utilized by pathogenic bacteria against the bactericidal and bacteriostatic activities of PGLYRPs seem to have different sensitivities. Indeed, Gram-positive Streptococcus strains exhibit varying degrees of sensitivity to killing by PGLYRPs(Lu et al., 2006). Therefore, we hypothesized that there exist countermeasures in Streptococci that facilitate escape from the bactericidal actions of innate immune cytotoxins. A Gram-positive streptococcus may horizontally acquire a DNA fragment containing a GI-type IVC secretion system and the sp1 gene, thus establishing a novel escape strategy against PGLYRP-mediated killing. Specifically, the GI-type IVC secretion system delivers the peptidoglycan effector SP1 across the bacterial membrane, thus directly interfering the PGLYRP-1-mediated bacteriostatic effect.. On the other hand, PGLYRP-1 activates a pathway that regulates sp1 gene transcription and expression (Fig. S5). We further demonstrated that the increased expression of SP1 is dependent on the environmental concentration of PGLYRP-1. In summary, most clinical occurrences of bacterial infectious diseases result from the failure of the body’s innate immune defenses (Okumura et al., 2014). This study elucidated a new strategy by which bacteria can escape host innate immune defenses. Some Gram-positive streptococci that have obtained a PAI through horizontal gene transfer, now carry a unique GI-type IVC secretion system that enlists the SP1 protein to establish a blockade against a key innate immune protein, PGLYRP-1, thus disabling and then effectively escaping its killing function. Further studies will help us understand the molecular mechanisms underlying bacterial resistance to the innate immune response and open a new window for the development of new antimicrobial drugs. This article is protected by copyright. All rights reserved.
Experimental procedures
Bacterial strains and growth conditions Streptococcal strains are listed in Table S3. All strains were cultured at 37°C on Columbia agar supplemented with 5% sheep's blood or in Todd-Hewitt broth (THB; Difco Laboratories Shanghai，China) supplemented with 1% yeast extract (THY) or plated on THB agar (1.5%) containing 5% (vol/vol) sheep blood. If required, 100 μg/mL spectinomycin (Sigma-Aldrich Shanghai，China), 10 μg/mL tetracycline (Sigma-Aldrich Shanghai，China), 500 μg/mL kanamycin (Sigma) and 4 μg/mL chloramphenicol (Sigma-Aldrich Shanghai，China) were added, and streptococcal strains were grown overnight on sheep blood agar plates at 37°C. Isolated colonies were then used as inoculant for 2 mL of THY, which was incubated for 16 h at 37°C with agitation. Working cultures were prepared by transferring 50 μL of the 16-h cultures into 5 mL of THY (1:100 dilution) and allowing them to stand at 37°C for 8 h. Bacterial yeast strains and plasmids for yeast two-hybrid experiments were obtained from Clontech Co., USA. Bacterial strain DH5α was used to clone each shuttle plasmid.
Bactericidal assay
The bactericidal and bacteriostatic activities of human PGLYRPs were assayed on logarithmically growing bacteria as described previously (Kashyap et al., 2011). Bacteria were precultured overnight and subcultured for 4 h in THY. Assay mixtures for antibacterial activities contained 1 × 10 6 CFU of the tested bacteria and PGLYRP-1 or bovine serum albumin (fraction V; Sigma-Aldrich Shanghai，China) in 1 mL of assay buffer (5 mM Tris-HCl pH 7.6, 150 mM NaCl, 2.5 mM CaCl2, 5 μM ZnSO4 and 5% glycerol supplemented with 1% LB broth). Where indicated, 1 mM zinc chloride or 1 mM EDTA was added to the assay mixture. At every 0.5 h (until 6 h) after the treatment, 100 μL of the mixture was recovered, and serially diluted specimens were plated on THY agar. Colonies were counted 24 h later. Neutralization by rabbit anti-PGLYRP-1 polyclonal antibody (Sigma-Aldrich, Shanghai，China) was accomplished by adding 1 mg of the antibody to the mixture. This article is protected by copyright. All rights reserved. Preparation of proteins from the supernatants or whole-cells The protein preparation were similar to our previously published study (Yin et al., 2016). Briefly, The Streptococcus strains were cultured to the late exponential growth phase and harvested by centrifuged at 10,000×g for 10 min at 4℃ . The supernatant proteins precipitation employed TCA in accordance the standard protocols(Sivaraman et al., 1997). The cell pellets were resuspended in a lysis buffer (50 mM Tris–HCl, 2 mM EDTA, 100 mM NaCl, 0.5% Triton X-100, 10 mg/ml lysozyme, and protease inhibitor cocktail at pH 8.5–9.0), and incubated at 37 °C for 4 h. After disruption was performed with three cycles of alternating ultrasound and freezing/thawing, the lysates were centrifuged at 2,000 × g for 5 min to remove debris. The resulting supernatants were collected as whole-cell proteins.
SDS-PAGE and Western blotting
SDS-PAGE was performed as described before (Osanai et al., 2011). For confirmation of the purity of PGLYRP-1, 2 μg of recombinant protein was examined using SDS-PAGE. Protein concentrations were determined using a Bio-Rad protein assay (Bio-Rad USA) according to the manufacturer's instructions and were normalized to 20 μg/well. Separated proteins were transferred to a PVDF membrane (Life Science Research at Merck Millipore, MA, USA) by electrophoresis. The polyclonal antibody prepared in this study was used to detect PGLYRP-1. Horseradish-peroxidase-conjugated goat anti-rabbit immunoglobulin G (MP Bio Science Ltd, USA) was used as a secondary antibody. After the washing step, substrate development was performed using an enhanced chemiluminescence blotting reagent (Roche Diagnostics, Mannheim, Germany) and Kodak film (Kodak, USA). Construction of gene deletion mutant strains The disruption of streptococcal genes was achieved by transformation with PCR amplicons of DNA fragments flanking each target gene and an intervening antibiotic cassette, as previously described. Briefly, the DNA sequences flanking the target gene were amplified from the chromosomal DNA of each strain using PCR with two pairs of specific primers carrying EcoRI/BamHI and PstI/HindIII restriction enzyme sites, respectively. Following This article is protected by copyright. All rights reserved. digestion with the corresponding restriction enzymes, the DNA fragments were directionally cloned into a pUC18 vector. Then, the Spc R gene cassette (from pSET2) was inserted at the BamHI/PstI sites to generate the target gene knockout vector. To obtain the isogenic mutant, competent cells were subjected to electrotransformation with pUC::gene, as described previously (Li et al., 2008). A colony PCR assay was used to examine all Spc R transformants with a series of specific primers.
Yeast two-hybrid assays
A leukocyte cDNA library was screened as described previously (Lin et al., 2006). PCR was performed with the following primers specific for the sp1 gene: sense primer 5’GCGCGAATTCATGTTAAATAAAGTG3’ and anti-sense primer 5’GAGAGGATCCGTGTGTCTCACTTGTTG3’. The sp1 PCR cDNA construct was treated with EcoRI and BamHI restriction endonucleases and cloned in frame with the GAL4 DNA-BD of the pGBKT7 DNA-BD vector, which had previously been treated with EcoRI and BamHI restriction enzymes. One large (2-3 mm), fresh (<2 mo-old) colony of AH109 [bait] was inoculated into 50 mL of SD/-Trp and incubated at 30°C overnight (16-24 h) with shaking at 250-270 rpm. Then, the cells were spun down by centrifuging the entire 50 mL culture at 1000 rpm for 5 min, and the supernatant was discarded. After decanting, the cell pellet was resuspended in the residual liquid by vortexing. The entire AH109 [bait] culture (beyond 1:109) and 1 mL library (beyond 1:109) were combined and cultured in a 2 L sterile flask, and 45 mL of 2X YPDA/Kan was added and swirled gently. After 20 h mating, the cells were centrifuged, resuspended and spread on 25 large (150 mm) plates containing 200 mL of SD/-Ade/-His/-Leu/-Trp (QDO) or 200 mL of SD/-His/-Leu/-Trp (TDO). After 6-18 d, yeast colonies larger than 3 mm in diameter were transferred onto plates containing X-α-Gal to examine the expression of the MEL1 reporter gene (blue colonies). The resultant plasmids were verified by PCR with the primers from the DNA-BD insert screen amplification. This article is protected by copyright. All rights reserved. Assay for β-galactosidase activity β-galactosidase activity was determined using a colony-lift filter assay as previously described (Wang et al., 2006). Briefly, fresh colonies were grown on a plate at 30°C for 4 days until they reached 2–3 mm in diameter. A sterile Whatman #5 filter was placed over the surface of the plate of colonies, and the filter was gently rubbed with the side of the forceps until it was evenly wet. The filter was carefully lifted off the agar plate with forceps and transferred (colonies facing up) to a pool of liquid nitrogen. After the filter had frozen completely (approximately 10 s), it was removed and allowed to thaw at room temperature. The filter was then carefully placed, with the colony side up, on another filter that was presoaked in a clean 90-mm plate containing 3 mL of Z buffer X-gal solution. The filters were incubated at 30°C and checked periodically for the appearance of blue colonies. Expression of human PGLYRP-1 and streptococcal SP1 The transient expression of rPGLYRP-1 in the pcDNA6/HisA vector was performed according to the manufacturer's instructions (Invitrogen). Briefly, the rPGLYRP-1-pcDNA6 plasmid was transfected into HEK293T cells (ATCC) using the calcium phosphate method. The culture medium was replaced by fresh OPTI-MEM I Reduced-Serum Medium (Invitrogen) 10 h later. Supernatant containing expressed rPGLYRP-1 protein was collected 72 h later, and the recombinant rPGLYRP-1fusion protein was purified by use of a nickel nitrilotriacetic acid-agarose gel (Novagen, Madison, WI, U.S.A) column. Chromosomal DNA from Streptococcus strains was isolated and used as a template for PCR amplification of the sp1 gene fragment. The PCR products were then purified and ligated to the pMD18-T TA cloning vector. The sp1 gene was subcloned into the inducible pET-32 bacterial expression vector with N-terminal His6 (Novagen, Madison, WI, U.S.A), recombinant sp1 was expressed in E. coli, and recombinant protein was purified by nickel-agarose (His-Bind Kit, Novagen, Madison, WI, U.S.A) following the manufacturer’s instructions. The purification yielded single bands on Coomassie Blue-stained gels that corresponded to the bands detected on Western blots with anti-tag antibodies. In addition, we predicted the potential domain of SP1(S.suis) that binds PGLYRP-1 from the ExPASy database (http://www.expasy.org/proteomics). We constructed pET-32 plasmids with This article is protected by copyright. All rights reserved. C-terminally truncated SP-1 that expressed N-terminally truncated SP1, or C- terminally truncated forms of SP1 were generated by PCR using pET-32-SP1(1-212aa) as the PCR template to create pET-32-SP1(1-162aa), pET-32-SP1(1-112aa), pET-32-SP1(50-112aa), pET-32-SP1(50-162aa), pET-32-SP1(100-212aa) and pET-32-SP1(50-212aa). Production and purification of anti-SP1 monoclonal antibodies Eight six-week-old female BALB/c mice were immunized intraperitoneally (i.p.) three times at two-week intervals with 40 µg of recombinant SP1 protein emulsified in incomplete Freund's adjuvant (Sigma-Aldrich Shanghai, China). Spleen cells were isolated and fused with SP2/0 myeloma cells at a ratio of 5:1 in the presence of polyethylene glycol 1500 (Roche Diagnostics GmbH, Mannheim, Germany). The hybridomas were selected in HAT (hypoxanthine-aminopterin-thymidine) medium, and their binding to recombinant SP1 protein was measured by indirect ELISA. Highly reactive hybridomas were enriched in ascetic fluid from BALB/c mice pretreated with 1.0 mL of Pristance (Sigma-Aldrich Shanghai, China), and the immunoglobulin were purified by chromatography on a protein G-Sepharose 4B flow (Amersham Bioscience, Piscataway, NJ, USA). We demonstrated that the anti-SP1 antibody specifically reacted with SP1 from the lysates of WT strains compared to Δsp1 (Fig. S4). Sandwich enzyme-linked immunosorbent assay (ELISA) for detecting SP1 protein Anti-SP1 monoclonal antibodies were screened for their reactivity to recombinant SP1 protein, and highly reactive anti-SP1 monoclonal antibodies were tested for their suitability for sandwich ELISA. The optimum dilutions of these reagents were selected by checkerboard titration. Next, sandwich ELISA was performed as follows: briefly, 96-well microtiter plates (Nunc, Roskilde, Denmark) were coated with anti-SP1 monoclonal antibody at a suitable concentration and incubated at 4°C overnight. After blocking with non-fat dry milk, recombinant SP1 protein in phosphate-buffered saline (PBS) was added and incubated for 2 h at 37°C. Subsequently, the wells were washed four times and incubated with other horseradish peroxidase (HRP)-conjugated anti-SP1 monoclonal antibodies for 1 h at 37°C. Finally, after six washes, 3,3',5,5'-tetramethylbenzidine (TMB) substrate (Sigma-Aldrich This article is protected by copyright. All rights reserved. Shanghai, China) was added to the wells, the plates were incubated for 20 min in the dark, and the absorbance was read at 450 nm after the reaction was stopped with 2.0 N H2SO4. To generate a standard curve, 1.0 µg/mL to 1000 µg/mL of recombinant SP1 protein was used in the sandwich ELISA, and the A450 of the plates was determined using a microplate reader (Thermo Scientific Multiskan GO, USA). The resultant absorbance values were plotted on a graph and fitted to a linear equation, which served as the calibration curve. The detection limit of the assay was defined as the mean value of the blank plus three times its standard deviation. Sandwich ELISA for determining interaction between SP1 and PGLYRP-1 interaction SP1 at 6 μg/mL was adsorbed overnight onto a 96-well plate (Nunc, Roskilde, Denmark) at 4°C. The wells were then blocked using 30 mmol/L HEPES buffer (30 mmol/L 4-(2-hydroxyethyl)-1-piperazineethanesulfonicacid, 110 mmol/L NaCl, 10 mmol/L KCl, 1 mmol/L MgCl 2,10 mmol/L Glucose, pH7.4) containing 3% BSA for 2 h at RT. PGLYRP-1 at various concentrations were added to the wells for 1 h at RT. Following extensive washing using TBST (Tris-buffered saline with 0.1% Tween 20), polyclonal rabbit anti-PGLYRP-1 antibody (Sigma) was added and then incubated with HRP-conjugated anti-rabbit IgG for 1 h at RT. The dissociation constants (KD) were then estimated using Scatchard analysis.
Pull-down assays and dot blots
Anti-SP1-specific affinity resin was covalently linked to agarose using a Co-Immunoprecipitation kit (Thermo Fisher Scientific, Pierce, Shanghai China). The supernatant proteins (2mg) from the strains and PGLYRP-1 protein (300 µg) was mixed with 100 µL of anti-SP1 resin slurry (containing approximately 100 µg of coupled SP1-specific IgG) and was incubated overnight at 4°C under constant rotation. The anti-SP1 resin was collected by centrifugation at 1,000 rpm for 2 min and washed three times with IP-lysis/wash buffer (Pierce). The proteins that bound to the anti-SP1 resin were eluted by boiling in SDS sample-loading buffer and were analyzed by SDS-PAGE and Western blotting with a monoclonal antibody against SP1 or a polyclonal anti-PGLYRP-1 antibody produced in mouse or rabbit (Sigma-Aldrich Shanghai，China) at a 1:2000 dilution. This article is protected by copyright. All rights reserved. The PVDF membrane was soaked in 100% methanol for 2–3 min, followed by equilibration in 1× PBS for 5 min. Dot blotting was performed by adding 10 μL of the SP1 samples (10 µg) to each slot. The membrane was incubated in 5% nonfat dry milk in Tris-buffered saline with Tween-20 (TBST) with rocking for 1 h at room temperature. The membrane was washed with TBST three times for 10 min. The membrane was then incubated with PGLYRP-1 (100 µg/mL) for 1 h with rocking at room temperature. The membrane was washed three times for 10 min with TBST. The appropriate dilution of primary antibody (anti-PGLYRP-1 antibody produced in rabbit [Sigma] at a 1:2000 dilution) was added, followed by incubation for 1 h with rocking at room temperature. Again, the membrane was washed three times for 15 min with TBST. The membrane was then incubated in the appropriate dilution of secondary anti-rabbit IgG-HRP antibody for 1 h with rocking at room temperature, followed by three more washes for 15 min with TBST. After the last washing step, substrate development was performed using an enhanced-chemiluminescence blotting reagent (Roche Diagnostics, Mannheim, Germany) and Kodak film (Kodak, USA).
Comparative genomics and prediction of GIs
Each genomic sequence comparison was performed using NCBI BLAST, which is available in the BioEdit Sequence Alignment Editor. The results were visualized using ACT (Artemis Comparison Tool) release 8, based on Java web start launcher™. The files of all S4GIs were obtained from GenBank using Vector NTI Advance 11 software. The figures were generated using ACT and Vector NTI Advance 11 exported graphics (Fig. 1).
Identification of genes
Protein sequences from all the S4GIs were compared using BLASTP with matrix BLOSUM62 with the expectation value set at 1.0E-20 and an additional criterion of match length set at 75% of the query sequence. This article is protected by copyright. All rights reserved.
Quantitative real-time PCR (qRT-PCR) analysis
The Streptococcus strains were incubated with PGLYRP-1 and albumin (control), and total RNA was extracted using a Qiagen RT kit (Qiagen, USA) according to the manufacturer’s instructions. The RNA concentration was evaluated by A260/A280 measurement. The degenerate oligonucleotide primers used for qRT-PCR analysis were designed from Streptococcus genome sequences using Clone Manager Suite 7 (Scientific & Educational Software) and were synthesized by Invitrogen (Shanghai, China). The following primers were used for the qRT-PCR analysis: sense 5’-CGYATYMARCCYTAYATGACDGAHTC-3’ and anti-sense 5’-ATCWGAHACATARGTYACHTKATARG-3’. qRT-PCR and the data analysis were performed as previously described (Dramsi et al., 2006). Duplicate reactions were performed using RNA samples isolated from at least two separate assays for each incubation time point. A 453-bp fragment of the recA gene was used as an internal control between streptococcal strains of the three species according to the protocol previously described (Sistek et al., 2012; Florindo et al., 2012).
Ethics statement
All animal experiments performed in this study were reviewed and approved by the Committee on the Ethics of Animal Experiments of PLA Hospital No. 454 in accordance with the relevant guidelines and regulations. The welfare of the animals was adequately protected, and efforts were made to minimize the suffering and distress of the animals.
Acknowledgments
We thank Fuquan Hu and Li Ming from the Department of Microbiology, Third Military Medical University, Chongqing, China, and Xiaoning Wang from the Institute of Life Science, General Hospital of the People's Liberation Army, Beijing 100853, China, for their valuable suggestions on the comparative analysis of genomic islands. This article is protected by copyright. All rights reserved.
Funding
This work was supported by grants to J.T. from the National Natural Science Foundation of China (#81171527 and 81371768), to C.W. from the National Natural Science Foundation of China (#81471920, 31170124 and 81172794), and to J.W. from the Key Issue of Medical and Health Foundation of Nanjing Military Command (#12Z17 and 09Z015).
Figure legends
This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Article Images (0)
×![]()
Bioz is the world’s most comprehensive AI search engine for scientific experimentation. The Bioz search engine offers researchers billions of data-driven product, technique, and protocol recommendations. Bioz taps into the latest advances in Artificial Intelligence (AI) – including Natural Language Processing (NLP), Machine Learning (ML) and Generative AI to mine and structure hundreds of millions of pages of complex and unstructured scientific papers. By harnessing the power of AI, Bioz provides researchers with an unprecedented amount of summarized scientific experimentation knowledge right at their fingertips, ultimately helping to speed up drug discovery and the rate of success in finding cures for diseases. Bioz is used by over 15 Million researchers from over 17,000 different universities and companies in 196 countries.
