Article Images (0)
×![]()
featured_play_listSave article to folder
X
Create new folder
Full Text
PDF
Table of Contents
Abstract
Neutrophil Gelatinase-Associated Lipocalin (NGAL) Is Associated With
Symptomatic Carotid Atherosclerosis And Drives Pro-Inflammatory State
W. Eilenberg A, S. Stojkovic B, A. Piechota-Polanczyk A, C. Kaun B, S. Rauscher C, M. GröGer C, M. Klinger A, J. Wojta B,C,
C. Neumayer A, I. Huk A, S. Demyanets D,*
INTRODUCTION
MATERIALS AND METHODS
Tissue Sampling
Cell Culture
Treatment Of Cells
Protein Determination
Statistical Analysis
RESULTS
Characteristics Of Study Population
DISCUSSION
Study Limitations
CONFLICT OF INTEREST
FUNDING
Upper Extremity Ischemia As A “Warning Shot” Of Cerebellar Infarction
S. Regus *, W. Lang
Abstract
W. Eilenberg , S. Stojkovic , A. Piechota-Polanczyk , C. Kaun , S. Rauscher , M. Gröger , M. Klinger , J. Wojta , C. Neumayer , I. Huk , S. Demyanets d,* a Department of Surgery, Division of Vascular Surgery, Medical University of Vienna, Austria b Department of Internal Medicine II, Division of Cardiology, Medical University of Vienna, Austria c Core Facilities, Medical University of Vienna, Austria d Department of Laboratory Medicine, Medical University of Vienna, Vienna, Austria
Neutrophil Gelatinase-Associated Lipocalin (NGAL) is Associated with
Symptomatic Carotid Atherosclerosis and Drives Pro-inflammatory State
In Vitro
W. Eilenberg a, S. Stojkovic b, A. Piechota-Polanczyk a, C. Kaun b, S. Rauscher c, M. Gröger c, M. Klinger a, J. Wojta b,c,
C. Neumayer a, I. Huk a, S. Demyanets d,*
a Department of Surgery, Division of Vascular Surgery, Medical University of Vienna, Austria b Department of Internal Medicine II, Division of Cardiology, Medical University of Vienna, Austria c Core Facilities, Medical University of Vienna, Austria d Department of Laboratory Medicine, Medical University of Vienna, Vienna, Austria * Co Univers E-ma 1078 Elsevie http: WHAT THIS PAPER ADDS Neutrophil gelatinase-associated lipocalin (NGAL) has been proposed as a potential marker of poor prognosis in cardiovascular patients. This study confirms expression of NGAL protein in human atherosclerotic tissue by macrophages, endothelial cells, and smooth muscle cells. Pro-inflammatory properties of NGAL were found in all three cell types, which are known to be involved in atherogenesis, as NGAL up-regulated the production of cytokines IL-6, IL-8, and MCP-1. Therefore, it is believed that NGAL could be not only a potential prognostic marker in patients with vascular pathologies but also an indicator of development and progression of atherosclerosis. Objective: Neutrophil gelatinase-associated lipocalin (NGAL), a protein found in activated neutrophils, is expressed in kidney tubule cells in response to noxious stimuli, and is thus recognized as a marker of acute kidney injury. Recent studies have suggested that NGAL could also have pathophysiological importance in cardiovascular diseases. The aim of the present study was to examine NGAL expression in human carotid endarterectomy tissues ex vivo as well as the effects of NGAL in the main cell types involved in atherogenesis, namely in human macrophages, endothelial cells, and smooth muscle cells in vitro. Methods: NGAL protein was analyzed in human endarterectomy samples from patients with asymptomatic and symptomatic carotid stenosis by immunofluorescence, and NGAL mRNA expression was detected using RealTimePCR. Human monocyte derived macrophages (MDM), human coronary artery smooth muscle cells (HCASMC), and human umbilical vein endothelial cells (HUVEC) were treated with recombinant human (rh) NGAL at different concentrations. Interleukin (IL)-6, IL-8, and monocyte chemo-attractant protein-1 (MCP-1) were determined by specific enzyme linked immunosorbent assays (ELISAs) in culture supernatants of such treated cells. Results: Expression of NGAL protein was demonstrated by macrophages, smooth muscle cells, and endothelial cells in human carotid atherosclerotic tissue. NGAL mRNA expression was detected at a higher rate in atherosclerotic tissue of patients with symptomatic carotid stenosis (in 70%; n ¼ 19) compared with asymptomatic patients (in 37%; n ¼ 20, p < .001). Treatment of MDM, HCASMC, and HUVEC with rhNGAL led to a significant (p < 0.05) and concentration dependent increase of pro-inflammatory cytokines IL-6, IL-8, and MCP1 in all cell types analyzed. Conclusion: By induction of pro-inflammatory mediators in human macrophages, smooth muscle cells and endothelial cells, NGAL, which is predominantly expressed in atherosclerotic plaques of symptomatic patients, could be involved in creating the local and systemic pro-inflammatory environment characteristic for atherosclerosis. 2016 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved. Article history: Received 30 October 2015, Accepted 16 January 2016, Available online 2 March 2016 Keywords: NGAL, Lipocalin, Atherosclerosis, Cytokines, Inflammation rresponding author. Department of Laboratory Medicine, Medical ity of Vienna, Waehringer Guertel 18e20, A-1090 Vienna, Austria. il address: svitlana.demyanets@meduniwien.ac.at (S. Demyanets). -5884/ 2016 European Society for Vascular Surgery. Published by r Ltd. All rights reserved. //dx.doi.org/10.1016/j.ejvs.2016.01.009
INTRODUCTION
Neutrophil gelatinase-associated lipocalin (NGAL) is a member of the lipocalin family of small extracellular proteins, and is recognized as an excellent marker of acute kidney injury.1 NGAL is a 25 kilodalton protein stored in the granules of human neutrophils.2 Besides neutrophils, NGAL may also be released by macrophages, epithelial cells, renal tubular cells, adipocytes, and hepatocytes during inflammation and injury.3e6 Recent data have established a link between NGAL and cardiovascular diseases.7 NGAL expression was detected in human and murine atherosclerotic plaques, where it was found in endothelial cells, smooth muscle cells (SMCs), and macrophages,5,8 as well as in human abdominal aortic aneurysm tissue.9e11 In atherosclerotic lesions, increased NGAL expression was associated with unstable plaque phenotype characterized by high lipid content, a large number of macrophages, low SMC content, and intraplaque hemorrhage.8,12 Bu et al. showed an increase of NGAL expression by angioplastic injury in the intima of rat carotid artery.13 It is important to note that NGAL can bind to matrix metalloproteinase (MMP)-9 to form a dimeric NGAL/MMP-9 complex, thus preventing the degradation of MMP-9.14 Circulating NGAL is under intense investigation as a diagnostic and prognostic tool for cardiovascular diseases.15 High plasma NGAL predicts all cause mortality and major adverse cardiovascular events in ST segment elevation myocardial infarction,16 as well as in the general population.17,18 In patients with coronary artery disease, levels of circulating NGAL reflect the degree of inflammatory process.19,20 Although NGAL has been shown to be an acute phase protein,21 its expression was associated with high IL-6 and IL-8 levels in human atherosclerotic tissue,8 and the association between plasma NGAL and inflammatory markers was established in clinical studies,17,19 few data are available about the effects of NGAL in cell types involved in atherogenesis. For that reason the present study aimed to investigate the influence of NGAL on the production of inflammatory mediators in human macrophages, SMCs, and endothelial cells. Furthermore, the expression of NGAL was examined in human carotid atherosclerotic tissue from patients with asymptomatic versus symptomatic carotid stenosis.
MATERIALS AND METHODS
Tissue sampling
Atherosclerotic tissue was collected from 39 patients undergoing carotid endarterectomy (mean age 70.9 7.5 years; 80% male, 49% symptomatic; mean stenosis grade 87.5 11.0%) at the Department of Surgery, Division of Vascular Surgery, Medical University of Vienna. All subjects were Caucasian and did not suffer from acute infection or autoimmune or neoplastic disease. Representative samples were collected from carotid artery lesions of these patients for tissue RNA isolation and stored at 80 C. For descriptive histological analyses, selected samples were embedded in paraffin. The study has been reviewed and approved by the ethics committee of the Medical University of Vienna, Austria (EK 269/2009), and all study subjects gave informed consent. Immunofluorescence analysis of NGAL in human atherosclerotic tissue Immunofluorescence analysis of human carotid atherosclerotic tissue was performed as described previously.22,23 Paraffin embedded sections were deparaffinized according to standard protocol and then boiled for antigen retrieval in citrate buffer (Dako North America, Inc., CA, USA). Sections were blocked with a 3% bovine serum albumin (BSA, Sigma, St. Louis, MO, USA) solution for 30 minutes (min) at room temperature. The following primary antibodies were used: goat polyclonal antibody anti-NGAL (1:100 dilution; Santa Cruz, CA, USA), mouse monoclonal antibody anti-CD68 for detection of macrophages (1:100 dilution; Dako), rabbit polyclonal antibody anti-von Willebrand factor for visualization of endothelial cells (1:500 dilution; Dako), as well as respective isotype IgG controls (Sigma). Smooth muscle cells were detected using monoclonal anti-alpha smooth muscle actin labeled to Cy3 produced in mouse (1:200 dilution, Sigma). Primary antibodies were incubated overnight at 4 C. After washing with phosphate buffered saline (PBS) containing 0.05% Tween-20 (Sigma), slides were incubated with secondary antibodies for 1 hour (h) at room temperature in the dark (TRITC labeled donkey anti-goat IgG [Jackson ImmunoResearch Laboratories, West Grove, PA, USA]), and sections were blocked for 10 minutes with diluted goat serum to avoid cross reactions with subsequent secondary antibodies: Alexa Fluor-488 goat anti-mouse IgG (Invitrogen Life Technologies) and Cy5 labeled goat antirabbit IgG (Jackson ImmunoResearch Laboratories). All antibodies were diluted in PBS with 0.1% Triton X-100 (Sigma) for permeabilization. Nuclear counter staining was performed with DAPI (1 mg/mL; Sigma) for 10 min at room temperature. Sections were analyzed with a confocal laser scanning microscope LSM780 (Carl Zeiss). Total RNA purification and cDNA preparation Frozen human atherosclerotic tissue was homogenized using a ball mill (Retsch, Haan, Germany), and mRNA was isolated using an RNeasy Mini Kit (Quiagen, Valencia, CA, USA). Total RNA content was measured using NanoDrop (Thermo Scientific, Barrington, IL, USA). Reverse transcription was performed using the GoScript reverse transcription system (Promega, Madison, WI, USA). Real time polymerase chain reaction Real time PCR was performed using a LightCycler Taq-Man Master (Roche, Basel, Switzerland) according to the manufacturer’s instructions. Primers (forward [fwd] and reverse [rev]) were designed using the Roche Universal ProbeLibrary Assay Design Centre (http://www.universalprobe library.com/): glycerinaldehyde-3-phosphate-dehydrogenase (GAPDH) (fwd: AGCCACATCGCTCAGACAC, rev: GCCCAATACGACCAAATCC, UPLprobe #60; Amplicon Size [bp] 66) e NGAL (fwd: CAGGACTCCACCTCAGACCT; rev: CCAGGCCTACCACATACCAC, UPLprobe #84; Amplicon Size [bp] 109). The amplification conditions consisted of an initial incubation at 95 C for 10 min, followed by 45 cycles of 95 C for 10 s, 63 C for 20 s and 72 C for 6 s, and a final cooling to 40 C. Data were analyzed using Light-Cycler Software Version 3.5 (Roche).
Cell culture
Peripheral blood mononuclear cells (PBMCs) from healthy donors were isolated using a Ficoll-Hypaque density gradient (Amersham Biosciences, Uppsala, Sweden). Positive isolation of peripheral blood monocytes from PBMCs was performed using a MACS monocyte isolation kit (MiltenyBiotec, Bisley, GB) with CD14 antibodies conjugated to magnetic beads according to the manufacturers’ instructions. These peripheral blood monocytes were suspended in ultra-culture medium (BioWhittaker, Walkersville, MD, USA) containing 10% human serum (Sigma) as well as 100 U/mL penicillin, 100 mg/mL streptomycin, and 0.5 mL of the cell suspension were seeded per well into cell culture plates at a cell density of 2 106 cells/mL. Macrophage transformation was performed as described previously.24 The explant technique was used to isolate human coronary artery smooth muscle cells (HCASMC) from pieces of coronary arteries obtained from patients undergoing heart transplantation, as described previously.25 Human umbilical vein endothelial cells (HUVEC) were isolated from fresh umbilical cords by mild collagenase treatment, and cultivated as described.22 The study was reviewed and approved by the ethics committee of the Medical University of Vienna (EK 1616/2013).
Treatment of cells
Human MDMs, cultured in ultra-culture medium containing 10% human serum, were treated with rhNGAL (R&D Systems, Minneapolis, MN, USA) at concentrations between 50 ng/mL and 1 mg/mL for between 12 h and 48 h. HCASMC were incubated in minimum essential medium 199 (M199, Sigma) containing 0.1% BSA (Sigma) for 24 h prior to treatment with rhNGAL. Thereafter, the medium was replaced with fresh M199 containing 0.1% BSA, and rhNGAL was added at 200 ng/mL, 500 ng/mL, and 1 mg/mL for 24 h. HUVEC were incubated in M199 (Sigma) containing 1.25% fetal calf serum (Lonza, Verviers, Belgium) without or with rhNGAL at 1 mg/mL for 12 h and 24 h.
Protein determination
IL-6, IL-8, and MCP-1 antigen in cell culture supernatants of such treated cells was measured by specific ELISAs using monoclonal antibodies (all from Bender MedSystems, Vienna, Austria).
Statistical analysis
For patient data, the median and its quartile values are given to describe continuous variables, and absolute numbers and percentages are used to describe categorical variables. For comparison of the study groups (symptomatic and asymptomatic patients with carotid stenosis), the following statistical tests were used: differences with respect to continuous variables were tested by the two sample t test, for non-normally distributed variables the Wilcoxon rank sum test was used. Categorical variables were compared by the chi-square test or the Fisher’s exact test as appropriate. Data from cell culture experiments were analyzed by one-way ANOVA followed by Bonferroni post-hoc test or by Student t test. These values are expressed as means standard deviations (SD). Values of p .05 were considered significant. All statistical analyses were performed with the statistical software package SPSS version 18.0 (SPSS, Inc., Chicago, IL, USA).
RESULTS
Characteristics of study population
Demographic data of the patients with symptomatic and asymptomatic carotid artery stenosis used for tissue mRNA isolation are shown in Table 1. There were no differences in age, gender, stenosis grade, body mass index, presence of hypertension, coronary artery disease, hyperlipidemia, diabetes, disabling claudication, smoking status, use of statins and anticoagulants, or creatinine, C-reactive protein, and leukocyte levels between the two study groups. NGAL protein is expressed by endothelial cells, smooth muscle cells, and macrophages in human atherosclerotic plaques As shown in Fig. 1, using fluorescence immunohistochemistry NGAL protein was detected in human carotid endarterectomy specimens. NGAL protein is expressed by endothelial cells (Fig. 1A and B), smooth muscle cells (Fig. 1C), and macrophages (Fig. 1D) as shown by colocalization of NGAL with von Willebrand factor, alphasmooth muscle actin, and CD68, respectively. NGAL expression is associated with symptomatic carotid atherosclerosis mRNA specific for NGAL in human carotid plaques samples was measured. When patients were divided according to Figure 1. Expression of NGAL in human atherosclerotic lesion. Confoca staining for NGAL and von Willebrand factor (vWF) (A, B, vWF in red, smooth muscle actin in red, NGAL in grey, nuclei in blue), or NGAL and C as described in the text. Original magnification 630. Scale bar ¼ 10 clinical presentation of carotid atherosclerosis (Table 1), NGAL mRNA expression was detected at a higher rate (p < .001) in atherosclerotic tissue of patients with symptomatic carotid stenosis (in 70%) compared with asymptomatic patients (in 37%). If patients were divided according to their stenosis grade as having <90% or 90%, no difference was found in NGAL mRNA expression between these two groups (p ¼ .748). NGAL increased pro-inflammatory mediators in human macrophages, endothelial and smooth muscle cells in vitro To estimate the influence of NGAL on the main cell types involved in atherogenesis, cell culture models of human macrophages, endothelial cells, and SMC were used. When macrophages, HCASMC, and HUVEC were treated with different concentrations of rhNGAL, a concentration dependent increase in IL-6, IL-8, and MCP-1 production was found in cell culture supernatant of these cells (Figs. 2e4). In MDM, a significant increase in IL-6 protein was seen after 12 h incubation with rhNGAL starting at the concentration of 50 ng/mL (Fig. 2A). A maximum dose of 1 mg/mL of rhNGAL was used and up to 3.1-, 3.4-, and 4.5-fold l immunofluorescence images of carotid atherosclerotic tissue. CoNGAL in grey, nuclei in blue), NGAL and smooth muscle actin (C, D68 (D, CD68 in green, NGAL in grey, nuclei in blue) was performed mm. Representative pictures are shown. increases in IL-6 production were seen after 12, 24, and 48 h of incubation, respectively. Therefore, rhNGAL was effective in up-regulating IL-6 protein in MDM at concentrations between 50 ng/mL and 1 mg/mL between 12 h and 48 h (Fig. 2A). IL-8 protein followed similar kinetics to those of IL6 after treatment of MDM with rhNGAL (Fig. 2B): a significant increase was seen with 50 ng/mL of rhNGAL after 12 h and 24 h of treatment. However, 50 ng/mL NGAL did not modulate IL-8 protein after 48 h of incubation. Upregulation of IL-8 production reached maximum values of up to 5.6-, 3.6-, and 3.3-fold after 12 h, 24 h, and 48 h of incubation with rhNGAL at concentrations between 500 ng/ mL and 1 mg/mL (Fig. 2B). A significant increase in MCP-1 production was seen with all concentrations of rhNGAL after 12 h and 48 h, and at concentrations above 200 ng/mL at 24 h of incubation (Fig. 2C). When HCASMC were treated with rhNGAL at 200 ng/mL, 500 ng/mL, and 1 mg/mL for 24 h, significant increases in IL-6 (Fig. 3A) and MCP-1 (Fig. 3C) protein were seen with all three concentrations. However, significant IL-8 up-regulation was evident only with 500 ng/mL and 1 mg/mL of rhNGAL (Fig. 3B). As it was found that 1 mg/mL of NGAL was most effective in the cell culture models, HUVEC was incubated with this concentration for 12 h and 24 h. As can be seen from Fig. 4, this concentration of rhNGAL significantly up-regulated IL-6 (Fig. 4A), IL-8 (Fig. 4B), and MCP-1 (Fig. 4C) protein at both time points; however, in the case of IL-6 the maximum effect was reached after 12 h of incubation with rhNGAL.
DISCUSSION
NGAL expression was analyzed in human atherosclerotic tissue of patients with both symptomatic and asymptomatic carotid atherosclerosis, with no differences in demographic characteristics. NGAL protein was detected in macrophages, endothelial cells, and smooth muscle cells, and a higher rate of NGAL mRNA expression was detected in atherosclerotic lesions derived from symptomatic compared with asymptomatic patients. Using cell culture models of human macrophages, vascular endothelial cells and SMCs, proinflammatory properties of NGAL were revealed. Treatment of these cells with NGAL caused concentration dependent increased production of cytokines IL-6, IL-8, and MCP-1 in vitro. The present data on expression of NGAL protein by macrophages, endothelial cells and SMCs in atherosclerotic lesion correspond with the data of Hemdahl et al.5 and te Boekhorst et al.,8 who showed NGAL expression in atherosclerotic tissue from patients with carotid stenosis. The present study adds to these data by comparing expression levels of mRNA specific for NGAL in atherosclerotic specimens from 39 patients with different clinical presentations of carotid stenosis. It was possible to detect a higher rate of NGAL expression in atherosclerotic tissue from symptomatic compared with asymptomatic patients. te Boekhorst et al. found previously that NGAL levels were higher in carotid plaques with an unstable phenotype, such as fibro-atheromatous and atheromatous plaques, and plaques with high levels of IL-6 and IL-8. Moreover, plaque levels of NGAL tended to be higher when intra-plaque hemorrhage or luminal thrombus was present.8,26 Another study showed previously higher levels of NGAL/MMP-9 complexes in conditioned media from atherosclerotic plaques with hemorrhage.12 Clinical studies have demonstrated that levels of circulating NGAL are associated with the degree of inflammatory process in patients with coronary artery disease where NGAL levels are higher in patients with acute coronary syndrome compared with patients with stable coronary artery disease, and elevated serum NGAL as an independent risk factor for a high SYNTAX score.19,20,27 Furthermore, high plasma NGAL levels are associated with poor prognosis in patients with myocardial infarction and in the general population.16e18 The present study examined the relationship between NGAL mRNA expression in plaque and the percentage of carotid artery stenosis and did not find any significant difference in NGAL mRNA expression in patients with stenosis grade of <90% and 90%. This is in agreement with data of Giaginis et al., who found no association between plasma NGAL levels and advanced stenosis grade in patients with carotid atherosclerosis.28 If NGAL truly affects the processes involved in atherogenesis in vivo, the precise mechanisms are still unknown. NGAL (in mouse lipocalin 2 [Lcn2] gene, which encodes protein 24p3) was shown to be increased by IL-1b,13,29 IL10,30 hypoxia, lipopolysaccharide,5 hepatocyte growth factor,31 or co-stimulation with IL-17 and tumor necrosis factor (TNF)-a32 in different cell types. Although regulation of NGAL by different stimuli was extensively investigated, the effect of NGAL itself on the cells is limited. Not only was NGAL expression in atherosclerotic plaques detected in this study, but also the functions of this protein were examined in cell types involved in atherogenesis. It was shown that NGAL up-regulates IL-6, IL-8, and MCP-1 release in human macrophages, SMCs, and endothelial cells in vitro. Therefore, NGAL appears to be a direct trigger of inflammatory milieu in human atherosclerotic tissue, which is known to represent the site of chronic inflammation.33,34 NGAL has multiple functions that include regulation of cell death and survival, migration and invasion, cell differentiation, and iron homeostasis.35 Moreover, formation of the complex between NGAL and MMP-9 increases its stability. All these mechanisms are involved in the regulation of inflammation. Lcn2 expression is induced under many inflammatory conditions, such as inflammatory bowel disease, psoriasis, rheumatoid arthritis, systemic lupus erythematosus, neuro-inflammatory disorders,35 and as evident by this and previous studies also in atherosclerotic lesions.5,8 As chronic inflammation occurs in atherogenesis,33,34 NGAL could be an important pro-inflammatory player in this vessel pathology. NGAL can exert either pro- or anti-inflammatory effects depending on the experimental model and conditions. Lcn2 promotes macrophage type 1 (M1) polarization, and Lcn2 neutralization decreases recruitment of neutrophils and macrophages and attenuates cardiac ischemia reperfusion injury.36,37 In mice fed a high fat diet, administration of recombinant Lcn2 protein induces endothelial dysfunction and adipose tissue inflammation.38 In astrocytes, Lcn2 is thought to be a chemokine inducer.35 Interestingly, Lcn2 deficient mice showed reduced levels of IL-6, MCP-1, IL-1b, and TNF-a after spinal cord injury.39 However, NGAL is also able to inhibit inflammation under certain conditions. Lcn2 plays important roles in the innate immune response by limiting bacterial growth.4 In a murine macrophage cell line, Lcn2 suppressed lipopolysaccharideinduced cytokine expression. However, Lcn2 treatment alone had no effect on gene expression of IL-1b, IL-6, MCP-1, TNF-a, and granulocyte macrophage colony stimulating factor.40 In such murine macrophage cell line, Lcn2 overexpression prevented IL-6 induction on Streptococcus pneumoniae challenge.41 Therefore, some species and cell type specific differences in the effects of NGAL appear to exist. By measuring different factors in atherosclerotic plaque tissue42,43 or blood of patients with carotid stenosis,44,45 previous studies tried to establish the markers for plaque instability as a helpful tool for prediction of unfavorable clinical outcome or selection of treatment strategies. The present study proposes NGAL as a potential player in the atherosclerotic process. Expression of NGAL is confirmed in human atherosclerotic tissue as well as the association of NGAL with symptomatic carotid atherosclerosis. Moreover, the present study is the first that highlights possible mechanisms for the interaction of NGAL into the atherosclerotic process, as it was shown that NGAL creates a proinflammatory milieu via induction of cytokines IL-6, IL-8, and MCP-1 in macrophages, SMCs, and endothelial cells.
Study limitations
The present study has several limitations. It was conducted on a limited number of samples, which may influence the significance of the results. Second, it was not possible to provide detailed histo-morphological analysis of human carotid endarterectomy samples. Moreover, the study is predominantly of an experimental nature and applies human carotid atherosclerotic tissue ex vivo and human cell culture in vitro. Therefore, further studies are necessary to validate the levels of NGAL as a potential biomarker of atherosclerotic plaque instability in patients with carotid stenosis.
CONFLICT OF INTEREST
None.
FUNDING
This study was funded by the Herzfelder’sche Familienstiftung (Vienna, Austria) to Svitlana Demyanets. Furthermore, this work was supported by the Association for the Promotion of Research in Atherosclerosis, Thrombosis and Vascular Biology.
Upper Extremity Ischemia as a “Warning Shot” of Cerebellar Infarction
S. Regus *, W. Lang
FEBVS University Hospital, Department of Vascular Surgery, Krankenhausstrasse 12, 91054 Erlangen, Germany A 44-year-old woman without cardiovascular risk factors c omplained of pain and coldness in the digits of her left hand. Radial and ulnar pulses were palpable, with equal brachial pressures on both sides. After a 2-hour stay in the outpatient department she developed acute headache, nausea, and vomiting. Computed tomographic scan with contrast medium revealed a floating thrombus in the left subclavian artery extending towards the origin of the vertebral artery (A). Brain magnetic resonance imaging demonstrated an infarction of the left cerebellum (B), whereupon the patient was immediately referred to the stroke unit. vier Ltd. All rights reserved.
Article Images (0)
×![]()
Bioz is the world’s most comprehensive AI search engine for scientific experimentation. The Bioz search engine offers researchers billions of data-driven product, technique, and protocol recommendations. Bioz taps into the latest advances in Artificial Intelligence (AI) – including Natural Language Processing (NLP), Machine Learning (ML) and Generative AI to mine and structure hundreds of millions of pages of complex and unstructured scientific papers. By harnessing the power of AI, Bioz provides researchers with an unprecedented amount of summarized scientific experimentation knowledge right at their fingertips, ultimately helping to speed up drug discovery and the rate of success in finding cures for diseases. Bioz is used by over 15 Million researchers from over 17,000 different universities and companies in 196 countries.
