Article Images (0)
×![]()
featured_play_listSave article to folder
X
Create new folder
Full Text
PDF
Table of Contents
Abstract
Abstract
14 Almond anthracnose is a serious and emerging disease in several countries. All isolates 15 causing almond anthracnose have been assigned to the Colletotrichum acutatum species 16 complex, of which only C. fioriniae and C. godetiae have been associated with the disease to 17 date. Here, we characterized Colletotrichum isolates from almond fruits affected by 18 anthracnose in the Andalusia region. Two Colletotrichum isolates causing olive anthracnose 19 were included for comparison. Morphological characters were useful for separating the 20 isolates into groups based on colony morphology. Pathogenicity tests in almond, olive, and 21 apple fruit showed differences in virulence and some degree of pathogenic specialization 22 among isolates. Molecular characterization allowed clear identification of the Colletotrichum 23 isolates tested. The olive isolates were identified as C. godetiae and C. nymphaeae, both 24 previously identified in Andalusian olive orchards. Two phylogenetic species were identified 25 Page 1 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 317 -0 31 8R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r.
1 Almond anthracnose is a serious and emerging disease in several countries. All isolates 15 causing almond anthracnose have been assigned to the Colletotrichum acutatum species 16 complex, of which only C. fioriniae and C. godetiae have been associated with the disease to 17 date. Here, we characterized Colletotrichum isolates from almond fruits affected by 18 anthracnose in the Andalusia region. Two Colletotrichum isolates causing olive anthracnose 19 were included for comparison. Morphological characters were useful for separating the 20 isolates into groups based on colony morphology. Pathogenicity tests in almond, olive, and 21 apple fruit showed differences in virulence and some degree of pathogenic specialization 22 among isolates. Molecular characterization allowed clear identification of the Colletotrichum 23 isolates tested. The olive isolates were identified as C. godetiae and C. nymphaeae, both 24 previously identified in Andalusian olive orchards. Two phylogenetic species were identified 25 Page 1 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu 2 among the almond isolates: C. godetiae, with gray colonies, which is well known in other 26 countries, and C. acutatum, with pink-orange colonies. This species identification differs from 27 those of pink-colony subpopulations described in other countries, which are C. fioriniae. 28 Therefore, this study is also the first report of a new species of Colletotrichum causing 29 almond anthracnose within the C. acutatum species complex. 30 31 Introduction 32 Almond (Prunus dulcis L.) is a traditional and characteristic crop in the Mediterranean 33 Basin, with great social and economic importance due to its large acreage and its demarcation, 34 mostly in areas with unfavorable climatic and orographic conditions (Arquero et al. 2013). In 35 Spain, it is the fruit crop second in acreage after the cultivated olive (Olea europaea subsp. 36 europaea L.). The almond crop currently occupies approximately 500,000 ha in Spain, of 37 which 150,000 ha are located in the Andalusia region (southern Spain). The average crop 38 yield in Spain is less than 150 kg ha-1 of almond kernels, whereas in California (San Joaquin 39 Valley; USA) it is approximately 2,500 kg ha-1 (Ollero-Lara et al. 2016). During the last few 40 years, almonds have undergone a significant change in Spain. The current economic impact of 41 almond kernels all over the world as well as the necessity to find extensive alternative crops 42 in this country have led growers in the Iberian Peninsula to establish new almond plantings in 43 non-traditional areas for this crop, with optimum soil and climatic conditions. However, in 44 these new plantings, the incidence of foliar diseases has been higher than that in traditional 45 fields located in areas with unfavorable climatic and orographic conditions, which is limiting 46 its profitability (Arquero et al. 2013; Ollero-Lara et al. 2016). 47 In spring of 2014, a serious fruit disease showing typical anthracnose symptoms was 48 observed in almond orchards in the provinces of Huelva and Sevilla (Andalusia region) where 49 it is considered an emerging disease (López-Moral et al. 2016). Almond anthracnose was 50 Page 2 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 3 described for the first time in Italy in 1896. Between the beginning and the middle of the 51 twentieth century, the disease was detected in California, South Africa, Tunisia and France 52 (Förster and Adaskaveg 1999; Teviotdale et al. 2002). However, it was considered a 53 secondary disease in the Mediterranean Basin until the 1960s. In Spain, symptoms of the 54 disease were first observed in 1900 on the island of Mallorca (Ballester 1916), but the causal 55 agent of the disease was not identified until 1965 in Huesca (northeastern Spain). Four years 56 later, it was identified in Valencia, Castellón and Tarragona (eastern Spain) (Palazón and 57 Palazón 1979). Since then, it has been detected regularly, especially in orchards on the 58 Mediterranean coast, becoming a clearly endemic disease. Currently, almond anthracnose is 59 widely distributed in the main almond-growing areas worldwide (Teviotdale et al. 2002). 60 The pathogen mainly infects fruits, causing depressed, sunken, round, and orange 61 lesions from 5 to 12 mm in diameter. In the incipient lesions, the coloration of affected areas 62 does not clearly differ from the normal epidermis. However, a whitish mycelium that 63 produces abundant orange masses of conidia appears when the symptoms progress. Finally, 64 the affected fruits mummify, and most of them fall to the soil. The mummies that remain in 65 the tree canopy during autumn and winter serve as the main inoculum source for the spring 66 crop the following year. Almond trees with large numbers of diseased fruits also show 67 defoliation and dieback of shoots and branches due to the toxins produced by the pathogen in 68 the infected fruits (Adaskaveg et al. 2012; Förster and Adaskaveg 1999). This disease may 69 cause important economic losses due to the premature loss of fruit, which could represent up 70 to 80% of the harvest (López-Moral et al. 2016). Even the leaves may show symptoms in the 71 tips and margins, giving rise to irregular lesions which conclude in total necrosis of the leaf 72 (Supplemental Fig. 1) (Palazón and Palazón 1979). 73 The causal agent of almond anthracnose was described for the first time in 1896 in 74 Italy as Gloeosporium amygdalinum Brizi. Later, studies confirmed that this species was 75 Page 3 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 4 indistinguishable from other Gloeosporium species, being reclassified by Arx (1970) in the 76 Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. species complex. In 1965, the species 77 C. acutatum J.H. Simmonds, close to C. gloeosporioides, was identified. These two 78 Colletotrichum species differ in morphology mainly in the ends of their conidia, which are 79 sharp in C. acutatum and rounded in C. gloeosporioides (Simmonds 1965; Sutton 1980, 80 1992). Consequently, based on these morphological characters, all isolates of C. 81 gloeosporioides causing almond anthracnose were reclassified as C. acutatum (most of the 82 isolates) and C. gloeosporioides (a few isolates recovered in Israel) (Freeman et al. 1998). 83 After that time, based on molecular characters, all isolates causing almond anthracnose have 84 been assigned to the species C. acutatum (Adaskaveg and Hartin 1997; Freeman et al. 2000; 85 Gueber et al. 2003, McKay et al. 2009). Nevertheless, because C. acutatum is an extremely 86 genetically variable species, it has recently been considered as a species complex, within 87 which 31 phylogenetic species have been described (Damm et al. 2012). Among them, only 88 two species, C. fioriniae Marcelino & Gouli ex R.G. Shivas & Y.P. Tan and C. godetiae 89 Neerg., have been associated with almond anthracnose. These two species coincide with the 90 two subpopulations established on the basis of morphological characters, mainly pink (C. 91 fioriniae) or gray (C. godetiae) colony color, which have been described for the causal agents 92 of almond anthracnose (Damm et al. 2012; Guerber et al. 2003; Teviotdale et al. 2002). 93 In Andalusia, almond and olive crops coexist in the same agroecosystem. Olive is the 94 most important perennial crop in Spain, leading the world production of olive oil and olives, 95 and it is also seriously affected by anthracnose (Moral et al. 2014). Olive anthracnose has 96 been plentifully studied all over the world (Cacciola et al. 2012; Moral et al. 2014; Talhinhas 97 et al. 2011). In Spain, the disease’s symptoms have been mainly associated with the fruit at 98 ripening, causing fruit rot, mummification and fruit drop (Moral et al. 2009; Moral et al. 99 2014). The causal agents belong to the species complex of C. acutatum and C. 100 Page 4 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 5 gloeosporioides (Cacciola et al. 2012; Moral et al. 2014; Talhinhas et al. 2011). Within the C. 101 acutatum species complex, C. godetiae is the dominant species in Spain (Moral et al. 2014). 102 Nevertheless, the interactions between the Colletotrichum spp. associated with anthracnose in 103 the almond and olive crops have not yet been studied. 104 In Spain, little attention has been given to almond anthracnose. Nevertheless, it is 105 considered a re-emerging disease, becoming endemic. It has increasingly become a cause for 106 concern among growers in the almond-producing areas of the Andalusia region. For these 107 reasons, diagnosis and control of almond anthracnose have gained great importance. 108 However, although several studies about the identification and characterization of 109 Colletotrichum spp. isolates obtained from almond have been conducted in different areas of 110 the world (Adaskaveg and Hartin 1997; Förster and Adaskaveg 1999; Freeman et al. 2000; 111 Guerber et al. 2003; McKay et al. 2009), the etiology, epidemiology, and control of this 112 disease in Spain is still uncertain. Identification and characterization of the causal agent is 113 essential to establish the basis of studies on epidemiology and disease control. Thus, the main 114 objective of this study was to characterize Colletotrichum isolates obtained from almonds 115 affected by anthracnose in Andalusia, in relation to morphological, pathogenic and genetic 116 characteristics. At the same time, the almond isolates were compared with Colletotrichum 117 isolates causing olive anthracnose in the same region. 118 119 Material and Methods 120 Collection of fungal isolates. From 2014 to 2016, almond fruits showing typical anthracnose 121 symptoms were collected from 10 commercial orchards located in the municipalities of Alcalá 122 del Río, Lebrija, Maribáñez and Villamanrique de la Condesa (Seville province); Gibraleón 123 (Huelva province); Santa Cruz (Córdoba province) and Badajoz (Badajoz province), all in 124 southwestern Spain. One commercial orchard was surveyed per location, with the exception 125 Page 5 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 6 of Lebrija, Gibraleón and Villamanrique municipalities, in which two commercial orchards 126 were surveyed. Affected fruits were surface disinfected with commercial bleach (Cl at 50 g 127 liter–1) at 10% (vol/vol) in sterile water for 1 min, and air-dried on sterile filter paper for 30 128 min. Affected tissues were cut with a sterile scalpel and plated on potato dextrose agar (PDA) 129 (Difco Laboratories®, Detroit) acidified with lactic acid (2.5 ml of 25% [vol/vol] per liter of 130 medium) to minimize bacterial growth (APDA). When the affected fruit tissues showed 131 abundant pathogen sporulation, masses of conidia were removed using a sterile needle and 132 cultured in petri dishes on APDA. Petri dishes were incubated at 25 ± 2°C under a 12-h 133 diurnal photoperiod of cool fluorescent light (350 µmol m–2 s–1) for 5 days, and hyphal tips 134 from the colonies were transferred to PDA and incubated as described above. In total, 420 135 Colletotrichum spp. isolates were obtained and divided into two different groups or 136 subpopulations according to the morphology of the colony, especially colony color: gray and 137 pink-orange. Twelve Colletotrichum isolates (9 isolates of the gray subpopulation and 3 138 isolates of the pink-orange subpopulation) were selected for further analysis in this study 139 (Table 1). In addition, two Colletotrichum isolates, Col-506 and Col-508, representatives of 140 the two subpopulations causing anthracnose in olive orchards in the Andalusia region were 141 also included (Table 1). Single-spore isolates were prepared prior to use by means of the 142 serial dilution method (Dhingra and Sinclair 1995). All isolates were used for molecular 143 characterization. Representative isolates from each almond subpopulation, gray (Col-522, 144 Col-548 and Col-555) or pink-orange (Col-536, Col-537 and Col-538), and from olive (Col-145 506 and Col-508), were selected for morphological characterization and pathogenicity tests on 146 detached almond, olive and apple fruits (Table 1). All isolates are maintained in the collection 147 of the Departamento de Agronomía at the Universidad de Córdoba (Spain). 148 149 Page 6 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 7 Colony and conidium morphology. Four representative isolates of the two subpopulations 150 from almond (Col-522 and Col-536) and the two olive subpopulations (Col-506 and Col-508) 151 (Table 1), were used to study conidium morphology growing in two different media, PDA and 152 artificially inoculated detached almond fruits of cv. ‘Guara’ (moderately susceptible) (López-153 Moral et al. 2016). Healthy fruits were collected from the network of trials of almond 154 orchards belonging to the Andalusian Institute for Research and Formation in Agriculture and 155 Fishery (IFAPA in Spanish) located in Córdoba province. For the evaluation on culture 156 medium, the isolates were grown on PDA for 7 days as described above. There were three 157 replicate Petri dishes per isolate. For the evaluation on artificially inoculated detached almond 158 fruits, each fruit was punctured superficially with a needle (0.8 mm in diameter and 25 mm 159 long) before inoculation. Fruits were placed in humid chambers (plastic containers, 22 × 16 × 160 10 cm), inoculated with a 20-µl drop of a conidial suspension adjusted with a hemocytometer 161 to 106 conidia ml-1 deposited on the wound and incubated at 23 ± 2°C with a 12-h photoperiod 162 and 100% relative humidity (RH) for 14 days. A completely randomized design with fungal 163 isolates as the independent variable and humid chambers as replications was performed. There 164 were three replicate humid chambers per isolate or control. Fifteen fruits per humid chamber 165 and per isolate or control were used (225 almond fruits in total). The experiment was 166 conducted twice. 167 For each isolate and growth medium (PDA or almond fruit), the size and the shape of 168 100 conidia were measured by using a Nikon Eclipse 80i microscope (Nikon Corp., Tokyo) at 169 400× magnification. Culture characteristics (texture, density and color) were recorded on 7-170 day-old colonies grown on PDA. The size of the conidia was determined by measuring their 171 length and width, and their volume was calculated (considering conidia as cylindrical 172 structures) by the equation V = π · r2 · h, where r = conidium width/2 and h = conidium 173 length. According to their shape, conidia were classified into three categories: 1) conidia with 174 Page 7 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 8 two rounded ends (ellipsoid); 2) conidia with one rounded end and the other acute (clavate); 175 and 3) conidia with two acute ends (fusoid). Data were expressed as a percentage (%) of each 176 category to determine the predominant conidium type for each isolate. 177 Data from the two replicates of the experiment were combined after checking for 178 homogeneity of the experimental error variances with the F test. For the statistical analysis, 179 length, width and volume variables were analyzed using the Kruskal-Wallis non-parametric 180 method, due to the lack of homogeneity of variances. Mean values were compared by Dunn’s 181 test at P = 0.05. All data of this study were analyzed using Statistix 10 (Analytical Software, 182 2013). 183 184 Conidium production. Mycelial plugs (7 mm in diameter) obtained from the margins of 7-185 day-old actively growing colonies on PDA of the four representative isolates (Col-506, Col-186 508, Col-522 and Col-536) were placed in the center of Petri dishes (9 cm in diameter) (one 187 plug per plate) with Oatmeal Agar (OA) (Crous et al. 2009) or Spezieller Nahrstoffarmer 188 Agar (SNA) (Leslie and Summerell 2006). Petri dishes were incubated at 23 ± 2°C with a 12-189 h photoperiod. After 21 days, four plugs of agar (7 mm in diameter) with mycelia and spores, 190 were cut from the growing edge of each colony from each culture media. The plugs of each 191 plate were introduced into a glass tube containing 25 ml of distilled and deionized sterile 192 water (DDSW). Glass tubes with plugs were shaken for 5 s, and the number of conidia per ml 193 was counted using a hemocytometer. There were three replicate Petri dishes per isolate and 194 culture medium combination, and the experiment was conducted twice. 195 A randomized complete block design was used with experiments as blocks, isolates 196 and media as the independent variables, and Petri dishes as replications. The two runs of the 197 experiment were combined after checking for homogeneity of the experimental error 198 variances by the F test. Analysis of variance (ANOVA) was applied considering each medium 199 Page 8 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 9 (OA and SNA) separately, because there were large differences between the media. Means 200 were compared according to Fisher’s protected least significant difference (LSD) test at P = 201 0.05 (Steel and Torrie 1985). 202 203 Effect of temperature on mycelial growth. Mycelial plugs of the four representative isolates 204 (Col-506, Col-508, Col-522 and Col-536) were placed on PDA as described above. Petri 205 dishes were incubated at 0, 5, 10, 15, 20, 25, 30, and 35°C in darkness. After 8 days of 206 incubation, the largest and smallest diameters of colonies were measured using a digital scale 207 ruler. Mean data were converted to radial growth rate (mm day-1). There were three replicate 208 Petri dishes per isolate and temperature combination, and the experiment was conducted 209 twice. 210 For each isolate, to analyze the variation of the mycelial growth rate over temperature, 211 a non-linear adjustment of the data was applied using the generalized Analytis Beta model, 212 which is expressed by the following equation (Moral et al. 2012; Viruega et al. 2011): Y = c × 213 t a × (1 - t)b (Equation 1). In this equation, Y = standardized growth rate; t = standardized 214 temperature obtained by the formula t = (T – Tmin) / (Tmax - Tmin), where Tmin and Tmax are the 215 minimum and maximum growth temperatures, respectively; and a, b, and c are unknown 216 parameters. The above equation may be rewritten as Y = d × (T - Tmin) a × (Tmax - T) b (Equation 217 2). Subsequently, the optimum growth temperature and its corresponding maximum growth 218 rate were calculated for each isolate. For this, the values of a and b obtained from equation 2 219 in each repetition of each isolate were replaced in equation 3, which was obtained by equating 220 to 0 the derivative of equation 2: Topt = [(a × Tmax) + (b × Tmin)] / (a + b) (Equation 3). 221 ANOVA was performed on the estimated optimum temperature and maximum growth rate 222 data obtained from the fitted model. General ANOVAs were applied to the pooled data of 223 both variables using experimental runs as blocks, since variances of the experimental error 224 Page 9 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 10 were homogeneous. Mean values of optimum temperature and maximum growth rate were 225 compared using Fisher’s protected LSD test at P = 0.05 (Steel and Torrie 1985). 226 227 Pathogenicity tests. Pathogenicity on detached almonds. Detached, healthy and unwounded 228 almond fruits of cvs. Guara and Lauranne, which are moderately susceptible (López-Moral et 229 al. 2016) and representative of the most used cultivars in the new almond plantings in Spain 230 (Arquero et al. 2013), were collected in the almond orchards of the IFAPA trials network in 231 the province of Córdoba. Fruits were harvested at their first stages of maturity, when they had 232 not yet reached their final size and were highly susceptible to the disease. They were 233 inoculated with six Colletotrichum isolates from almond (Col-522, Col-536, Col-537, Col-234 538, Col-548, and Col-555) and two from olive (Col-506 and Col-508) (Table 1). Almonds 235 were washed with 0.02% Tween-20 solution in tap water for 1 min, surface-sterilized by 236 immersing them in 10% solution of commercial bleach (Cl at 50 g l-1) for 1 min, and double-237 washed with tap water. A second disinfection was carried out with 70% ethanol solution for 1 238 min, and the fruits were allowed to air dry on sterile filter paper for 30 min. Disinfected 239 almonds were placed in humid chambers, wounded, inoculated and incubated as described 240 above. Non-inoculated almonds with a 20 µl drop of DDSW deposited in the wound were 241 included as controls. A factorial randomized complete-block design with three replicate 242 humid chambers per cultivar and isolate or control was performed. Fifteen fruits per humid 243 chamber, per cultivar, and per isolate or control were used (810 almond fruits in total). The 244 experiment was conducted twice. 245 Disease severity in inoculated fruits was evaluated every four days until most of the 246 fruits reached 90-100% of their surface affected (20 days; five evaluations). The average of 247 the major and minor diameters of the lesion produced in each fruit was used to determine the 248 percentage of affected fruit surface for each isolate, cultivar and evaluation time. For each 249 Page 10 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 11 cultivar-isolate combination, the area under the disease progress curve (AUDPC) was 250 calculated by trapezoidal integration of the percentage of affected fruit surface over time. 251 Subsequently, relative area under the disease progress curve (RAUDPC) was obtained by 252 dividing each AUDPC by the highest AUDPC value obtained in the experiment. RAUDPC 253 data from both experiments were subjected to a factorial ANOVA, and the treatment means 254 were compared according to Tukey’s honestly significant difference (HSD) test at P = 0.05 255 because there were more than 5 means (Steel and Torrie 1985). Since interaction between 256 fungal isolate and almond cultivar was not significant, isolates were compared combining the 257 data from both cultivars. 258 Pathogenicity on detached olives. Unwounded violet (color class 3) (Barranco and 259 Rallo 2005) olive fruits of the moderately susceptible cv. Arbequina (Moral et al. 2008) were 260 collected from healthy olives growing in the World Olive Germplasm Bank (WOGB) 261 belonging to the IFAPA, located in Córdoba province. The four isolates selected for 262 inoculation were Col-506 and Col-508 from olive, and Col-522 and Col-536 from almond. 263 Before inoculation, the olives were washed and surface disinfected as described by Moral et 264 al. (2008). Fruits were placed in humid chambers as described above and inoculated by 265 spraying them until the run-off point with a conidial suspension adjusted with a 266 hemocytometer to 105 conidia ml-1. After inoculation, the humid chambers were incubated at 267 23 ± 2°C with a 12-h photoperiod. In addition, non-inoculated olives sprayed with DDSW 268 were included as controls. A completely randomized design with three replicate humid 269 chambers per isolate and control was used. Twenty fruits per humid chamber and per isolate 270 or control were used (300 olive fruits in total). The experiment was conducted twice. 271 Disease severity in inoculated fruits was evaluated weekly until most of the fruits 272 achieved the maximum value (100%) (approximately 28 days). Disease severity was assessed 273 using a 0 – 5 rating scale: 0) no symptoms; 1) 1-25% of the fruit surface affected; 2) 26-50%; 274 Page 11 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 12 3) 51-75%; 4) > 75%; and 5) 100% (Moral et al. 2008). A disease severity index (DSI) was 275 calculated in each replication using the following formula: DSI = [(Σni × i) / (N × 5)] × 100, 276 where i represents a severity (0 to 5), ni is the number of fruit with severity i, N is the total 277 number of fruit, and 5 is the highest value of the severity rating scale. RAUDPC was 278 calculated by trapezoidal integration of DSI values over time. RAUDPC data from the two 279 runs of the experiment were subjected to ANOVA, and means were compared according to 280 Fisher’s protected LSD test at P = 0.05 since there were less than 5 means (Steel and Torrie 281 1985). 282 Pathogenicity on apple fruits. Inoculation of apple fruits (Malus domestica Borkh) was 283 carried out to study the pathogenicity of Colletotrichum spp. isolates in a different host. 284 Healthy and unwounded apples of cv. Golden Delicious obtained from a commercial market 285 were used. Four isolates of Colletotrichum selected as representative, Col-506 and Col-508 286 from olive and Col-522 and Col-536 from almond, were used for inoculation. Fruits were 287 washed under running tap water, surface-sterilized by immersion in 70% ethanol solution and 288 allowed to air-dry on a laboratory bench. Subsequently, four holes (7 mm in diameter and 3 289 mm deep) were made in the widest part of the fruit using a cork-borer, with equal distances 290 between them. Inoculation was carried out by depositing inside each hole a 40-µl drop of a 291 conidial suspension adjusted with a hemocytometer to 104 conidia ml-1. Non-inoculated 292 apples with a 40-µl drop of DDSW deposited into each hole were included as controls. 293 Inoculated and non-inoculated apples were placed in humid chambers (closed plastic 294 containers of 30 × 45 × 15 cm, filled with sterile perlite at the bottom with 100% RH obtained 295 by adding 500 ml of water) and incubated as described above. A factorial randomized 296 complete-block design with three replicate humid chambers per isolate and control was used. 297 Four apples per humid chamber and per isolate or control were used (60 apples in total). The 298 experiment was conducted twice. 299 Page 12 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 13 Disease severity was assessed by measuring the major and minor diameters of each 300 lesion in each fruit. The first evaluation was carried out 10 days after inoculation, and 301 subsequent evaluations were performed every 3 days until the lesions reached the maximum 302 diameter (16 days; three evaluations). The average diameter was expressed in mm of real 303 growth by deducting the 7 mm corresponding to the hole diameter. Subsequently, RAUDPC 304 was calculated by trapezoidal integration of the mean diameter of the lesion over time, and a 305 one-way ANOVA was applied to the RAUDPC data. Comparison of means was performed 306 according to Fisher’s protected LSD test at P = 0.05 (Steel and Torrie 1985). 307 308 Molecular characterization. DNA extraction. All isolates of Colletotrichum spp. shown in 309 Table 1 were characterized molecularly. For genomic DNA, fungal mycelium and conidia 310 from single-spore cultures grown on PDA at 23 ± 2°C with a 12-h photoperiod for 7 days 311 were used. Total DNA was extracted using the EZNA® Fungal DNA Kit (OMEGA Bio-Tek) 312 following the manufacturer's instructions. The concentration and purity of the extracted DNA 313 were determined with a MaestroNano® spectrophotometer (MaestroGen). 314 PCR analysis and sequencing. Six genomic areas were amplified and sequenced, 315 including the 5.8S nuclear ribosomal gene with two flanking internal transcribed spacers 316 (ITS), a 200-bp intron of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and 317 partial sequences of the chitin synthase 1 (CHS-1), histone 3 (HIS3), actin (ACT) and beta-318 tubulin (tub2) genes. The primer pairs used for each genomic area, as well as their sequences, 319 are shown in Table 2. 320 PCR amplifications were performed in a MyCyclerTM Thermal Cycler (BIO-RAD) in 321 a total volume of 25 µl. All PCR mixtures contained 20 ng of genomic DNA, 5 µl of 5x My 322 Taq Reaction Buffer and 0.13 µl of My Taq DNA Polymerase (Bioline). Additionally, for 323 GAPDH, CHS-1, HIS3, and ACT PCRs 0.2 µM of each primer was used, and the reaction 324 Page 13 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 14 conditions were an initial denaturation step of 5 min at 94°C, followed by 40 cycles of 30 s at 325 94°C, 30 s at 52°C and 30 s at 72°C, and a final step of 7 min at 72°C (Damm et al. 2012); for 326 the ITS region PCR, 0.4 µM of each primer was used, and the conditions were an initial 327 denaturation step of 3 min at 94°C, followed by 35 cycles of 15 s at 94°C, 20 s at 48°C and 1 328 min at 72°C, and a final step of 7 min at 72°C. A negative control was included in all PCRs, 329 for which ultrapure water was used instead of DNA. Amplification products were checked by 330 electrophoresis in 1.5% (w/v) agarose gel stained with RedSafeTM (Intron Biotechnology) and 331 visualized under UV. As a molecular weight marker, 100-bp DNA Ladder-GTP (gTPbio) was 332 used. Subsequently, the PCR products were purified using MEGAquick-spinTM Total 333 Fragment DNA Purification kit (INTRON Biotechnology) following the manufacturer's 334 instructions, and they were sent to the Central Service Support Research (SCAI) of the 335 University of Córdoba (Spain) for sequencing. 336 Phylogenetic analysis. The nucleotide sequences generated by the forward and reverse 337 primers, after being checked and corrected where necessary, were used to obtain consensus 338 sequences using DNASTART LaserGen SeqMan® v. 7.0.0. In addition, sequences from the 339 forty-five main species of Colletotrichum spp. and from C. orchidophilum Damm, P.F. 340 Cannon & Crous as outgroup (Damm et al. 2012) were obtained from GenBank 341 (http://www.ncbi.nlm.nih.gov/genbank/) and included in the analysis (Table 3). 342 Previous studies conducted by Damm et al. (2012) indicated that all six genomic areas 343 under study were consistent and combinable, as they showed no conflict in the tree topologies 344 obtained. Therefore, multilocus sequences obtained from the union of individual genes were 345 used for phylogenetic analysis. Each of the individual genes, as well as a combined data set, 346 was aligned and analyzed using MEGA v.7 (Kumar et al. 2016). Phylogenetic Data Editor 347 (PhyDE-1) software was used to concatenate the genes and to form a supermatrix. First, a 348 maximum parsimony analysis (MP) was performed for multilocus alignment using the Tree-349 Page 14 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 15 Bisection-Reconnection (TBR) algorithm in which initial trees (10 replicates) were obtained 350 by random addition of sequences. Alignment gaps were treated as missing data. The 351 robustness of the trees obtained was measured by 2,000 bootstrap replications. Tree length 352 (L), consistency index (CI), retention index (RI), rescaled consistency index (RC) and 353 homoplasy index (HI) were also calculated. Multilocus sequences were also analyzed by 354 Bayesian Inference using the Markov Chain Monte Carlo (MCMC) algorithm. MrBayes 355 v.3.2.2 was used to generate phylogenetic trees with Bayesian probabilities (Ronquist et al. 356 2012). MEGA v.7 (Kumar et al. 2016) was used to determine the models of nucleotide 357 substitution used for each gene partition. The analysis was initiated with a random tree and 358 default parameters. Two analyses in parallel were performed with four Markov chains, 359 evaluating 107 generations and saving the search results once every 100 generations. 360 Sequences derived in this study have been deposited at GenBank (Table 3). 361 362 Results 363 Collection of fungal isolates. A total of 420 Colletotrichum spp. isolates from affected 364 almond fruits with symptoms of anthracnose were recovered. Based on the morphology of the 365 colonies on PDA, especially the color and abundance of mycelium and spore masses, the 366 Colletotrichum isolates were divided into two different groups: i) gray colonies with abundant 367 aerial mycelium and few spore masses (gray type), and ii) pink-orange colonies with very 368 scarce aerial mycelium and abundant spore masses (pink-orange type) (Table 1). Of the 420 369 isolates, 375 were classified as gray type and 45 as pink-orange type, which represent 89.3 370 and 10.7% of the fungal collection, respectively. Pink-orange isolates were recovered only 371 from two commercial orchards located in Lebrija (Sevilla province). In these fields, both 372 colony types were recovered, indicating that both fungal populations can co-exist in the same 373 field or growing area. 374 Page 15 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 16 375 Colony and conidium morphology. The growth pattern of all colonies was radial with 376 concentric circles. The colonies of the olive isolates Col-506 and Col-508 had similar 377 appearances, with formation of abundant aerial mycelium, few conidial masses and light to 378 dark gray color. However, colonies of the Col-508 isolate could be distinguished from those 379 of the Col-506 isolate by their darker gray color, more irregular edges and higher production 380 of conidial masses. The colonies of the almond isolates Col-536 and Col-522 differed greatly 381 from each other. The Col-536 isolate showed a very characteristic and specific colony 382 morphology, with an intense pink-orange color, very scarce aerial mycelium, regular edges 383 and abundant conidial masses. In contrast, colonies of the Col-522 isolate were gray, with 384 abundant and dense aerial mycelium, irregular edges and little production of conidial masses. 385 Comparing the colonies of the olive isolates with those of the almond isolates, the most 386 similar colonies were those of isolates Col-508 (from olive) and Col-522 (from almond). Even 387 in this case, there were slight differences between them that allowed differentiation, such as 388 the less dense and darker gray mycelium in the colonies of the olive isolate Col-508. 389 Interestingly, the color of the colonies that developed on almond fruits artificially inoculated 390 with isolates Col-522 and Col-536 from almond coincided with the colors of the colonies 391 grown on PDA, being gray or pink-orange for isolates Col-522 or Col-536, respectively 392 (Supplemental Fig. 2). 393 Concerning conidium morphology, the pathogen showed unicellular, hyaline, clavate 394 to fusoid conidia. There were significant differences in the size and volume of conidia 395 between the media, with higher sizes found on PDA than on artificially inoculated almond 396 fruits. The mean ± standard error (SE) conidium length and width on PDA varied significantly 397 between isolates (P < 0.0001), being 14.4 ± 1.25 × 3.8 ± 0.41 and 10.4 ± 1.19 × 3.2 ± 0.62 µm 398 for the isolates Col-508 and Col-536, respectively. Data analysis using the nonparametric 399 Page 16 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 17 method of Kruskal-Wallis showed significant differences among Colletotrichum spp. isolates 400 regarding the length and width, and comparison of means allowed the separation of two clear 401 homogeneous groups according to the host of origin (almond or olive). Concerning conidium 402 volume, four groups corresponding to each of the Colletotrichum spp. isolates studied were 403 established, and the following diminishing volume order was observed: Col-508 > Col-522 > 404 Col-506 > Col-536 (Table 4). Concerning conidium shape, 65% of conidia from olive were 405 clavate (category 2), whereas 60% of conidia from almond were fusoid (category 3) 406 (Supplemental Fig. 2). 407 On the other hand, the conidium length data obtained from artificially inoculated 408 almond fruits showed significant differences between isolates (P < 0.0001), being 13.2 ± 1.20 409 and 10.8 ± 1.18 µm for the isolates Col-508 and Col-536, respectively. However, no 410 significant differences in width (P = 0.0623) were observed between them. Two 411 homogeneous groups were clearly separated by conidium volume. Conidia produced by the 412 isolate from olive Col-508 were significantly larger (P < 0.0001) than those produced by the 413 rest of the isolates evaluated, which did not differ from each other (Table 4). 414 415 Conidium production. The isolates of Colletotrichum spp. studied were able to produce 416 conidia in the two culture media tested (OA and SNA). All isolates showed higher conidium 417 production in SNA than in OA, and there were significant differences (P < 0.0001) among all 418 isolates in each culture medium. On OA, the highest conidium production was for the isolate 419 Col-536 (130938 conidia ml-1), followed by Col-508 (45875 conidia ml-1), Col-506 (23625 420 conidia ml-1), and the smallest value for Col-522 (4375 conidia ml-1). On SNA, the highest 421 conidium production was for the isolate Col-536 (492500 conidia ml-1), followed by Col-508 422 (269688 conidia ml-1), Col-506 (214213 conidia ml-1), and the smallest value for Col-522 423 (135000 conidia ml-1). 424 425 Page 17 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 18 Effect of temperature on mycelial growth. All isolates of Colletotrichum spp. tested had a 426 similar growth pattern in PDA at the different temperatures evaluated, with the exception of 427 Col-522 from almond. Optimum growth temperatures ranged from 22.4 to 23.7°C, and the 428 maximum growth rate from 4.8 to 6.8 mm day-1 for the isolates Col-522 and Col-536, 429 respectively. ANOVA showed that the isolate Col-522 had an optimum growth temperature 430 (22.4°C) significantly lower (P < 0.0001) than the rest of the isolates, which did not differ 431 among themselves. Only one isolate (Col-506, from olive) grew at the maximum temperature 432 tested (35°C), but this temperature was not lethal for the other isolates, because mycelial 433 plugs incubated at this temperature were able to grow when they were replated on PDA and 434 incubated at 23°C for 7 days. Isolate Col-522 was the only one to grow at 0°C. However, the 435 isolates Col-506 and Col-508 from olive and Col-536 from almond were not able to grow 436 below 4-5°C, showing limited growth at low temperatures (Fig. 1; Table 5). With respect to 437 the maximum growth rate, the comparison of means allowed the establishment of three 438 homogeneous groups. The isolate Col-536 showed a faster growth rate (6.8 mm day-1), 439 followed by Col-508 (6.5 mm day-1) and Col-506 (6.4 mm day-1), among which no significant 440 differences were found. Finally, the isolate Col-522 showed the smallest growth rate (4.8 mm 441 day-1). 442 443 Pathogenicity tests. Pathogenicity on detached almonds. The eight Colletotrichum spp. 444 isolates tested, six from almond and two from olive, representative of the two colony types, 445 were pathogenic to almond fruits, causing depressed, round, and necrotic lesions that 446 extended radially to reach the whole fruit. The factorial ANOVA showed significant 447 differences in virulence between isolates from the two hosts of origin (P = 0.0062) (Fig. 2A) 448 and between almond cultivars (P < 0.0001), but not for the interaction between isolate and 449 Page 18 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 19 cultivar (P = 0.5144). For all isolates tested, cv. Lauranne proved to be significantly more 450 susceptible (RAUDPC = 81.4%) than cv. Guara (RAUDPC = 74.0%). 451 Because the interaction between isolate and cultivar was not significant, data from 452 both cultivars were combined for further statistical analysis. Tukey’s HSD contrasts showed 453 that there were two clear homogenous groups, one major group comprising the pink isolates 454 from almond (Col-536, Col-537 and Col-538) and the two isolates from olive (Col-506 and 455 Col-508), and a second group with the gray isolates from almond (Col-522, Col-548 and Col-456 555), with the first group the most virulent (Fig. 2A). 457 Pathogenicity on detached olives. All Colletotrichum isolates tested, coming from 458 olive or from almond, were pathogenic to olives causing fruit rot. ANOVA showed significant 459 differences in virulence (P < 0.0001) between isolates from the two hosts of origin. 460 Comparison of means using Fisher’s protected LSD test showed three homogeneous groups. 461 The two isolates from olive, Col-506 and Col-510, grouped together with 84.6% and 87.6% 462 RAUDPC values, respectively and were significantly more virulent than those from almond 463 (Col-522 and Col-536). Finally, significant differences were also detected between isolates 464 from almond, with the pink-orange isolate Col-536 (RAUDPC = 45.2%) being more virulent 465 than the gray isolate Col-522 (RAUDPC = 5.6%) (Fig. 2B). 466 Pathogenicity on apple fruits. All isolates of Colletotrichum spp., from olive and 467 almond origin and from both colony types, were pathogenic to apple fruits, causing circular 468 necrotic lesions around wounds. ANOVA showed significant differences in virulence between 469 isolates (P < 0.0001). Comparison of means by Fisher’s protected LSD test showed two 470 homogeneous groups. The major group was formed by isolates from olive Col-506 471 (RAUDPC = 91.1%) and Col-508 (RAUDPC = 85.2%) and the pink-orange isolate from 472 almond Col-536 (RAUDPC = 88.6%), which were significantly more virulent than the gray 473 isolate from almond Col-522 (RAUDPC = 36.9%) (Fig. 2C). 474 Page 19 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 20 475 Phylogenetic analysis. Six gene sequences from a total of 61 isolates of Colletotrichum spp., 476 including the outgroup C. orchidophilum, were studied in this work (Table 3). A total of 1,974 477 characters including alignment gaps were processed, of which 352 characters were 478 parsimony-informative sites and 1,496 were constant. The gene boundaries in the combined 479 matrix were: ITS = 1-417; TUB2 = 418-794; ACT = 795-1,041; CHS-1 = 1,042-1,349; HIS3 480 = 1,320-1,705; and GAPDH = 1,706-1,974. 481 Maximum parsimony analysis showed three equally parsimonious trees, (length = 738 482 steps, CI = 0.662, RI = 0.935, RC = 0.668, HI = 0.338), one of which is shown in Fig. 3. For 483 Bayesian analysis, model JC+G was selected for the genomic region ITS, model K2+G for the 484 regions TUB2, ACT, CHS and GAPDH and model TN93+G for the region HIS3. The 485 consensus tree determined by Bayesian inference confirmed the topology obtained by 486 maximum parsimony. Bayesian posterior probability values agreed with bootstrap supports 487 (Fig. 3). 488 The isolates of Colletotrichum spp. under study were classified into three well-489 supported clades with a bootstrap support of 100% and Bayesian posterior probability value 490 of 1.00. The pink-orange isolates from almond (Col-536, Col-537 and Col-538) were grouped 491 together in clade 4, C. acutatum (bootstrap support: 100% / Bayesian posterior probability 492 value: 1.00). However, the nine gray isolates from almond (Col-522, Col-524, Col-525, Col-493 540, Col-542, Col-544, Col-548, Col-555 and Col-613), as well as the dark gray isolate from 494 olive (Col-508), were included in the subclade of C. godetiae, in clade 5 (100% / 1.00). 495 Finally, the isolate from olive belonging to the light gray subpopulation (Col-506) clustered 496 together with isolates of C. nymphaeae (100% / 1.00) in a subclade belonging to clade 2. 497 498 Discussion 499 Page 20 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 21 The cultivation of almond in Spain has undergone a major expansion during recent 500 years. The incidence of foliar diseases in these new plantings is much higher than in 501 traditional orchards. Therefore, diagnosis and control of fungal diseases of this crop have 502 gained great importance. However, there are significant gaps in the knowledge of some of 503 these diseases, i.e., almond anthracnose. Since anthracnose is an emerging disease in Spain, 504 and because the taxonomy of Colletotrichum species has been recently revised (Cannon et al. 505 2012; Damm et al. 2012), the correct identification of the causal agent is one of the most 506 important aspects to elucidate. Indeed, this work represents the first study elucidating the 507 etiology of almond anthracnose in Spain, providing valuable information about the causal 508 agents associated with the disease in this country. Moreover, this study is the first report of a 509 new species of Colletotrichum causing almond anthracnose within the C. acutatum species 510 complex. 511 Taxonomic studies on Colletotrichum have mainly been focused on the identification 512 of specific or intraspecific taxa, based on phenotypic differences, mainly characteristics of 513 colony morphology, optimum growth temperature and growth rate, as well as conidium shape 514 and size (Freeman et al. 1998; 2000). Since environmental factors have a great influence on 515 the stability of morphological traits and the existence of intermediate forms, morphological 516 criteria are not always adequate to provide a correct identification of Colletotrichum species 517 (Freeman et al. 1998). For this reason, molecular techniques, such as phylogenetic analyses of 518 ribosomal genes (i.e., ITS, 28S, etc.) and functional protein regions (i.e., actin, β-tubulin, 519 calmodulin, etc.), have been incorporated in recent years as fundamental aspects of the 520 identification of species within this genus (Cannon et al. 2012; Damm et al. 2012; Guerber et 521 al. 2003; McKay et al. 2009). Therefore, in the present work, isolates of Colletotrichum spp. 522 collected from almond and olive trees infected by anthracnose were characterized by 523 morphological and molecular methods and by pathogenicity tests. All of these characteristics 524 Page 21 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 22 were useful for identifying the species of Colletotrichum causing almond anthracnose in the 525 Andalusia region. 526 For morphological characterization, the curvature of the ends of the conidia is one of 527 the most important morphological characters in the taxonomy of Colletotrichum species (Arx 528 1970; Sutton 1980, 1992) and is particularly used to separate the two main species associated 529 with almond anthracnose, which are C. acutatum (sharp conidium ends) and C. 530 gloeosporioides (rounded conidium ends) (Freeman et al. 1998; Simmonds 1965). In this 531 study, all isolates from almond showed more than 60% of the conidia having two sharp ends. 532 Thus, according to traditional criteria, these isolates could be classified within the C. 533 acutatum species complex (Damm et al. 2012). Meanwhile, the two isolates from olive (Col-534 506 and Col-508) presented more than 65% of conidia with a single sharp end, so their 535 classification under one species or the other is arbitrary. Therefore, our results reveal that it is 536 not possible to identify all isolates of Colletotrichum based exclusively on this morphological 537 characteristic. The conidium size, another morphological character of taxonomic importance 538 (Sutton 1980, 1992), was not helpful to differentiate the species in this work. Although there 539 were significant differences in the volumes of conidia among isolates, they did not help us to 540 classify them clearly. In fact, the four isolates studied showed significant differences for this 541 variable. Although the size of the conidia has been used to differentiate species of 542 Colletotrichum, this character is very variable depending on the culture media and 543 environmental conditions. Thus, it has not had a great importance in the taxonomy of 544 Colletotrichum spp. (Arx 1970; Sutton 1992). In fact, differences in the size and volume of 545 conidia produced on PDA and on inoculated almonds were observed, showing larger sizes on 546 PDA. This could be because the synthetic PDA provides more nutrients and optimum 547 conditions for fungal development than plant material, in which several plant physiological 548 factors could be affecting pathogen development. In addition, differences in conidium shape 549 Page 22 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 23 and size were observed between both of the C. godetiae isolates, Col-522 and Col-508 from 550 almond and olive, respectively. However, in this last case, these morphological differences 551 could also express genetic differences between the two isolates that could not be detected by 552 the analysis of the six genomic areas used in phylogenetic characterization. 553 With respect to conidium production, there were significant differences between the 554 four isolates tested and between the two culture media used to induce sporulation. It is 555 interesting to note that C. acutatum isolate Col-536 (pink-orange subpopulation) from almond 556 was able to produce markedly more conidia than C. godetiae isolate Col-522 (gray 557 subpopulation) from almond in both media tested. In addition, conidium production of C. 558 godetiae Col-522 was lower than that of C. godetiae Col-508 from olive. For the size of the 559 conidia, this character is very variable and has little importance in the taxonomy of 560 Colletotrichum. However, it has been used to characterize some isolates or species (Arx 561 1970). 562 The growth pattern at different temperatures has traditionally been used as a criterion 563 to differentiate species of the genus Colletotrichum (Bernstein et al. 1995; Smith and Black 564 1990). All isolates tested showed a similar pattern of mycelial growth on PDA at the different 565 temperatures evaluated, with the exception of C. godetiae isolate Col-522 from almond, 566 which showed an optimum growth temperature significantly lower than the rest of the isolates 567 tested. In addition, this isolate was able to grow at temperatures below 5°C, with 0°C being 568 the minimum growth temperature, while the two isolates from olive, C. nymphaeae Col-506 569 and C. godetiae Col-508 and the isolate C. acutatum Col-536 from almond were not able to 570 grow below 4-5°C. However, the maximum growth rate presented a greater variation among 571 isolates. Significant differences between the two isolates from olive were not observed, while 572 there were significant differences between the two isolates from almond and between them 573 and the olive isolates. These results suggest a greater adaptability of Colletotrichum isolates 574 Page 23 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 24 from almond at different temperatures. In fact, although C. godetiae isolate Col-522 from 575 almond has a lower growth rate than C. godetiae isolate Col-508 from olive, the activity of C. 576 godetiae isolate Col-522 from almond at low temperatures could be an adaptive advantage in 577 its life cycle. This temperature adaptability could be essential to increase the inoculum of C. 578 godetiae isolates from almond during the epiphytic phase (winter) as well as for primary 579 infections at fruit setting (late winter-early spring), mainly in almond-growing areas with hot 580 spring and summer seasons. According to this latter conclusion, in this study we also present a 581 life cycle of Colletotrichum spp. causing almond anthracnose (Fig. 4) that has been slightly 582 modified from the one proposed by Peres et al. (2005). The life cycle presented in this study 583 has adapted to hot, dry areas such those in southern Spain, where climatic conditions during 584 spring and summer are not favorable for the pathogen’s activity. This putative climatic 585 adaptability of isolates of C. godetiae associated with almond anthracnose has been confirmed 586 during the disease surveys conducted in this current work. Moreover, these surveys revealed 587 that the frequency of C. godetiae isolated from affected almonds was markedly higher (375 588 isolates; 89.3%) than that of C. acutatum (45 isolates; 10.7%). Our results are in concordance 589 with those observed for olive anthracnose, in which C. godetiae is also the most dominant 590 species in the Andalusia region (Moral et al. 2014). However, further surveys are needed to 591 confirm the frequency of each of the species associated with almond anthracnose in the 592 Andalusia region. 593 Pathogenicity or pathogenic specialization of isolates of Colletotrichum spp. on their 594 hosts of origin has also been a characteristic traditionally used in the identification of specific 595 or intraspecific taxa in this genus (Arx 1970; Sutton 1980). Pathogenicity tests showed 596 significant differences among Colletotrichum isolates and host plants. Pathogenicity tests in 597 olives showed that both Colletotrichum isolates from olive (Col-506 and Col-508) were more 598 virulent than the Colletotrichum isolates from almond (Col-522 and Col-536). However, this 599 Page 24 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 25 difference was not observed in pathogenicity tests conducted using almond and apple fruits, 600 because in these hosts, the C. acutatum isolates (pink-orange subpopulation) from almond did 601 not differ in virulence from the olive isolates. In the three hosts tested, the C. godetiae isolates 602 (gray subpopulation) from almond were the least virulent. Thus, our results suggest that 603 Colletotrichum spp. isolates from olive showed little or no pathogenic specialization, since 604 they were able to infect and develop symptoms in other hosts with a similar degree of 605 virulence to that in its host of origin. These results do not coincide with those obtained in 606 previous studies conducted by Moral et al. (2007), which showed a remarkable pathogenic 607 specialization for isolates from olive. However, the isolates from almond showed some degree 608 of specialization, since the isolate C. acutatum Col-536 was more virulent in almond and 609 apple fruits than in olives. Concerning cultivar resistance in almond, ‘Lauranne’ turned out to 610 be more susceptible to anthracnose than ‘Guara’. However, the cultivar-isolate interaction was 611 not significant according to ANOVA, since none of the eight Colletotrichum isolates showed 612 any preference for either of the two almond cultivars. These results might vary if more and 613 different almond cultivars were inoculated. 614 Phylogenetic analysis showed five main clades, in agreement with the taxonomical 615 studies of Colletotrichum recently performed by Damm et al. (2012). Our results concluded 616 that isolates of the pink-orange subpopulation from almond (Col-536, Col-537 and Col-538) 617 belong to the species C. acutatum, and isolates of the gray subpopulation from almond (Col-618 522, Col-524, Col-525, Col-540, Col-542, Col-544, Col-548, Col-555 and Col-613) belong to 619 C. godetiae. Regarding the isolates from olive, the isolate belonging to the light gray 620 subpopulation (Col-506) was identified as C. nymphaeae, while isolate belonging to the dark 621 gray subpopulation (Col-508) was identified as C. godetiae. The use of molecular techniques 622 based on the analysis of different genomic areas was the key to correctly identifying the 623 Colletotrichum isolates included in this study. However, in this study, morphological 624 Page 25 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 26 characters also allowed separation of the fungal isolates into different groups. For instance, C. 625 godetiae isolates from different hosts, almond (Col-522) and olive (Col-508), were clearly 626 separated by different morphological characters, whereas this difference was not detected by 627 molecular methods. Finally, the two phylogenetic species identified among isolates from 628 olive, C. godetiae and C. nymphaeae, had been previously identified and are representative 629 isolates of C. acutatum species complex present in the olive-growing areas in the Andalusia 630 region, with C. godetiae being the most frequent species (Moral et al. 2014). This work 631 represents the first identification of phylogenetic species between populations of the C. 632 acutatum species complex causing almond anthracnose in Spain. Of the two identified 633 species, C. godetiae coincides with the gray subpopulation, which is well known in other 634 countries (Damm et al. 2012; Gueber et al. 2003). However, the species C. acutatum, which 635 presents pink-orange colonies, does not coincide with the pink subpopulations described in 636 other countries, which have been identified as C. fioriniae (Damm et al. 2012; Gueber et al. 637 2003). Thus, to our knowledge, this is the first report of a new identified species, C. acutatum, 638 within the C. acutatum species complex, causing almond anthracnose. 639 Colletotrichum acutatum has been described in major almond-growing areas 640 worldwide, such as Australia or California, as causing fruit rot in several crops other than the 641 almond tree (Damm et al. 2012), and in Portugal as associated mainly with olive anthracnose 642 (Sreenivasaprasad and Talhinhas 2005). Our work is relevant because we give new etiological 643 information about C. acutatum, reporting this species for the first time as a causal agent of 644 almond anthracnose. Moreover, important epidemiological traits have been described in this 645 study. In this sense, we have demonstrated that C. acutatum isolates from almond had a 646 higher capacity to produce conidia and a higher growth rate at high temperatures (35°C) than 647 the other tested isolates. This information is relevant because it suggests that these isolates are 648 especially dangerous for areas with warm spring seasons, particularly when rains occur, 649 Page 26 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 27 facilitating infection and disease development. Concerning C. godetiae isolates from almond, 650 our results show that these isolates have lower capacity to produce conidia, lower growth rate 651 and lower virulence than the other tested isolates. However, the ability of these isolates to 652 grow at low temperatures is an important advantage for causing infection during the short 653 infection period of their life cycle (late winter-early spring) in most years. This could explain 654 why C. godetiae is markedly more frequent in affected almond orchards in the Andalusia 655 region than C. acutatum. The information generated in the current study will be highly 656 advantageous for developing future epidemiological and control studies of the disease. 657 Finally, the life cycle of almond anthracnose in southern Spain as modified in this study (Fig. 658 4) should be used to determine the critical stages for effective management strategies against 659 the disease. 660 661 Acknowledgments 662 This research was funded by the Junta de Andalucía (project ‘Transforma de 663 Fruticultura Mediterránea’ from the Andalusian Institute for Research and Formation in 664 Agriculture and Fishery, IFAPA). C. Agustí-Brisach is the holder of a ‘Juan de la Cierva-665 Formación’ fellowship from MINECO. The authors thank ‘Crisol/Arboreto’ and ‘Mañán’ 666 OPFHs, and the private company ‘Almendras Francisco Morales’ for their collaboration. 667 668 Literature Cited 669 Adaskaveg, J. E., and Hartin, R. J. 1997. Characterization of Colletotrichum acutatum isolates 670 causing anthracnose of almond and peach in California. Phytopathology 87:979-987. 671 Adaskaveg, J. E., Gubler, W. D., Duncan, R., Stapleton, J. J., and Holtz, B. A. 2012. UC 672 Management Guidelines for Anthracnose on Almond, UC IPM. 673 www.ipm.ucdavis.edu/PMG/r3101111.html 674 Page 27 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 28 Arquero, O., Belmonte, A., Casado, B., Cruz-Blanco, M., Espadafor, M., Fernández, J. L., 675 Gallego, J. C., García, A., Lorite, I., Lovera, M., Parra, M. A., Ramírez, A., Roca, L., 676 Romancho, F. J., Romero, J., Salguero, A., Santos, C., Serrano, N., Trapero, A., Urquiza, 677 F., and Viñas, M. 2013. Manual del almendro. Consejería de Agricultura, Pesca y 678 Desarrollo Rural. Ediciones Junta de Andalucía, Sevilla, Spain. 679 Arx, J. A. von. 1970. A revision of the fungi classified as Gloeosporium. Bibl. Mycol. 24:1-680 203. 681 Ballester, A. 1916. Enfermedades del almendro en Baleares. Imprenta de J. Tous, Palma, 682 Spain. 683 Barranco, D., and Rallo, L. 2005. Épocas de floración y maduración. Pages 281-292 in: 684 Variedades de olivo en España. D. Barranco, R. Fernández-Escobar and L. Rallo, eds. Co-685 edition MAPA/Mundi-Prensa, Madrid, Spain. 686 Bernstein, B., Zehr, E. I., Deam, R. A., and Shabi, E. 1995. Characteristics of Colletotrichum 687 from peach, apple, pecan, and other hosts. Plant Dis. 79:478-482. 688 Cacciola, S. O., Faedda, R., Sinatra, F., Agosteo, G. E., Schena, L., Frisullo, S., and di San 689 Lio, M. 2012. Olive anthracnose. J Plant Pathol. 94:29-44. 690 Cannon, P. F., Damm, U., Johnston, P. R., and Weir, B. S. 2012. Colletotrichum – current 691 status and future directions. Stud. Mycol. 73:181-213. 692 Carbone, I., and Kohn, L. M. 1999. A method for designing primer sets for speciation studies 693 in filamentous ascomycetes. Mycologia 91:553-556. 694 Crous, P. W., Groenewald, J. Z., Risede, J. M., and Hywel-Jones, N. L. 2004. Calonectria 695 species and their Cylindrocladium anamorphs: species with sphaeropedunculate vesicles. 696 Stud. Mycol. 50:415-430. 697 Crous, P. W., Verkley, G. J. M., Groenewald, J. Z., and Samson, R. A. 2009. Fungal 698 Biodiversity. CBS-KNAW Fungal Biodiversity Centre Utrecht, Utrecht, The Netherlands. 699 Page 28 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 29 Damm, U., Cannon, P. F., Woudenberg, J. H. C., and Crous, P. W. 2012. The Colletotrichum 700 acutatum species complex. Stud. Mycol. 73:37-113. 701 Dhingra, O. D., and Sinclair, J. B. 1995. Basic Plant Pathology Methods, 2nd Ed. CRC Press, 702 Boca Raton, FL. 703 Förster, H., and Adaskaveg, J. E. 1999. Identification of subpopulations of Colletotrichum 704 acutatum and epidemiology of almond anthracnose in California. Phytopathology 705 89:1056-1065. 706 Freeman, S., Katan, T., and Shabi, E. 1998. Characterization of Colletotrichum species 707 responsible for anthracnose diseases of various fruits. Plant Dis. 82:596-605. 708 Freeman, S., Minz, D., Jurkevitch, E., Maymon, M., and Shabi, E. 2000. Molecular analyses 709 of Colletotrichum species from almond and other fruits. Phytopathology 90:608-614. 710 Glass, N. L., and Donaldson, G. 1995. Development of primer sets designed for use with PCR 711 to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microb. 712 61:1323-1330. 713 Guerber, J. C., Liu, B., Correll, J. C., and Johnston, P. R. 2003. Characterization of diversity 714 in Colletotrichum acutatum sensu lato by sequence analysis of two gene introns, mtDNA 715 and intron RFLPs, and mating compatibility. Mycologia 95:872-895. 716 Kumar, S., Stecher, G., and Tamura, K. 2016. MEGA7: Molecular Evolutionary Genetics 717 Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33:1870-1874. 718 Leslie, J. F., and Summerell, B. A. 2006. The Fusarium Laboratory Manual. Blackwell 719 Publishing Ltd, Oxford, UK. 720 López-Moral, A., Agustí-Brisach, C., Raya, M. C., Lovera, M., Roca, L. F., Luque, F., 721 Arquero, O., and Trapero, A. 2016. La antracnosis del almendro, susceptibilidad varietal 722 en Andalucía. Vida Rural 423:56-62. 723 Page 29 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 30 McKay, S. F., Freeman, S., Minz, D., Maymon, M., Sedgley, M., Collins, G. C. and Scott, E. 724 S. 2009. Morphological, genetic and pathogenic characterization of Colletotrichum 725 acutatum, the cause of anthracnose of almond in Australia. Phytopathology 99:985-995. 726 McKay, S. F., Shtienberg, D., Sedgley, M., and Scott, E. S. 2014. Anthracnose on almond in 727 Australia: disease progress and inoculums sources of Colletotrichum acutatum. Eur. J. 728 Plant Pathol. 139:773-783. 729 Moral, J., Bouhmidi, K., and Trapero, A. 2008. Influence of fruit maturity, cultivar 730 susceptibility, and inoculation method on infection of olive fruit by Colletotrichum 731 acutatum. Plant Dis. 92:1421-1426. 732 Moral, J., Jurado-Bello, J., Sánchez, M. I., Oliveira, R., and Trapero, A. 2012. Effect of 733 temperature, wetness duration, and planting density on olive anthracnose caused by 734 Colletotrichum spp. Phytopathology 102:974-981. 735 Moral, J., Oliveira, O., Tello, A., and Trapero. A. 2007. Caracterización fisiológica y 736 patogénica de aislados de Colletotrichum spp. causantes de la antracnosis del olivo. Bol. 737 San. Veg. Plagas 33:233-248. 738 Moral, J., Oliveira, R., and Trapero, A. 2009. Elucidation of disease cycle of olive 739 anthracnose caused by Colletotrichum acutatum. Phytopathology 99:548-56. 740 Moral, J., Xaviér, C., Roca, L. F., Romero, J., Moreda, W., and Trapero, A. 2014. La 741 Antracnosis del olivo y su efecto en la calidad del aceite. Grasas Aceites 65 (2):e028. Doi: 742 http://dx.doi.org/10.3989/gya.110913. 743 Ollero-Lara, A., López-Moral, A., Lovera, M., Raya, M. C., Roca, L. F., Arquero, O., and 744 Trapero, A. 2016. Las enfermedades del almendro en Andalucía. Fruticultura 49:166-183. 745 Palazón, I. J., and Palazón, C. F. 1979. Estudios sobre Gloeosporium amygdalium Brizi en los 746 almendros españoles. Anuario INIA, Servicio de Protección Vegetal 11:29-43. 747 Page 30 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 31 Peres, N. A., Timmer, L. W., Adaskaveg, J. E., and Correl, J. C. 2005. Lifestyles of 748 Colletotrichum acutatum. Plant Dis. 89:784-796. 749 Ronquist, F., Teslenko, M., Van Der Mark, P., Ayres, D. L., Darling, A., Höhna, S., Larget, 750 B., Liu, L., Suchard, M. A., and Huelsenbeck, J. P. 2012. MrBayes 3.2: Efficient Bayesian 751 phylogenetic inference and model choice across a large model space. Syst. Biol. 61:539-752 542. 753 Simmonds, J. H. 1965. A study of the species of Colletotrichum causing ripe fruit rots in 754 Queensland. Queens. J. Agric. Sci. 22:361-378. 755 Smith, B. J., and Black, L. L. 1990. Morphological, cultural, and pathogenic variation among 756 Colletotrichum species isolated from strawberry. Plant Dis. 74:69-76. 757 Sreenivasaprasad, S., and Talhinhas, P. 2005. Genotypic and phenotypic diversity in 758 Colletotrichum acutatum, a cosmopolitan pathogen causing anthracnose on a wide range 759 of hosts. Mol. Plant Pathol. 6:361-378. 760 Steel, R. G. D., and Torrie, J. H. 1985. Bioestadística, 2nd ed. McGraw-Hill, Bogotá, 761 Colombia. 762 Sutton, B. C. 1980. The Coelomycetes. Fungi imperfecti with pycnidia, acervula and 763 stromata. Commonwealth Mycological Institute, Kew, Surrey, UK. 764 Sutton, B. C. 1992. The genus Glomerella and its anamorph Colletotrichum. Pages 1-27 in: 765 Colletotrichum: Biology, pathology and control. J. A. Bailey and M. J. Jeger, eds. CAB 766 International, Wallingford, UK. 767 Talhinhas, P., Mota-Capitão, C., Martins, S., Ramos, A. P., Neves-Martins, J., Guerra-768 Guimarães, L., Várzea, V., Silva, M. C., Sreenivasaprasad, S., and Oliveira, H. 2011. 769 Epidemiology, histopathology and aetiology of olive anthracnose caused by 770 Colletotrichum acutatum and C. gloeosporioides in Portugal. Plant Pathol. 60:483-495. 771 Page 31 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. 32 Teviotdale, B. L., Michailides, T. J., and Pscheidt, J. W. 2002. Compendium of Nut Crop 772 Diseases in Temperate Zones. APS Press, Saint Paul, MN, USA. 773 Viruega, J. R., Roca, L. F., Moral, J., and Trapero, A. 2011. Factors affecting infection and 774 disease development on olive leaves inoculated with Fusicladium oleagineum. Plant Dis. 775 95:1139-1146. 776 White, T. J., Bruns, T., Lee, S., and Taylor, J. 1990. Amplification and direct sequencing of 777 fungi ribosomal RNA genes for phylogenetics. Pages 315-322 in: PCR Protocols. A Guide 778 to Methods and Applications. M. A. Innis, D. H. Gelfand, J. J. Sninsky and T. J. White, 779 eds. Elsevier Academic Press, San Diego, CA. 780 Page 32 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. Table 1. Isolates of Colletotrichum spp. used in this study. Isolatew Fungal species Host Subpopulation (colony type) Affected tissue Originz (location/province/Orchard) Col-506x,y Colletotrichum nymphaeae Olea europaea Light gray Fruit Hornachuelos/Córdoba Col-508x,y Colletotrichum godetiae Olea europaea Dark gray Fruit Hornachuelos/Córdoba Col-536x,y Colletotrichum sp. Prunus dulcis Pink-orange Fruit Lebrija/Sevilla/Orchard 1 Col-537x Colletotrichum sp. Prunus dulcis Pink-orange Fruit Lebrija/Sevilla/Orchard 2 Col-538 x Colletotrichum sp. Prunus dulcis Pink-orange Fruit Lebrija/Sevilla/Orchard 3 Col-522x,y Colletotrichum sp. Prunus dulcis Gray Fruit Lebrija/Sevilla/Orchard 1 Col-524 Colletotrichum sp. Prunus dulcis Gray Fruit Lebrija/Sevilla/Orchard 2 Col-525 Colletotrichum sp. Prunus dulcis Gray Fruit Lebrija/Sevilla/Orchard 3 Col-540 Colletotrichum sp. Prunus dulcis Gray Fruit Gibraleón/Huelva Col-542 Colletotrichum sp. Prunus dulcis Gray Fruit Villamanrique/Sevilla Col-544 Colletotrichum sp. Prunus dulcis Gray Fruit Villamanrique/Sevilla Col-548 x Colletotrichum sp. Prunus dulcis Gray Fruit Maribáñez/Sevilla Col-555 x Colletotrichum sp. Prunus dulcis Gray Fruit Gibraleón/Huelva Col-613 Colletotrichum sp. Prunus dulcis Gray Fruit Santa Cruz/Córdoba wAll isolates were used for molecular characterization. xColletotrichum spp. isolates used for pathogenicity tests to almond. yColletotrichum spp. isolates selected as representative of each host and fungal subpopulation (colony type) used for morphological characterization and for pathogenicity tests to olive and apple fruits. zAll locations belong to the Andalusia region, southern Spain. Number of the orchard is indicated when several orchards were surveyed in the same location. Page 33 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. Table 2. Primers used to amplify the six genomic areas studied by DNA analysis. Primer Primer pairs Genomic sequence (5’ - 3’) Expected PCR product size (bp) Reference ITS ITS4 TCCTCCGCTTATTGATATGC 540 White et al. 1990 ITS5 GGAAGTAAAAGTCGTAACAAGG TUB2 BT2A GGTAACCAAATCGGTGCTGCTTTC 429 Glass and Donaldson 1995 BT2B ACCCTCAGTGTAGTGACCCTTGGC ACT ACT-512F ATGTGCAAGGCCGGTTTCGC 246 Carbone and Kohn 1999 ACT783R TACGAGTCCTTCTGGCCCAT CHS-1 CHS-79F TGGGGCAAGGATGCTTGGAAGAAG 282 Carbone and Kohn 1999 CHS-354R TGGAAGAACCATCTGTGAGAGTTC HIS3 CYLH3F AGGTCCACTGGTGGCAAG 382 Crous et al. 2004 CYLH3R AGCTGGATGTCCTTGGACTG GAPDH GDF1 GCCGTCAACGACCCCTTCATTGA 250 Gueber et al. 2003 GDF1 GGGTGGAGTCGTACTTGAGCATGT Page 34 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. Table 3. Isolates of Colletotrichum spp. used in this study, with collection details and GenBank accessions. Species Isolate y Substrate (Host) GenBank accession no. ITS TUB2 ACT CHS-1 HIS3 GAPDH C. acerbum CBS 128530, ICMP 12921, PRJ 1199.3 z Malus domestica JQ948459 JQ950110 JQ949780 JQ949120 JQ949450 JQ948790 C. acutatum CBS 112996, ATCC 56816, STE-U 5292z Carica papaya JQ005776 JQ005860 JQ005839 JQ005797 JQ005818 JQ948677 CBS 129952, PT227, RB015 Olea europaea JQ948364 JQ950015 JQ949685 JQ949025 JQ949355 JQ948695 CBS 127598, 223/09 Olea europaea JQ948363 JQ950014 JQ949684 JQ949024 JQ949354 JQ948694 Col-536 Prunus dulcis KY171894 KY171902 KY171910 KY171918 KY171926 KY171934 Col-537 Prunus dulcis KY171895 KY171903 KY171911 KY171919 KY171927 KY171935 Col-538 Prunus dulcis KY171896 KY171904 KY171912 KY171920 KY171928 KY171936 C. australe CBS 116478, HKUCC 2616z Trachycarpus fortunei JQ948455 JQ950106 JQ949776 JQ949116 JQ949446 JQ948786 C. brisbanense CBS 292.67, DPI 11711 z Capsicum annuum JQ948291 JQ949942 JQ949612 JQ948952 JQ949282 JQ948621 C. chrysanthemi IMI 364540, CPC 18930 Chrysanthemun coronarium JQ948273 JQ949924 JQ949594 JQ948934 JQ949264 JQ948603 C. cosmi CBS 853.73, PD 73/856 z Cosmos sp. JQ948274 JQ949925 JQ949595 JQ948935 JQ949265 JQ948604 C. costaricense CBS 330.75 z Coffea arabica JQ948180 JQ949831 JQ949501 JQ949120 JQ949450 JQ948790 C. cuscutae IMI 304802, CPC 18873 z Cuscuta sp. JQ948195 JQ949846 JQ949516 JQ949025 JQ949355 JQ948695 Page 35 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. Species Isolatey Substrate (Host) GenBank accession no. ITS TUB2 ACT CHS-1 HIS3 GAPDH C. fioriniae IMI 345583, CPC 18889 Fragaria × ananassa JQ948333 JQ949984 JQ949654 JQ005797 JQ005818 JQ948677 IMI 345575, CPC 18888 Fragaria × ananassa JQ948332 JQ949983 JQ949653 JQ949116 JQ949446 JQ948786 CBS 125396 GJS 08- 140A Malus domestica JQ948299 JQ949950 JQ949620 JQ948952 JQ949282 JQ948621 CBS 129946, PT170, RB021 Olea europaea JQ948342 JQ949993 JQ949663 JQ949024 JQ949354 JQ948694 CBS 293.67, DPI 13120 Persea americana JQ948310 JQ949961 JQ949631 JQ948934 JQ949264 JQ948603 CBS 127537, STE-U 5289 Vaccinium sp. JQ948318 JQ949969 JQ949639 JQ948935 JQ949265 JQ948604 C. godetiae CBS 133.44 z Clarkia hybrida JQ948402 JQ950053 JQ949723 JQ949063 JQ949393 JQ948733 CBS 130251, OL 10, IMI 398854 Olea europea JQ948413 JQ950064 JQ949734 JQ949074 JQ949404 JQ948744 CBS 193.32 Olea europea JQ948415 JQ950066 JQ949736 JQ949076 JQ949406 JQ948746 CBS 130252, IMI 398855, OL 20 Olea europaea JQ948414 JQ950065 JQ949735 JQ949075 JQ949405 JQ948745 Col-508 Olea europaea KY171892 KY171900 KY171908 KY171916 KY171924 KY171932 CBS 126527, PD 93/1748 Prunus avium JQ948408 JQ950059 JQ949729 JQ949069 JQ949399 JQ948739 Page 36 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. Species Isolatey Substrate (Host) GenBank accession no. ITS TUB2 ACT CHS-1 HIS3 GAPDH CBS 126522, PD 88/472, BBA 70345 Prunus cerasus JQ948411 JQ950062 JQ949732 JQ949072 JQ949402 JQ948742 CBS 129934, ALMIKS-7Q Prunus dulcis JQ948431 JQ950082 JQ949752 JQ949072 JQ949422 JQ948762 Col-522 Prunus dulcis KY171893 KY171901 KY171909 KY171917 KY171925 KY171933 Col-524 Prunus dulcis KY644521 KY644527 KY644533 KY644539 KY644545 KY644551 Col-525 Prunus dulcis KY644522 KY644528 KY644534 KY644540 KY644546 KY644552 Col-540 Prunus dulcis KY644523 KY644529 KY644535 KY644541 KY644547 KY644553 Col-542 Prunus dulcis KY644524 KY644530 KY644536 KY644542 KY644548 KY644554 Col-544 Prunus dulcis KY644525 KY644531 KY644537 KY644543 KY644549 KY644555 Col-548 Prunus dulcis KY171897 KY171905 KY171913 KY171921 KY171929 KY171937 Col-555 Prunus dulcis KY171898 KY171906 KY171914 KY171922 KY171930 KY171938 Page 37 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. Species Isolate y Substrate (Host) GenBank accession no. ITS TUB2 ACT CHS-1 HIS3 GAPDH Col-613 Prunus dulcis KY644526 KY644532 KY644538 KY644544 KY644550 KY644556 IMI 376331, CPC 18933 Prunus sp. JQ948409 JQ950060 JQ949730 JQ949070 JQ949400 JQ948740 C. guajavae IMI 350839, CPC 18893 z Psidium guajava JQ948270 JQ949921 JQ949591 JQ948931 JQ949261 JQ948600 C. indonesiense CBS 127551, CPC 14986 z Eucalyptus sp. JQ948288 JQ949939 JQ949609 JQ948949 JQ949279 JQ948618 C. johnstonii CBS 128532, ICMP 12926, PRJ 1139.3 z Solanum lycopersicum JQ948444 JQ950095 JQ949435 JQ949105 JQ949105 JQ948775 C. kinghornii CBS 198.35 z Phormium sp. JQ948454 JQ950105 JQ949775 JQ949115 JQ949445 JQ948785 C. laticiphilum CBS 112989, IMI 383015, STE-U 5303 z Hevea basiliensis JQ948289 JQ949940 JQ949610 JQ948950 JQ949280 JQ948619 C. limetticola CBS 114.14 z Citrus aurantifolia JQ948193 JQ949844 JQ949514 JQ948854 JQ949184 JQ948523 C. lupini CBS 109225, BBA 70884 z Lupinus albus JQ948155 JQ949806 JQ949476 JQ948816 JQ949146 JQ948485 C. melonis CBS 159.84 z Cucumis melo JQ948194 JQ949845 JQ949515 JQ948855 JQ949185 JQ948524 C. nymphaeae CBS 515.78 z Nymphaea alba JQ948197 JQ949848 JQ949518 JQ948858 JQ949188 JQ948527 CBS 231.49 Olea europaea JQ948202 JQ949853 JQ949523 JQ948863 JQ949193 JQ948532 CBS 129945, PT135, RB012 Olea europaea JQ948201 JQ949852 JQ949522 JQ948862 JQ949192 JQ948531 Col-506 Olea europaea KY171891 KY171899 KY171907 KY171915 KY171923 KY171931 Page 38 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. Species Isolate y Substrate (Host) GenBank accession no. ITS TUB2 ACT CHS-1 HIS3 GAPDH C. orchidophilum CBS 119291, MEP 1545 Cycnoches aureum JQ948154 JQ949805 JQ949475 JQ948815 JQ949145 JQ948484 CBS 632.80z Dendrobium sp. JQ948151 JQ949802 JQ949472 JQ948812 JQ949142 JQ948481 C. paxtonii IMI 165753, CPC 18868 z Musa sp. JQ948285 JQ949936 JQ949606 JQ948946 JQ949276 JQ948615 C. phormii CBS 118194, AR 3546 z Phormium sp. JQ948446 JQ950097 JQ949767 JQ949107 JQ949437 JQ948777 C. pyricola CBS 128531, ICMP 12924, PRJ 977.1z Pyrus communis JQ948445 JQ950096 JQ949766 JQ949106 JQ949436 JQ948776 C. rhombiforme CBS 129953, PT250, RB011 z Olea europaea JQ948457 JQ950108 JQ949778 JQ949115 JQ949448 JQ948788 C. salicis CBS 607.94z Salix sp. JQ948460 JQ950111 JQ949781 JQ949121 JQ949451 JQ948791 C. scovillei CBS 126529, PD 94/921-3, BBA 70349 z Capsicum sp. JQ978267 JQ949918 JQ949588 JQ948928 JQ948928 JQ948597 C. simmondsii CBS 122122, BRIP 28519 z Carica papaya JQ948276 JQ949927 JQ949597 JQ948937 JQ949267 JQ948606 C. sloanei IMI 364297, CPC 18929 z Theobroma cacao JQ948287 JQ949938 JQ949608 JQ948948 JQ949278 JQ948617 C. tamarilloi CBS 129814, T.A.6 z Solanum betaceum JQ948184 JQ949835 JQ949505 JQ948845 JQ949175 JQ948514 C. walleri CBS 125472, BMT(HL)19 z Coffea sp. JQ948275 JQ949926 JQ949596 JQ948936 JQ949266 JQ948605 y ATCC: American Type Culture Collection, Virginia, U.S.A.; CBS: Culture collection of the Centraalbureau voor Schimmelcultures, Fungal Biodiversity Centre, Utrecht, The Netherlands; IMI: Culture collection of CABI Europe UK Centre, Egham, UK; BRIP: Plant Pathology Herbarium, Department of Employment, Economic, Development and Innovation, Queensland, Australia; ICMP: International Collection of Microorganisms from Plants, Auckland, New Zealand; STE-U: Culture collection of the Department of Plant Pathology, University of Stellenbosch, South Africa; HKUCC: The University of Hong Kong Culture Collection, Hong Kong, China; PD: Plantenziektenkundige Dienst Wageningen, Nederland; STE-U: Culture collection of the Department of Plant Pathology, University of Stellenbosch, South Africa. *ex-holotype or ex-epitype cultures. Page 39 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. z Sequences from GenBank used in the phylogenetic analysis indicated in bold type (Damm et al. 2012). Page 40 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. Page 41 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. Table 4. Conidial measures v (length, width, and volume) of the representative Colletotrichum spp. isolates grown on PDA or on inoculated almond fruit. Medium Isolate Length (µm) Width (µm) Volume (µm) PDA w Col-508 14.4 ± 1.25 a y 3.8 ± 0.41 a 165.7 ± 39.51 a Col-522 12.8 ± 1.29 b 3.7 ± 0.33 a 140.4 ± 29.66 b Col-506 12.1 ± 1.44 c 3.4 ± 0.62 b 114.0 ± 44.47 c Col-536 10.4 ± 1.19 d 3.2 ± 0.62 b 87.2 ± 35.04 d Average 12.4 ± 1.93 A z 3.5 ± 0.57 A 126.8 ± 47.55 A Almond fruit x Col-508 13.2 ± 1.20 a 3.5 ± 0.51 a 128.6 ± 35.37 a Col-522 11.3 ± 1.11 b 3.5 ± 0.53 a 109.6 ± 32.12 b Col-506 11.6 ± 1.34 b 3.3 ± 0.60 a 103.1 ± 37.83 b Col-536 10.8 ± 1.18 c 3.4 ± 0.58 a 99.4 ± 34.57 b Average 11.7 ± 1.50 B 3.4 ± 0.56 B 110.2 ± 36.67 B vEach measure represents the average of 100 conidia ± standard error. wConidia were obtained from colonies grown on PDA at 23±2°C with a 12-h photoperiod of fluorescent light (350 µmol m-2 s-1) for 7 days. xConidia were obtained from colonies developed on inoculated almond fruits incubated in humid chamber at 23±2°C with a 12-h photoperiod for 14 days. yMeans in a column followed by the same lower-case letter do not differ significantly according to Dunn’s test at P = 0.05. zCapital letters indicate the different homogeneous groups for the mean values of each parameter (length, width and volume) in both tested media (PDA and almond fruit) according to the Dunn’s test at P = 0.05. Page 42 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. Table 5. Effect of temperature on mycelial growth of the representative Colletotrichum spp. isolates from olive (Col-506 and Col-508) and almond (Col-522 and Col-536) grown on PDA at 0, 5, 10, 15, 20, 25, 30 and 35ºC in darkness for 8 days. Isolate Analytis Beta model w Optimum growth Tª (ºC) x Min. Tª Max. Tª MGR (mm day -1 ) y R 2 a b Col-506 0.957 2.10 1.41 23.6 a z 5 36 6.4 b Col-508 0.999 1.98 0.06 23.5 a 5 31 6.5 b Col-522 0.986 2.26 0.76 22.4 b 0 30 4.8 c Col-536 0.960 3.70 2.14 23.7 a 4 35 6.8 a wAnalytis Beta model, where R2= coefficient of determination, and a, b=coefficients of regression. x For each Colletotrichum spp. isolate, temperature average growth rates were adjusted to a regression curve to estimate the optimum growth temperature. yMaximum growth rate. z Means in a column followed by the same letter do not differ significantly according to the Fisher’s protected LSD test at P = 0.05. Page 43 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. Fig. 1. Effect of temperature on mycelial growth rate (mm day -1 ) of the four representative Colletotrichum isolates from olive (Col-506 and Col-508) and almond (Col-522 and Col-536) grown on PDA at 0, 5, 10, 15, 20, 25, 30 and 35ºC in darkness for 8 days. For each Colletotrichum isolate, average growth rates over temperature were adjusted to a non-linear regression curve using the Analytis Beta model. Data points are the means of two independent sets (experiments) of three replicated Petri dishes. Vertical bars are the standard error of the means. Fig. 2. Relative area under the disease progress curve (RAUDPC) on fruits of A, almond of cvs. Guara and Lauranne; B, olive of cv. Arbequina; C, apple of cv. Golden Delicious inoculated with Colletotrichum spp. RAUDPC on almond fruits (A) represents the pooled values for Guara and Lauranne cultivars. Columns are the means of two independent sets (experiments) of three replicated (humid chambers) in each host inoculation, with 15 almonds, 20 olives and 4 apples per humid chamber. Vertical bars are the standard error of the means. Columns with the same letter do not differ significantly according to the Tukey’s HSD test (A) or to the Fisher’s protected LSD test (B and C), both at P = 0.05. Fig. 3. One of three most parsimonious trees (Length= 738 steps, CI= 0.662, RI= 0.935, RC= 0.668, HI= 0.338) obtained from a heuristic search of the combined ITS, TUB2, ACT, CHS-1, HIS3 and GAPDH sequences alignment of the Colletotrichum acutatum species complex. Bootstrap support values above 70% and Bayesian posterior probability values above 0.95 are shown at the nodes. Colletotrichum orchidophilum CBS 632.80 and CBS 119291 were used as outgroup. Colletotricum spp. isolates identified in this study are emphasized in bold and their strain numbers are followed by substrate (host species). Page 44 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. Fig. 4. Life cycle of almond anthracnose caused by Colletotrichum spp. adapted to the environmental conditions in Andalusia region (southern Spain) characterized by a Mediterranean climate with a long dry-hot period during the late spring and summer. Supplemental figures: Supplemental Fig. 1. Symptoms of almond anthracnose caused by Colletotrichum spp. A, depressed, sunken, round, and orange lesions on green almonds; B, branch with mummified fruits and necrotic leaves; C, mummified fruits from infections caused the previous year and remaining in the tree canopy; D, defoliation and dieback of shoots and branches as a consequence of the toxins produced by the pathogen; E, necrotic irregular lesions in the tips and margins of the leaves. Supplemental Fig. 2. Colonies and conidia of the representative Colletotrichum spp. isolates used in this study. Colonies grown on PDA and on inoculated almond fruits at 23±2°C with a 12-h photoperiod for 7 and 14 days, respectively. A and B, Isolate Col- 506 from olive and light gray colony type; C and D, isolate Col-508 from olive and dark gray colony type; E and F, isolate Col-536 from almond and pink-orange colony type; G and H, isolate Col-522 from almond and gray colony type; I and J, mycelial colonies developed on almonds inoculated by a conidial suspension of the isolate Col-536 (pink- orange colony type) and isolate Col-522 (gray colony type), respectively. Scale bars: (B,D,F,H) 10 µm. Page 45 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. G ro w th r a te ( m m d a y -1 ) Temperature (°C) 0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9 0 5 10 15 20 25 30 35 40 Topt = 23.5°C Col-508 0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9 0 5 10 15 20 25 30 35 40 Topt = 23.7°C Col-536 0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9 0 5 10 15 20 25 30 35 40 Topt = 22.4°C Col-522 0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9 0 5 10 15 20 25 30 35 40 Topt = 23.6°C Col-506 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 0 0.1 0.2 0.3 . 0.5 0.6 0.7 0.8 0.9 0 0.1 0.2 0.3 0. 0.5 0.6 0.7 0.8 0.9 0 0.1 0.2 0.3 0. 0.5 0.6 0.7 0.8 0.9 Page 46 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. R A U D P C R A U D P C R A U D P C R A U D P C ( % ) (% ) (% ) (% ) Isolate of Colletotrichum spp. 0 20 40 60 80 100 120 Col-506 Col-508 Col-536 Col-522 a a b c B 0 20 40 60 80 100 120 Col-506 Col-508 Col-536 Col-522 a a b a C 0 20 40 60 80 100 120 C o l5 0 6 C o l5 0 8 C o l5 3 6 C o l5 3 7 C o l5 3 8 C o l5 2 2 C o l5 4 8 C o l5 5 5 A b b b a a a a a Page 47 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. C. limetticola CBS 114 14 C. costaricense CBS 330 75 C. tamarilloi CBS 129814 C. lupini CBS 109225 C. melonis CBS 159 84 C. cuscutae IMI 304802 C. nymphaeae CBS 231 49 C. nymphaeae CBS 129945 Col-506 Olea europaea (light gray colony) C. nymphaeae CBS 515 78 C. simmondsii CBS 122122 C. paxtonii IMI 165753 C. sloanei IMI 364297 C. brisbanense CBS 292 67 C. laticiphilum CBS 112989 C. indonesiense CBS 127551 C. guajavae IMI 350839 C. scovillei CBS 126529 C. chrysanthemi IMI 364540 C. cosmi CBS 853 73 C. walleri CBS 125472 C. fioriniae CBS 129946 C. fioriniae IMI 345575 C. fioriniae IMI 345583 C. fioriniae CBS 293.67 C. fioriniae CBS 125396 C. fioriniae CBS 127537 C. acutatum CBS 129952 C. acutatum CBS 127598 Col-538 Prunus dulcis (pink-orange colony) C. acutatum CBS 112996 Col-536 P. dulcis (pink-orange colony) Col-537 P. dulcis (pink-orange colony) C. godetiae CBS 130251 Col-508 O. europaea (dark gray colony) C. godetiae CBS 193 32 C. godetiae CBS:126522 C. godetiae IMI:376331 C. godetiae CBS:126527 C. godetiae CBS 133 44 C. godetiae CBS 130252 Col-542 P. dulcis (gray colony) Col-555 P. dulcis (gray colony) C. godetiae CBS:129934 Col-525 P. dulcis (gray colony) Col-544 P. dulcis (gray colony) Col-613 Col-522 P. dulcis (gray colony) Col-540 P. dulcis (gray colony) Col-524 P. dulcis (gray colony) Col-548 P. dulcis (gray colony) C. pyricola CBS 128531 C. johnstonii CBS 128532 C. acerbum CBS 128530 C. rhombiforme CBS 129953 C. phormii CBS 118194 C. kinghornii CBS 198 35 C. australe CBS 116478 C. salicis CBS 607 94 C. orchidophilum CBS 119291 C. orchidophilum CBS 632 80 99 1.00 100 99 1.00 99 1.00 99 1.00 91 100 1.00 99 1.00 88 100 1.00 97 0.99 95 1.00 77 1.00 99 1.00 100 1.00 89 99 1.00 99 1.00 99 1.00 86 100 1.00 94 1.00 96 1.00 20 82 98 1.00 99 0.97 100 1.00 95 1.00 0.99 99 1.00 91 1.00 1.00 100 1.00 P. dulcis (gray colony) colony) Clade 1 Clade 2 Clade 3 Clade 4 Clade 5 Page 48 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. A U T U M N -W IN T E R S P R IN G -S U M M E R Developed fruits with symptoms Mummified fruit and dry branch Asymptomatic fruit Infection of flowers, leaves and fruitlet Acervulus Kernel infection Branch with mummified fruits and necrotic leaves Mummified fruit Epiphytic phase Page 49 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. A B C D E Page 50 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r. B A D C F E H G I J Page 51 of 51 Pl an t D is ea se " Fi rs t L oo k" p ap er • h ttp :// dx .d oi .o rg /1 0. 10 94 /P D IS -0 3- 17 -0 31 8- R E • p os te d 07 /2 8/ 20 17 T hi s pa pe r ha s be en p ee r re vi ew ed a nd a cc ep te d fo r pu bl ic at io n bu t h as n ot y et b ee n co py ed ite d or p ro of re ad . T he f in al p ub lis he d ve rs io n m ay d if fe r.
Article Images (0)
×![]()
Bioz is the world’s most comprehensive AI search engine for scientific experimentation. The Bioz search engine offers researchers billions of data-driven product, technique, and protocol recommendations. Bioz taps into the latest advances in Artificial Intelligence (AI) – including Natural Language Processing (NLP), Machine Learning (ML) and Generative AI to mine and structure hundreds of millions of pages of complex and unstructured scientific papers. By harnessing the power of AI, Bioz provides researchers with an unprecedented amount of summarized scientific experimentation knowledge right at their fingertips, ultimately helping to speed up drug discovery and the rate of success in finding cures for diseases. Bioz is used by over 15 Million researchers from over 17,000 different universities and companies in 196 countries.
