Article Images (0)
×![]()
featured_play_listSave article to folder
X
Create new folder
Full Text
PDF
Table of Contents
INTRODUCTION
RESULTS
CRF2R Harbors A Cleavable Signal Peptide
DISCUSSION
MATERIALS AND METHODS
Materials
Transfections And Generation Of Stable Cell Lines
Immunofluorescence, Confocal Microscopy, And Image Analysis
Receptor Co-Immunoprecipitation (Co-IP)
Western Blot Analysis
Mass Spectrometry: Reverse-Phase LC-MS/MS And Data Analysis
Measurement Of Intracellular Calcium [Ca2+]I
UK).
Statistical Analysis
ACKNOWLEDGEMENTS
CONFLICT OF INTEREST
AUTHOR CONTRIBUTION
FOOTNOTES
confirmed the presence of both CRF1R and CRF2R, along with actin in these heteromeric complexes. Inhibition of actin filament polymerization prevented the transport of CRF2R to the cell surface, but had no effect on CRF1R. Transport of CRF1R when co-expressed with CRF2βR became actin-dependent. Simultaneous stimulation of cells co-expressing CRF1R+CRF2R with their respective high-affinity agonists, CRF+urocortin2, resulted in ~2-fold increases in peak Ca2+ responses, whereas stimulation with urocortin1 that binds both receptors with 10-fold higher affinity, did not. The ability of CRFRs to form heteromeric complexes in association with regulatory proteins is one mechanism to achieve diverse and nuanced function.
INTRODUCTION
At any given time, a cell expresses several different G protein-coupled receptors (GPCRs), which enables it to respond to a plethora of extracellular agonists in a spatio-temporal manner. Many GPCRs do not operate in isolation, but may ‘talk’ to other receptors and proteins via physical association for an integrated and balanced response to different stimuli (Vischer et al., 2011). GPCR heteromerization can often modify functional characteristics of the individual monomers, including subcellular localization, agonist binding and downstream signaling (Levoye et al., 2006; Springael et al., 2007; Milligan, 2009; Vischer et al., 2011). Though most GPCR monomers have the capacity to elicit an intracellular signaling response upon agonist binding, many GPCRs exist and function as homomeric or heteromeric assemblies. For example, the umami and sweet taste receptors (TIR) are heterodimeric assemblies of T1R3 in combination with T1R1 or T1R2 respectively (Zhao et al., 2003). Also, constitutive homodimerization of class B secretin receptors was found to facilitate G protein coupling, which is critical for secretin binding (Harikumar et al., 2006; Gao et al., 2009). GPCRs are also known to interact with accessory proteins known as receptor activity-modifying proteins (RAMPs). RAMPs regulate the activities of several GPCRs including the receptors for secretin, calcitonin, glucagon, and vasoactive intestinal peptide (Sexton et al., 2006). Interaction of RAMPs with GPCRs can modulate receptor actions including chaperoning of the receptor to the cell surface, as is the case for the calcitonin receptor-like receptor. RAMP present in a heterodimer may modulate other functions such as receptor internalization and recycling and downstream signaling pathways (Sexton et al., 2006). Stress responses to the same stressor are highly individualized and nuanced. An ancient family of neuropeptide hormones known as the corticotropin-releasing factor (CRF) family that comprises of four known agonists, CRF and urocortins (Ucn1-3) mediates stress responses. The neuropeptide hormone, CRF is primarily responsible for regulating and/or initiating stress responses via activation of the hypothalamic–pituitary–adrenal axis (Muglia et al., 1995), whereas urocortins play a vital role in the recovery response to stress (Neufeld-Cohen et al., 2010). These neuropeptides mediate their effect via two known class B GPCRs, CRF1R and CRF2R. CRF2R has three splice variants in humans: CRF2R, CRF2R and CRF2R. CRF1R and CRF2R have different agonist binding affinities as determined using in vitro binding assays. CRF has a relatively higher affinity for CRF1R compared to CRF2R. Ucn1 has equal affinity for both receptors, but a 10-fold higher binding affinity than that displayed by CRF, and Ucn2 and Ucn3 are selective for CRF2R (Vaughan et al., 1995; Lewis et al., 2001; Reyes et al., 2001a). Stressors activate both CRF1R and CRF2R receptors. CRF1R activation mediates ACTH release, anxiety-like behavior and short-term anorexia, whereas CRF2R activation mediates stress-coping responses including anxiolytic behavior and long-term anorexia (Hotta et al., 1999; Reyes et al., 2001b). Acute stress induces a comprehensive and integrated response to maintain homeostasis and survival of organisms. The absence of proper counter regulation might lead to exaggerated stress responses and detrimental consequences for the organism (Chrousos, 2009). Therefore, the counterbalancing actions of CRF2R might be critical under a stressful condition. Many organs and cell-types co-express both CRF receptors which function ‘hand-in-hand’ for an integrated response to stress and to bring the system back to homeostatic baseline (Bhargava, 2011; Henckens et al., 2016). CRF1R is known to hetero(di)merize with vasopressin receptor V1b to mediate synergistic actions of vasopressin and CRF (Murat et al., 2012). As a heteromeric partner of 5HT2A/CRs, CRF1R responds to serotonin to signal via IP3 (Magalhaes et al., 2010). CRF1R is known to harbor a cleavable signal peptide (Rutz et al., 2006; Schulz et al., 2010) and exists in an equilibrium state of monomer/dimer that is already established in the endoplasmic reticulum (ER) (Teichmann et al., 2014). CRF2R on the other hand harbors a pseudo signal peptide that is thought to prevent receptor oligomerization (Teichmann et al., 2012). Deletion of the signal peptide of CRF2R results in receptors being trapped in the ER (Rutz et al., 2006). It remains to be established whether CRF2R harbors a functional or pseudo signal peptide. Recently, we have shown that a balanced and coordinated expression of CRF receptors is required for actions of Ucn3 at baseline and during inflammation (Mahajan et al., 2014), but it remains to be established whether this effect on physiological function involves physical interaction between CRF receptors and formation of heteromeric complexes. In this study we determine whether CRF receptors form heteromeric complexes and the functional significance of this association.
RESULTS
CRF2R shows both cell surface and intracellular expression The cellular location of a given GPCR determines its function. Using an antibody that recognizes the C-terminus of both CRF1R and CRF2R (anti-CRFR1/2), we have previously shown that CRF1R expressed in HEK293 cells localized mainly to the plasma membrane (Hasdemir et al., 2012). We now examined the localization of CRF2R expressed in HEK293 cells and found this receptor to be present both at the cells surface and intracellular compartments, irrespective of whether the cells were transiently or stably transfected (Figure 1A). To characterize whether CRF2R from the cell surface internalizes with bound agonist, we first used fluorescently-labeled agonists: 5-Carboxyfluorescein-labeled Ucn1 (5-FAM-Ucn1) and Rhodamine red-labeled CRF (Rhod-CRF). HEK293 cells expressing CRF1R were used as positive controls, as Ucn1 is known to bind both CRFRs with equal affinity in in vitro assays (Vaughan et al., 1995). Untransfected HEK293 cells were used as negative controls. 5-FAM- Ucn1 bound strongly to cell surface CRF2R and CRF1R (Figure 1, B and C, top panel) and the agonist-bound receptors internalized to endosomes within 30 min of incubation (Figure 1, B and C, bottom panel). Cell surface CRF2R did not bind appreciably to Rhod-CRF and did not show any appreciable internalization after 30 min of incubation, whereas CRF1R bound to Rhod-CRF showed robust internalization within 30 min of incubation (Figure 1, E and F). Importantly, untransfected HEK293 cells did not bind 5FAM-Ucn1 or Rhod-CRF, nor did they show any discernable expression of CRFRs (Figure 1, D-G). These results further confirm in vitro observations that Ucn1 binds to both CRF1R and CRF2R and takes it a step further to show that ligand-bound receptors are internalized.
CRF2R Harbors a Cleavable Signal Peptide
While the signal peptides (SP) for CRF1R and CRF2R have been studied before (Alken et al., 2005; Rutz et al., 2006; Schulz et al., 2010; Teichmann et al., 2012), it is unknown whether CRF2R harbors a pseudo or cleavable SP. Using the Max-Planck-Institute proteasome cleavage prediction site (http://www.mpiib-berlin.mpg.de/mpiib-cgi/MAPPP/cleavage.pl), we identified putative cleavage domains within the first 33 amino acids (Figure 2A). Based on this plot and the putative cleavage site for CRF2R (Perrin et al., 2003), we constructed a Flagtagged delta()SP version of CRF2R (Flag-CRF2RSP) lacking the N-terminal 26 amino acids, as well as N-terminal HA-and Flag-tagged full-length CRF2R (HA-CRF2R and Flag- CRF2R). Schematic representations of all tagged constructs used in this study are shown in Figure 2B. Construction of HA-tagged CRF1R (HA-CRF1R) was described by us elsewhere (Hasdemir et al., 2012). In HEK293 cells expressing HA-CRF2R or Flag- CRF2R, we were unable to detect the full-length receptor using anti-HA or anti-Flag antibodies, whereas the anti-CRFR1/2 antibody that recognizes the C-terminus of CRFRs, clearly detected both the HA- and Flag- tagged CRF2R both at the cell surface and in intracellular compartments (Figure 2C). Only intracellular staining was detected with the anti-HA antibody (Figure 2C, arrowheads), whereas the Flag-tag was not detected at all, suggesting that the N-terminal tags are cleaved off from the nascent peptide. On the other hand, Flag-CRF2RSP was detected with both anti-Flag and anti-CRFR1/2 antibodies at the cells surface (Figure 2D). HA-tagged CRF1R was used as a positive control and its expression was detected at the cell surface using both anti-HA and anti-CRFR1/2 antibodies (Figure 2E). When primary antibody was omitted, no staining was seen (Figure 2E bottom panel). These data suggested that the N-terminal signal peptide of CRF2R is cleavable. Next, we confirmed that HEK293 cells expressing either HA-CRF2R or Flag-CRF2RSP showed similar subcellular localization of the receptors both under basal unstimulated and agonist-stimulated conditions (Figure 3, A and B). Under unstimulated conditions, both the full length and SP versions of CRF2R showed both cell surface as well as intracellular localization. Stimulation with Ucn1, a high-affinity agonist, or Ucn2, a lower-affinity, but CRF2R-specific agonist resulted in internalization of CRF2Rs (Figure 3, A and B, middle and lower panels). Quantification of the confocal images demonstrates that in unstimulated cells, the cell surface expression of both CRF2R constructs was equivalent (Figure 3C). Western blot analysis further confirmed that both CRF2R constructs were equally expressed (Figure 3D). Next, we ascertained whether deletion of SP of CRF2R alters function. The CRF receptors signal via coupling to several G-proteins to increase intracellular cAMP levels (Reisine et al., 1985; Grammatopoulos, 2012) and/or Ca2+ levels (Hasdemir et al., 2012). We confirmed that the intracellular increase in cAMP and Ca2+ levels mediated by unmodified CRF2R and CRF2RSP were similar, after Ucn1 or Ucn2 stimulation (Figure 3, E and F). This suggests that the cleavage of SP of CRF2R does not affect internalization or downstream signaling ability in the systems examined, and that the signal peptide is cleaved to obtain a functional receptor. Identification of CRF receptor heteromeric complex and CRFR-interacting proteins by mass spectrometry analysis Heteromerization of CRF1R with CRF2R has not been previously demonstrated. CRF1R is shown to exist as a monomer or homo(di)mer (Teichmann et al., 2014), whereas the pseudo SP of CRF2R is thought to prevent oligomerization (Teichmann et al., 2012). To ascertain whether CRF receptors are capable of physically interacting and forming heteromeric complexes, HEK293 cells were transfected with HA-CRF1R or Flag-CRF2RSP alone, or co-transfected with both HA-CRF1R+Flag-CRF2RSP. Western blot analysis using anti-CRFR1/2 antibody that detects both receptors (Chang et al., 2011) revealed presence of CRFR monomers (at ~75 kDa) and CRFR multimeric complex (at ~250kDa) that were not present in untransfected HEK293 cells (Figure 4A). In HEK293 cells co-transfected with both CRFRs, only a ~250 kDa band was detected, which suggested that CRF1R and CRF2RSP resolve on SDS-PAGE as a multimeric protein complex, as has been reported for other GPCRs (Vischer et al., 2015). To ensure that receptor heteromerization was not restricted to transfected HEK cells, but is a phenomenon that occurs in vivo, without co-transfection in tissues known to express both CRF receptors (pancreas) or only CRF2R (colon), we used protein lysates from pancreas and colon tissue to demonstrate presence of a higher molecular band in tissue co-expressing both receptors. We observed presence of a ~250kDa band, along with CRFR monomers and homo- and/or heterodimers in pancreatic tissue lysates from mice, whereas only CRFR monomers and dimers were present in colonic lysates (Figure 4B). To further investigate CRF1R+CRF2R interaction and to identify other interacting partners in the receptor super complex, HEK293 cells co-expressing epitope-tagged CRFRs (HA-CRF1R+Flag-CRF2RSP) were stimulated with CRF and the complex was purified. In the absence of well-characterized antibodies that distinguish between CRF receptors, anti-HA antibodies were used to pull down complexes (Figure 4C) and identify interacting partners using mass spectrometry, an approached used previously by others and by us (Bockaert et al., 2004; Gingras et al., 2005; Trester-Zedlitz et al., 2005). Immunoprecipitated complexes were separated by SDS-PAGE (Figure 4C), excised and digested with trypsin and subjected to analysis by reversed-phase liquid chromatography-electrospray tandem mass spectrometry (LC-MS/MS). Mass spectrometric analysis of the proteins that co-precipitated with HA-tagged HA-CRF1R in cells co-expressing Flag-CRF2RSP revealed hundreds of proteins (Supplemental Table 1). Several of the proteins that interacted with CRFR complex were specifically enriched compared with pulldowns of untransfected (mock) cells (Figure 4D). As expected, MS analysis detected CRF1R receptor in the multimeric receptor-protein complex and confirmed the presence of CRF2R in HEK293 cells co-expressing both CRFRs and stimulated with CRF (Figure 4D and Supplemental Table 1). A number of cytoskeleton-associated proteins including F-actin and filament A interact with the i3 loop of GPCRs (Binda et al., 2002; CorneaHebert et al., 2002; Kim et al., 2002). GPCRs undergoing endocytosis require cytoskeleton support to mediate trafficking. Several proteins critical for trafficking of receptors and maintaining cell structure and integrity were co-immunoprecipitated with CRFRs and were specifically enriched in receptor complexes according to the abundances in immunoprecipitated complex estimated by spectral counting. These proteins included tubulin α/β-chain, actin, and heat shock protein 70 (Hsp70) proteins (Figure 4D and Supplemental Table 1). To confirm these mass spectrometry findings and to explore agonist-specific interactions of CRF1R with CRF2R and possibility of simultaneous receptor activation in presence of multiple agonists, HEK293 cells co-expressing both receptors were stimulated with CRF, Ucn2, or Ucn1 alone, or a cocktail of CRF+Ucn2. Immunoprecipitation of HA-CRF1R was performed using anti-HA antibodies, and separated by SDS-PAGE. As expected, agonist treatment did not affect presence of HA-CRF1R in HEK293 cells co-expressing both CRF receptors (Figure 4E). Western blot analysis with anti-Flag antibody confirmed that Flag-CRF2RSP was coimmunoprecipitated with HA-CRF1R (Figure 4F). Additionally, actin was found to interact with the CRF receptor complex (Figure 4F, blots 1 and 2 and Supplemental Figure S1A) and was not present in co-IP complex from HEK cells alone, although actin was present in inputs from all conditions. We used protease-activated receptor 2 (PAR2), another GPCR (Hasdemir et al., 2007) that is unrelated to the CRF family in its function to validate that actin is a specific interacting partner for CRFRs. HEK cells expressing PAR2 with an N-terminal Flag epitope and a C-terminal HA epitope were used. Immunoprecipitation of Flag-PAR2-HA was performed using anti-HA antibodies, and separated by SDS-PAGE. While actin was present in all input lanes (Figure 4G), actin did not co-immuniprecipitate with Flag-PAR2-HA (Figure 4H and Supplemental Figure S1B). Taken together, these data suggest that CRF1R interacts with CRF2R both under unstimulated and various agonist-stimulated conditions and that actin specifically interacts with the CRF receptor complex, further confirming our mass spectrometry findings. CRF1R + CRF2R heteromerization alters agonist-induced internalization of CRF1R We have previously shown that CRF1R traffics and internalizes to early endosomes in response to its cognate agonists CRF and Ucn1 (Hasdemir et al., 2012). We determined whether co-expression of CRF2RSP with CRF1R alters this trafficking behavior. To study trafficking of receptors exclusively from the cell surface, we labeled the cell-surface receptors by incubating the cells with anti-HA antibody (for HA-CRF1R) or anti-Flag antibody (for FlagCRF2RSP). We have previously demonstrated that surface-tagged CRF1R trafficked similarly to untagged receptors (Hasdemir et al., 2012) as has been observed with other GPCRs (Hasdemir et al., 2007). Under unstimulated conditions, CRF2RSP and CRF1R expressed individually were found at the cell surface (Figure 5, A-C, row 1 and Figure 5, D-G). As expected, CRF stimulation showed modest internalization of CRF2RSP (Figure 5A, row 2 and Figure 5D), whereas Ucn2 caused more robust internalization (Fig 5A, row 2 vs. 4 and Figure 5D; p<0.0001 vs. unstim and CRF). As expected, stimulation of cells expressing CRF1R with CRF resulted in robust receptor internalization, whereas Ucn2 did not (Figure 5B, row 2 vs. 4 and Figure 5E; p<0.0001 vs. unstim and Ucn2). Ucn1 that exhibits 10-fold higher binding affinity for CRF2R and CRF1R in vitro than CRF or Ucn2 (Pal et al., 2010), showed less internalization of CRF2RSP than Ucn2 (Figure 5A, row 3 and Figure 5D; p<0.01 Ucn2 vs. Ucn1). Ucn1 stimulation also resulted in internalization of CRF1R to a similar degree as CRF (Figure 5B, row 3 and Figure 5E), suggesting that in vitro binding affinities that take only the ligand-binding domain of the receptor in to account, may not reflect how the receptor may behave when expressed in its native form. In cells co-expressing CRF1R+CRF2RSP, image quantification showed that both CRF receptors were expressed at similar levels at the cell surface (Figure 5F) with little intracellular co-localization (Figure 5G). Both receptors internalized upon CRF stimulation (Figure 5C, panel 3, row 2 and Figure 5F; p<0.0001 vs. unstim) and robust colocalization was evident (Figure 5G). Ucn1 had similar effects and resulted in internalization and co-localization of the two co-expressed receptors in intracellular vesicles (Figure 5C, panel 3, row 3 and Figure 5, F and G; p<0.0001 vs. unstim). Ucn2 stimulation resulted in little co- internalization or intracellular co-localization (Figure 5C, panel 3, row 4 and Figure 5, F and G). Upon Ucn2 stimulation, CRF1R+CRF2RSP remained largely localized to the plasma membrane, and only what appeared to be the CRF1R-dissociated portion of CRF2RSP was found intracellular (Figure 5F), as was evident by little co-localization of intracellular CRF2RSP with CRF1R (Figure 5C, panel 3, row 4 and Figure 5G). Simultaneous stimulation of the receptor with CRF+Ucn2 resulted in robust internalization and co-localization in the cytoplasm of both receptors (Figure 5C, panel 3, row 5 and Figure 5, F and G; p<0.0001 vs. unstim). Importantly, total co-localization coefficient of CRF receptors in unstimulated conditions and upon stimulation with various ligands was similar (Figure 5G). These observations suggest that co-expressed CRF1R and CRF2RSP form heteromeric complexes that affect one another’s trafficking behavior and co-internalize upon specific agonist stimulations. CRF1R+CRF2R heteromerization alters agonist-mediated intracellular calcium [Ca 2+]i and cAMP signaling It is well established that CRF binds both CRF1R and CRF2R, whereas Ucn2 binds exclusively to CRF2R (Pal et al., 2010). We tested the notion that binding affinities might not be directly proportional to receptor function. In HEK293 cells expressing CRF1R alone, stimulation with individual agonists or in combination evoked Ca2+ responses to a similar degree (Figure 6, A and B), whereas Ucn2 stimulation did not result in a measurable cAMP response (Figure 6, C and D). In HEK293 cells expressing CRF2RSP alone, Ucn2 stimulation evoked Ca 2+ responses and induced cAMP levels that were ~2-fold greater than those induced by CRF (Figure 6, A-D). Next, we determined whether CRF receptor heteromerization alters their Ca2+ or cAMP signaling capabilities as opposed to individually expressed CRF1R and CRF2R. Ca 2+ responses of cells co-expressing CRF1R+CRF2RSP challenged by CRF+Ucn2 simultaneously were significantly higher than those induced by CRF, Ucn2, or Ucn1 individually (Figure 6, A and B). When cells co-expressing CRF1R+CRF2RSP were simultaneously stimulated with CRF+Ucn2, the peak Ca2+ signal showed an additive effect compared with individually expressing receptors (Figure 6B). In contrast to Ca2+ levels, cAMP levels were similarly increased after stimulation with individual agonists or simultaneous stimulation with CRF+Ucn2 (Figure 6, C and D). Thus, while CRF1R+CRF2RSP internalize together as heteromers in response to a single agonist, activation and downstream coupling with G proteins of both receptors after stimulation with their cognate agonists may be necessary for functional efficacy. We reasoned that Ucn1 that binds both CRF1R and CRF2R with equal, but 10-fold higher affinities than either CRF or Ucn2 (Pal et al., 2010) would induce synergistic cooperation of CRFR heteromers and on secondary messenger signaling. However, contrary to our prediction, stimulation of cells expressing CRF1R+CRF2RSP with Ucn1 did not result in significantly different Ca2+ responses than those observed in cells expressing individual CRFRs (Figure 6B), whereas cAMP levels in co-expressing cells were in between those expressing CRF1R or CRF2RSP alone (Figure 6D). This suggests that activation of the receptor heteromers by Ucn1 was insufficient to induce synergistic cooperation. Co-expression of CRF2R switches CRF1R trafficking and signaling from an actin-independent to an actin-dependent pathway Receptor mediated endocytosis can occur using the actin cytoskeleton (Lamaze et al., 1997). Mass spectrometry analysis of CRF1R+CRF2R multimeric complex revealed actin as an interacting partner that co-immunoprecipitated with CRF1R (Figure 4, D-F). We investigated whether individually expressed CRF receptors and/or CRF1R+CRF2RSP heteromers require polymerization of actin to translocate from ER/Golgi complex to the cell surface and vice versa. HEK293 cells expressing only CRF1R continued to show cell surface receptor expression even after treatment of cells with cytochalasin D, which inhibits actin polymerization and causes aggregation of actin filaments on endosomes (Figure 7A, phalloidin-red stains F-actin). Cytochalasin D treatment led to significant accumulation of CRF2RSP in intracellular vesicles that showed strong co-localization with phalloidin (Figure 7A, lower panel), indicating that trafficking and subcellular localization of CRF2βRΔSP was disrupted by inhibiting actin polymerization. Importantly, when CRF1R+CRF2RSP were co-expressed, treatment with cytochalasin D resulted in both CRF receptors being trapped in F-actin aggregates (Figure 7B), indicating that the fate of CRF1R depends on formation of heteromeric complexes with CRF2βRΔSP that alter trafficking of CRF1R from an actin-independent to an actin-dependent pathway. Destabilization of actin cytoskeleton in polarized Caco2 cells inhibits receptor-mediated endocytosis at the apical, but not basolateral surface (Gottlieb et al., 1993). Polymerization of actin filaments controls formation of clathrin-coated vesicles in a context-dependent manner (Boulant et al., 2011). We investigated the role of the actin cytoskeleton in mediating Ca2+ signaling. We stimulated HEK293 cells expressing individual CRFRs or co-expressing both receptors with CRF+Ucn2 in the presence or absence of cytochalasin D (Figure 7C). Ca2+ responses in cells expressing CRF1R were not affected by cytochalasin D treatment, further confirming our observation that trafficking of CRF1R to the cell surface from intracellular locale does not require presence of intact actin filaments. However, Ca2+ responses in cells expressing CRF2RSP alone or co-expressing both CRF1R+CRF2RSP were significantly affected by cytochalasin D incubation (Figure 7C). Treatment of cells with cytochalasin D increased Ca2+ responses by 40-50%. The additive effect of stimulation with CRF+Ucn2 simultaneously was maintained in the presence of cytochalasin D (Figure 7C). This indicated that disruption of actin polymerization specifically affected Ca2+ signaling mediated by CRF2 when expressed alone and also heteromeric complexes that contain CRF2R. Thus actin-dependence of heteromeric CRFRs signaling possibly requires dual and simultaneous receptor stimulation with specific agonists.
DISCUSSION
CRF1R and CRF2R receptor signaling pathways are being explored as potential drug targets for a plethora of disorders, ranging from anxiety and depression to obesity (Doyon et al., 2004; Henckens et al., 2016). In this study, we made several novel observations. First, we show that CRF2R harbors a cleavable signal peptide in its N-terminal. Second, agonist-binding affinities as defined by in vitro assays do not translate to functional potencies. For example, both CRF and Ucn2 are known to have equal binding affinities for CRF2R, but here we show that Ucn2 stimulation results in ~2-fold higher cAMP/Ca2+ signaling than CRF. Third, we show that CRF1R and CRF2R interact with other regulatory proteins to form multimeric complexes. These high mobility complexes were also seen in vivo in pancreatic tissue. Interaction of CRF1R and CRF2R was confirmed by co-immunoprecipitation and mass spectrometry. Fourth, interaction of CRF1R with CRF2R resulted in co-internalization of both receptors after stimulation with CRF, but not Ucn2 and altered downstream intracellular Ca2+ signaling. Finally, we show that trafficking of CRF2R, but not CRF1R is actin-dependent. Co-expression of both CRF1R and CRF2R results in altering trafficking fate of CRF1R from actin-independent to actin-dependent. CRF1R is shown to have a cleavable signal peptide, whereas CRF2R harbors a pseudo signal peptide (Teichmann et al., 2012). Deletion of the putative signal peptide of CRF2R prevents the receptor from exiting the ER (Rutz et al., 2006). Here we show that not only does CRF2R harbor a cleavable signal peptide, but also it is functional without its N-terminal signal peptide. The pseudo signal peptide of CRF2R is thought to prevent oligomerization (Teichmann et al., 2012), in contrast CRF2R without its signal peptide is able to form heteromers with CRF1R or homomers. CRF1R is shown to exist as a monomer or dimer (Teichmann et al., 2014) and our data from pancreas, colon, and transfected HEK293 cells shows that CRF2R can also exist as monomer or dimer. We observed that in vitro binding affinities of agonists Ucn1 and Ucn2 with CRF2R do not necessary translate to trafficking and cAMP and/or Ca2+ signaling properties. Ucn1 is known to exhibit a 10-fold higher binding affinity to both CRF1R and CRF2R than CRF or Ucn2, whereas Ucn2 is known to bind only to CRF2R (Vaughan et al., 1995; Lewis et al., 2001; Reyes et al., 2001a). Here we found that Ucn2 stimulation evoked Ca2+ and cAMP responses that were similar in magnitude to those seen with Ucn1 in cells expressing CRF2R. All three agonists (CRF, Ucn1 and Ucn2) evoked similar Ca2+ responses in cells expressing CRF1R alone, whereas Ucn2 did not increase intracellular cAMP levels in cells expressing CRF1R. CRF, Ucn2, and a combination of both agonists, significantly increased peak Ca2+ responses in cells coexpressing both receptors compared with cells expressing individual CRF receptors. This is in contrast to Ucn1 stimulation where no such differences were seen, despite Ucn1 exhibiting higher affinity for CRF2R. This is in agreement with published data that showed Ucn1 stimulation resulted in CRF1R to traffic through a slower recycling Rab11 pathway (Hasdemir et al., 2012). Ucn2 increased cAMP levels in cells co-expressing both receptors, whereas Ucn1 dampened the effect. Surprisingly, despite Ucn1 exhibiting equal binding affinities for both receptors, levels of cAMP in CRF2R expressing cells were 2-fold higher than CRF1R expressing cells. Interestingly, stimulation of co-expressed CRF receptors with Ucn3, another CRF2R-specific agonist was shown to decrease Ca 2+ responses (Mahajan et al., 2014). Taken together, these data strongly suggest that in vitro binding affinities determined using ligandbinding domains of receptors may not be reflective of in vivo affinities or function. Intracellular cAMP and Ca2+ signaling regulates many downstream cellular functions, including changes in phosphorylation levels of various MAPK, including ERK1/2. Previous co-expression studies of CRF1R and CRF2R in HEK293 cells showed that CRF1R did not alter Ucn2-induced activation of cAMP, p38 or p42/p44 MAPK (Markovic et al., 2008). Furthermore, heteromerization of the two CRF receptors might allow CRF2R-specific agonists such as Ucn2 and Ucn3 to regulate functions that are driven by the CRF1R or allow for nuanced signaling by high-affinity agonists, such as Ucn1. However, the exact nature of this interaction and consequences of preventing CRFR heteromerization require further investigation. Previous studies have suggested CRF receptor cross talk (Mahajan et al., 2014), however, the physical heteromeric interaction of CRF receptors or association with ancillary proteins has not been demonstrated. Drugs that antagonize one specific CRFR may have unintended consequences on CRFR function in cells that co-express both CRFRs. Here we show that CRF1R and CRF2R interact and form heteromers in a multimeric complex with ancillary proteins that include cytoskeletal proteins. Trafficking and signaling of heteromeric CRFRs is distinct from mono- or homomers and so is their dependence of the actin cytoskeleton (model proposed in Figure 8). The concept of GPCR heteromerization was first introduced by Rodbell who showed that GPCRs were not simple monomeric structures, but formed large complexes with G proteins and adenylyl cyclase (Rodbell, 1995). The functional significance of GPCR heteromerizations remains an area not well understood, but is emerging to be of considerable pathophysiological importance. For example, heteromerization of GABAbR1 and GABAbR2 within the ER is necessary for adequate GABAbR1 expression on the cell surface (Margeta-Mitrovic et al., 2000). The serotonin receptor 5-HT2A/CR and vasopressin receptor V1B interact with CRF1R to increase anxiety-like behavior in rats (Magalhaes et al., 2010), or modulate CRF function (Murat et al., 2012), respectively. Several cytoskeleton-associated proteins including F-actin and filamin A interact with the i3 loop of GPCRs (Binda et al., 2002; Cornea-Hebert et al., 2002; Kim et al., 2002), and this study identified actin, F-actin capping protein, and tubulin as protein partners that associate with the CRF1R+CRF2R heteromeric complex. It is possible that the interaction with actin is not “static” but rather an agonist-regulated dynamic process. Based on in vitro individual receptor binding studies, it has been rationalized that Ucn2 and Ucn3 exert their effects via CRF2R alone, whereas CRF and Ucn1 bind and activate both CRF1R and CRF2R (Pal et al., 2010). This might have important therapeutic implications since Ucn2 is implicated in the pathophysiology of congestive heart failure and type 2 diabetes (Lai et al., 2015). Studies have shown that CRF1R is the principal receptor involved in stress adaptive responses, whereas CRF2R functions to dampen the activity of CRF1R and ameliorate stress behavior (Hotta et al., 1999; Reyes et al., 2001b). Upon agonist-binding CRF receptors association with ancillary proteins, such as - arrestins, clathrins, dynamins, and cytoskeleton proteins are essential for proper trafficking and localization of these receptors in specific microdomains. Destabilization of actin cytoskeleton in polarized Caco2 cells inhibits receptor-mediated endocytosis at the apical, but not basolateral surface (Gottlieb et al., 1993). Polymerization of actin filaments controls formation of clathrincoated vesicles in a context-dependent manner (Boulant et al., 2011). Thus, our finding that CRFR heteromers associate with actin cytoskeleton to mediate trafficking in a agonistdependent manner is of interest since stress conditions and drugs that compromise polarization of cytoskeleton proteins may also indirectly affect agonist-receptor signaling at the membrane. Our findings of CRF receptors heteromerization and formation of a multimeric complex that signals in an agonist-dependent manner identify a novel regulatory mechanism of potential relevance for compound pharmacology as antagonist and drugs that target one CRF receptor only, can alter function and signaling of interacting CRF receptors resulting in off-target side effects. Migrating and invading carcinoma cells use F-actin-based protrusions to promote trafficking of integrin / heteromeric receptors (Paul et al., 2015). F-actin remodeling in pancreatic islet cells is induced by glucose, similar to that seen with cytochalasin D (Kalwat and Thurmond, 2013) and Ucn2 acting via CRF receptors regulates glucose levels in pancreas (Gao et al., 2016). Thus, trafficking of CRF receptors, specifically that of CRF2R may be of significance in pathophysiological conditions such as diabetes and metabolic diseases. Physiological relevance of our observations is further validated by other studies that showed colocalization between the endogenous CRFRs and actin stress fibers in native uterine smooth muscle cells (Markovic et al., 2007). The sub-apical actin cytoskeleton is pivotal in regulating fusion and/or fission of zymogen granule membranes with the luminal plasma lemma in the acinar cells and its redistribution is a crucial event responsible for inhibition of Ca2+-mediated secretion (Singh et al., 2001). Inhibition of actin filament polymerization resulted in CRF2R being trapped in F-actin aggregates, whereas CRF1R continued to traffic to the cell surface, suggesting that individually expressed CRF1R traffic to and from the ER/Golgi to the cell surface in an actin independent manner (Figure 8). When CRF1R+CRF2R were co-expressed, inhibition of actin polymerization prevented normal trafficking of CRF1R; both receptors colocalized with actin aggregates (Figure 8). Our findings suggest that CRF2R traffics via an actin-dependent path and alters the fate of CRF1R trafficking, which may help mediate Ca 2+ signaling in discrete intracellular regions; however, the precise mechanism remains to be elucidated.
MATERIALS AND METHODS
Materials
pcDNA-FRT-5.0 plasmid and Fura-2AM (ThermoFisher Scientific); Lipo-fectamine™ 2000 (Invitrogen); CRF and urocortins (American Peptide); Trypsin (Gold, Mass Spectrometry Grade, Promega); Solvents for in-gel digestion, UPLC, water, acetonitrile, and formic acid (HPLC grade, Fisher Scientific); Ionomycin (Life technologies); Cytochalasin D (Enzo Life Sciences); Alexa Fluor ® 555 Phalloidin red (Cell Signaling). Antibodies were from the following sources (primary): rabbit anti-HA11, rabbit anti-Flag, mouse anti-Flag, mouse anti-β-actin and rabbit anti-actin (Sigma); rat anti-HA11 (Roche); goat anti-CRFR1/2 (Santa Cruz Biotechnology); (secondary): anti-goat, anti-rabbit, anti-rat IgG coupled to fluorescein isothiocyanate or rhodamine red-X (Jackson ImmunoResearch Laboratories); anti-mouse or -rat or -rabbit IgG coupled to Alexa Fluor 680 (Invitrogen), and coupled to IRDye 800 (Rockland Immunochemicals, Inc.). cDNA Constructs HA-CRF1R cDNA plasmid was previously cloned and described by us (Hasdemir et al., 2012). A full-length CRF2R cDNA plasmid previously cloned and described by us (Grammatopoulos et al., 2000; Hasdemir et al., 2012) was used as a template to make CRF2R constructs: HACRF2R and Flag-CRF2RSP in pcDNA-FRT-5.0 vector. Forward primer for HA-CRF2R: 5’GCAGTCTAAGCTTGCCACCATGTACCCATACGATGTTCCAGATTACGCTATGAGGGGTCC CTCAGG3’ [HindIII site: AAGCTT, Kozak sequence: GCCACC, start site: ATG, HA-Tag: TACCCATACGATGTTCCAGATTACGCT, hCRF2R sequence: ATGAGGGGTCCCTCAGG]. Reverse primer: 5’CGCAGATCTCGAGTCACACAGCGGCCGTCTGCTTGATGCTG3’ [Xho I site: CTCGAG, stop codon: TGA, hCRFR2 sequence: CAAGCAGACGGCCGCTGTG]. FlagCRF2R: Flag-tagged full length CRF2R was cloned in pCMV-Tag 1 vector (Agilent Technologies) in BglII and XhoI restriction sites in the multiple cloning sequence: Forward primer: 5’CAAGATCTTAATGAGGGGTCCCTCAGGGCC3’; reverse primer: 5’TGCTCGAGCACAGCGGCCGTCTGCTTG3’ (Figure 2B) However, while the receptor expression was robust from both the HA- and Flag-tagged constructs as determined using the C-terminal antibody, the Flag-tag was not detected, whereas the HA-tag was seen in intracellular vesicles (Figure 2C). Thus, it was concluded that the N-terminal sequence of the receptor is cleaved, irrespective of the tag. We next made a Flag-tagged construct that lacked the putative signal peptide sequence (first 26 amino acids) referred to as delta signal peptide (SP) CRF2R. Flag-tagged 27-461- CRF2R (Flag-CRF2RSP) was amplified using Forward primer for Flag-CRF2RSP: 5’AAGCTTGCCACCATGGACTACAAGGACGACGACGACAAGCCGCTCCAATACGCAGCCG3’ [HindIII site: AAGCTT, Kozak sequence: GCCACC, start site: ATG, Flag-Tag: GACTACAAGGACGACGACGACAAG, hCRF2R sequence: CCGCTCCAATACGCAGCCG]. Reverse primer: 5’CTCGAGTCACACAGCGGCCGTCTGCTTG3’ [Xho I restriction site: CTCGAG, stop codon: TGA, hCRFR2 sequence: CAAGCAGACGGCCGCTGTG]. High-fidelity Taq polymerase was used for PCR amplification. Amplified cDNAs were cloned into the HindIII and XhoI within the multiple cloning site of pcDNA-FRT-5.0 vector and sequenced to confirm no additional mutations or mismatches were present before use in transfection and expression studies.
Transfections and Generation of Stable Cell Lines
Human embryonic kidney 293 (HEK) were grown in Dulbecco's modified Eagle's medium containing 10% heat-inactivated fetal bovine serum in 95% air, 5% CO2 at 37°C and used up to passage 6. HEK-FLP cells stably expressing HA-CRF2R or Flag-CRF2RSP were generated as described previously for HA-CRF1R (Hasdemir et al., 2012). In specified experiments, HEK cells were transiently transfected using Lipo-fectamine™ 2000 according to the manufacturer's guidelines. Cells were plated 48 h prior to experiments and incubated in Dulbecco's modified Eagle's medium, 0.1% bovine serum albumin for treatments. HEK-FLP cells stably expressing PAR2 with an N-terminal Flag epitope and a C-terminal HA epitope described previously (Hasdemir et al., 2007) were used as controls for the co-IP experiments.
Immunofluorescence, Confocal Microscopy, and Image Analysis
HEK293 cells were seeded on poly-D lysine (100 μg/ml) coated coverslips in 6 well plates at ∼3×105 per well. 48 hrs post-transfection, cells were processed for immunofluorescence staining either by conventional immunofluorescence method or antibody-tagged receptor method to examine trafficking of receptors exclusively from the plasma membrane. For conventional immunofluorescence staining, cells were incubated with agonists (or not) as indicated. All agonists were applied at 100nM and included CRF, Ucn1, Ucn2 or fluorescentlylabeled agonists: 5-Carboxyfluorescein-labeled Ucn1 (5-FAM-Ucn1) and Rhodamine redlabeled CRF (Rhod-CRF). Cells were washed with PBS, fixed with 4% paraformaldehyde (20 min, 4°C), washed and incubated with blocking buffer containing 0.1% saponin and 1% heatinactivated normal goat or horse serum for 60 min. Receptors were localized using the primary antibodies (anti-HA, anti-Flag, or anti-CRFR1/2, 1:500, 2 h room temperature), washed and incubated with secondary antibodies conjugated to fluorescein isothiocyanate (FITC) or rhodamine red-X (RRX) (1:200, 1 h room temperature) as previously described by us (Hasdemir et al., 2012). To stain actin filaments, cells were incubated with Alexa Fluor ® 555 Phalloidind red (1:20, 30 min room temperature) after the secondary antibody incubation and then washed before mounting. To study trafficking of receptors expressed on the cell surface, antibodytagged receptor staining protocol was used. Briefly, cells expressing either HA-CRF1R or FlagCRF2RSP, or co-expressing both receptors were incubated with rat anti-HA and/or rabbit antiFlag (1:100, 45 min at 37 °C). Cell were washed and stimulated with 100nM of CRF, Ucn2, Ucn1, or CRF+Ucn2 for 2 and 30 minutes or with buffer (unstimulated controls). Cells were fixed, washed, incubated in blocking buffer for 1 h, followed by incubation with secondary antibodies conjugated to FITC or RRX (1:200, 1 h room temperature). Cells were imaged with a Zeiss confocal microscope (LSM Meta 510; Carl Zeiss, Thornwood, NY) using a Fluar Plan Apochromat ×63 oil immersion objective (NA 1.4). Images were collected and simultaneously processed (colored and merged) using the Zeiss (LSM 510) software. Image Analysis – Confocal images were analyzed using Zeiss LSM 510 software. Cell surface expression was quantified by drawing regions of interest on the outside and the inside of the plasma membrane (as illustrated in Figure 5G), which allowed determination of the percentage of total cellular fluorescence at the plasma membrane, as previously described (O'Callaghan et al., 2003; Hasdemir et al., 2007). Co-localization of RRX-stained HA-CRF1R (red) and FITCstained Flag-CRF2RSP (green) was quantified by measuring the overlap coefficient, with a coefficient of 0 indicating no co-localization and of 1 indicating complete co-localization within the regions of interest as illustrated in Figure 5G.
Receptor Co-immunoprecipitation (Co-IP)
HA-CRF1R and Flag-CRF2RSP were co-transfected in HEK293 cells in 10 cm dishes (at ∼1×106 cells per dish) using lipofectamine2000 (Invitrogen). Untransfected HEK-FLP cells and HEK-FLP cells stably expressing Flag-PAR2-HA were used as additional controls. 48 hrs post transfection cells were either vehicle-treated or stimulated for 30 min with 100nM of CRF, Ucn2, Ucn1, or CRF+Ucn2 together. IP was performed from both formaldehyde cross-linked (XL) cells or non-cross-linked cells with both anti-HA and anti-Flag antibodies. Subsequently, the cells were washed twice with ice cold PBS and lysed in 500 µl RIPA buffer (RIPA buffer: 50 mM Tris/HCl, pH 7.4, 150 mM NaCl, 5 mM MgCl2, 1 mM EGTA, 10 mM NaF, 10 mM Na4P2O7, 0.1 mM Na3VO4, 0.5% Nonidet P-40; supplemented with protease inhibitor cocktail (Roche) and phosphatase inhibitor cocktails). 20 µl per lysate were used as “IP input” and the rest of the lysate was used for IP. Briefly, each lysate was incubated with 2.5 μg rat anti-HA-antibody in 500 µl RIPA buffer on a rotor overnight at 4°C. 30 μl of washed Protein A beads (Santa Cruz) were added and incubated on a rotor for 1-2 h at 4°C. The slurry was centrifuged at 3,000 rpm for 5 min and supernatant was discarded. The beads were washed three times with 1 ml RIPA buffer. 30μl of SDS-sample dye was added, boiled and IPs resolved on a 10% SDS-PAGE followed by Western blotting with anti-HA, anti-Flag, and anti-β-actin or anti-actin antibodies.
Western Blot Analysis
Cells were lysed in RIPA buffer as described above. Lysates (30 µg of protein) or IP samples were boiled with SDS-sample loading buffer, resolved with 10% SDS-PAGE, transferred to polyvinylidene difluoride membranes (PVDF, Immobilon-FL, Millipore, Billerica, MA), blocked for 1h, and incubated with anti-β-actin or anti-actin (1:5000), anti-HA (1:1000), anti-Flag (1:1000), or anti-CRFR1/2 (1:1000) (2 h at room temp). Membranes were incubated with secondary antibodies conjugated to Alexa Fluor 680 or IRDye 800 (1:20,000, 1 h at room temperature), and blots were analyzed with the Odyssey Infrared Imaging System (Li-COR Biosciences, Lincoln, NE).
Mass Spectrometry: Reverse-phase LC-MS/MS and Data Analysis
HA-CRF1R and Flag-CRF2RSP were co-transfected in HEK293 cells and Co-IP was performed as described above. Proteins bound to beads were eluted using 0.2 M glycine pH 2.0 and neutralized with 1M Tris-HCl, pH 8.0, and resolved on a 10% SDS-PAGE. In-gel digestion of proteins with trypsin was performed as described previously (Rosenfeld et al., 1992). Peptides were analyzed in an Orbitrap XL (Thermo), in positive ion mode and in informationdependent acquisition mode to automatically switch between MS and MS/MS acquisition. For each MS spectrum, the 6 most intense multiple charged ions (charge 2 to 5) over a threshold of 1000 counts were selected for generation of CID mass spectra. A dynamic exclusion window was applied which prevented the same m/z from being selected for 1 min after its acquisition. Peak lists were generated using PAVA software (Guan et al., 2011). The peak lists were searched against the human subset of the SwissProt database as of June 23, 2013, using in- house Protein Prospector version 5.2.2 (a public version is available online). A randomized version of all entries was concatenated to the database to estimate false discovery rates in the searches. Peptide tolerance in searches was 20 ppm for precursor ions, and 0.8 Da for product ions, respectively. Peptides containing two miscleavages were allowed and included. Carbamidomethylation of cysteine was allowed as constant modification; acetylation of the N terminus of the protein, pyroglutamate formation from N terminal glutamine and oxidation of methionine was allowed as variable modifications. The number of modifications was limited to two per peptide. Protein Prospector thresholds used for identification criteria were: minimal protein score of 15, minimal peptide score of 15, maximum expectation value of 0.1 and a minimal discriminant score threshold of 0.0. FDR was limited to 1%. Protein hits were considered significant when two or more peptide sequences matched a protein entry. Further details about identification of fragments and criteria used have been described by us elsewhere (Clauser et al., 1999).
Measurement of intracellular Calcium [Ca2+]i
Transfected HEK293 cells were grown on 96-well plates (25,000 cells were seeded per well; 3-4 wells per condition were used). 48 hrs post-transfection cells were loaded with Fura-2AM and [Ca2+]i was measured as described previously (Hasdemir et al., 2012). Agonist-induced peak Ca2+ responses were normalized to peak ionomycin-induced responses. Cells were stimulated with 1µM ionomycin 90 seconds after agonist (100 nM) stimulation, as indicated in the example Ca2+ traces in Figure 3F. cAMP Measurements Two methods were used for cAMP measurements: The cAMP data shown in Figure 3E was derived as follows: Full-length, untagged CRF2R or FLAG-CRF2RSP constructs were transfected individually in HEK293 cells grown on poly D-lysine coated 6-well plates. Cellular cAMP levels were measured by using Perkin Elmer Lance® TR-FRET based cAMP assay kits and 96 well white optiplates (Perkin Elmer, Cambridge, UK). Briefly, 48 h following transfection, cells were removed with 0.25 % (w/v) trypsin containing 0.53 mM EDTA solution, washed with PBS and re-suspended in assay stimulation buffer (SB, PBS with 0.1% BSA and 0.5mM IBMX). The cells were counted with a hemocytometer and the appropriate cell number pelleted at 500 x g for 4 min, and resuspended in SB with 1/100 AlexaFluor® 647 anti-cAMP antibody at an assay concentration of 2000 cells/10 µl. Cells were loaded onto a 96 well white optiplate and were stimulated in triplicate with 30 and 100nM of Ucn1 or Ucn2. The plate was incubated in the absence of light for 30 min before 20 µl/well of detection mix was added. The plate was incubated in the dark for a further 60 minutes. FRET was recorded by excitation at 320 nm and emission at 665 nm, by an EnVision Xcite multilabel plate reader (Perkin Elmer, Cambridge,
UK).
The cAMP data shown in Figure 6, C and D were derived as follows: Individually transfected (CRF1R or CRF2RSP), and co-transfected (CRF1R+CRF2RSP) HEK293 cells were grown on poly D-lysine coated 12-well plates and challenged with agonist (100nM CRF, Ucn1, Ucn2, or CRF+Ucn2) or vehicle (giving basal levels). Cells were then washed with icecold PBS and solubilized with 0.1 M HCl/0.1% Triton X-100. The lysates were used to measure levels of cAMP with a competitive immunoassay kit (Direct cAMP ELISA Kit, Enzo lifesciences, Farmingdale, NY) according to the manufacturer's guidelines. All cAMP concentrations were corrected for protein levels (5 µg of protein per well were used in the ELISA assay). Results are expressed as fold increase over basal.
Statistical Analysis
Data are presented as mean ± SEM from n ≥ 3 experiments. Prism (GraphPad Software, San Diego, CA) was used for statistical analysis. When comparing multiple groups, one-way ANOVA followed by posthoc Tukey’s multiple comparisons was used. When two groups were compared, Student's t-test was used. P < 0.05 was considered significant.
ACKNOWLEDGEMENTS
We thank Mai Nguyen for her help in making the HA-tagged CRF2R construct. MW is a Warwick Medical School Doctoral Training Centre in Interdisciplinary Biomedical Research student. This work was supported by NIH grants GM8P41GM103481 to A. Burlingame and DK080787 to A. Bhargava. BH was in part supported by T32 AT003997 from the NIH/NCCIH.
CONFLICT OF INTEREST
The authors have nothing to disclose.
AUTHOR CONTRIBUTION
A Bhargava conceptualized, coordinated the study, analyzed the data, and wrote the paper. BH and SM performed experiments, analyzed the data, and wrote parts of the paper. JO-P and SC performed and analyzed and A Burlingame supervised MS experiments. DKG provided FL- CRF2R, edited the manuscript, and together with MW performed and analyzed cAMP assays.
FOOTNOTES
Abbreviations used: CRF, corticotropin releasing factor; CRF1R, corticotropin releasing factor receptor 1; CRF2R, corticotropin releasing factor receptor 2, CRFR, CRF receptor; GPCR, G protein-coupled receptor; Co-IP; Co-immunoprecipitation; Hsp90, heat shock protein 90; 5HTR, serotonin receptor; IP3, inositoltriphosphate; PAR2, protease-activated receptor 2; PFA, paraformaldehyde; SP, signal peptide; RAMPs, Receptor activity-modifying proteins; Ucn1, urocortin 1, Ucn2, urocortin 2. receptor. (D) In HEK293 cells stably expressing Flag-CRF2RSP, both anti-CRFR1/2 and antiFlag antibodies detected the receptor at the cell surface (arrows). (E) In HEK293 cells stably expressing HA-CRF1R, both anti-CRFR1/2 and anti-HA antibodies detected the receptor at the cell surface (arrows). In the absence of primary antibody (negative control), no staining was visible (bottom panel). Scale bar: 10 μm. Representative images are shown (n=2 coverslips per condition and each experiment was repeated 3 times). HEK293 cells expressing HA-CRF2R or Flag-CRF2RSP showed similar receptor expression levels with both constructs. Untransfected cells were used as negative control. (E) cAMP levels increased significantly from baseline values upon stimulation with either Ucn1 or Ucn2 in a dose-dependent manner (p< 0.05 vs. baseline values with ligand concentrations >1.6nM; twotailed unpaired Student’s t test, mean ± SEM of 3 experiments in triplicate) in both full length and SP versions of CRF2Rs. Importantly, both version of CRF2Rs showed similar increases in cAMP levels at all doses tested (two-tailed unpaired Student's t test: n.s.). (F) Peak [Ca2+]i increased in response to 100nM Ucn1 or Ucn2 stimulations in both full length and SP versions of CRF2Rs to a similar degree (normalized to peak ionomycin responses). Data are mean ± SEM. No significant differences were found between CRF2R and CRF2RSP (two-tailed unpaired Student's t test: n.s.). Representative traces of [Ca2+]i are shown (n=3 wells per condition and repeated 3 times). with both HA-CRF1R+Flag-CRF2RSP, suggesting heteromerization and formation of a super complex. Untransfected cells were used as negative control. (B) Western blot analysis of mouse colon or pancreas whole tissue lysates using anti-CRFR1/2 antibody showed a band at ~60kDa corresponding to the predicted size of CRFR monomers (blue arrow), as well as bands at ~100kDa and ~120kDa, which may represent CRFR dimers (purple arrow). In mouse pancreas an additional strong band at~250kDa (orange arrow) was also detected. (C) Immunoprecipitation (IPs) using anti-HA antibody was performed from co-transfected HA- CRF1R+Flag-CRF2RSP HEK293 cell lysates stimulated with 100nM CRF for 30 min. Coomassie Blue-stained gel of IPs showed a band at ~250kDa in lysates from co-transfected, but not untransfected cells (box). These bands were excised and processed for mass spectrometry. XL=cross-linked; M=marker (n=3-4 for IP and 2-3 for MS). (D) MS analysis of the excised bands revealed that tubulin α/β-chain, actin, and heat shock protein 70 (Hsp70) were proteins that were specifically enriched in CRF1R+CRF2 heteromeric complexes. Scatter plot showing relative enrichment of HA-CRF1R associated proteins in anti-HA vs. mock pulldowns. Intervals of confidence for 95% (blue lines) and 99.7% (red lines) are indicated. Spectral analysis: x- High-energy collision dissociation–tandem mass spectra obtained from precursor ions with mass 707.7146+3 (panel 1) and 626.9720+3 (panel 2) found in tryptic digests of immunoaffinity pulldowns of HA-CRF1R corresponding to peptides spanning residues S58 to R76 of human CRF1R and I93 to R107 of human CRF2R. b- and y- type ion series are labeled in the figure. (E and F) Co-IPs and western blots showing presence of CRFR heteromeric complexes of ~250kDa size. Anti-HA or anti-Flag antibodies were used in western blot analyses of HA-CRF1R+Flag-CRF2RSP co-transfected HEK293 cells to detect presence of individual receptor in this complex. Cells were stimulated with various agonists (100nM) as indicated and IP was performed using anti-HA antibody. Both the cell lysate inputs (E) and IPs (F) show bands at ~250kDa in unstimulated as well as various agonist-stimulated cells. Biological replicates of IPs are shown in Figure 4F blots 1 and 2, and Supplemental Figure S1A. The blots were also probed for -actin confirming that input had similar levels of total protein and showing that - actin is co-immunoprecipitated with the CRF receptor complex. Untransfected cells were used as negative control and no major bands were detected in IP with either anti-HA, anti-Flag, or anti--actin antibodies. (G and H) Co-IPs and western blots showing presence of Flag-PAR2-HA detected by either HA or Flag antibodies in stably expressing HEK293 cells. Both the cell lysate inputs (G) and IPs (H) show PAR2 as a characteristic smear from ~250kDa to ~30kDa due to various post-translational modifications. While actin was unequivocally present in the input; actin did not co-immunoprecipitate with Flag-PAR2-HA or untransfected HEK293 cells that were used as negative control. and immunostained. (A) In cells transfected with Flag-CRF2RSP alone, CRF2RSP translocated from the plasma membrane to intracellular vesicles upon Ucn1, Ucn2 or CRF+Ucn2 stimulations, but not upon CRF stimulation. (B) In cells transfected with HA-CRF1R alone, CRF1R translocated from the plasma membrane to intracellular vesicles upon CRF, Ucn1 or Ucn2 or CRF+Ucn2 stimulations, but not upon Ucn2 stimulation. (C) In cells co-transfected with both HA-CRF1R+Flag-CRF2RSP, Ucn1 resulted in co-internalization of both receptors, as expected. CRF also resulted in co-internalization of both receptors (yellow, merge images), whereas Ucn2 stimulation appeared to inhibit internalization of both CRF receptors. Costimulation with CRF+Ucn2 resulted in internalization of both receptors in cells co-expressing both receptors. Representative images are shown (n=2 coverslips per condition and each experiment repeated 3 times). Scale bar: 10 μm. Quantification of images of cells transfected with (D) Flag-CRF2RSP alone, (E) HA-CRF1R alone, or (F) co-transfected with both HACRF1R+Flag-CRF2RSP. The percentage of total fluorescence at the cell surface (plasma membrane or PM) was determined for each receptor under various stimulations or unstimulated conditions (n=5-23 cells per condition). (G) Quantification of overlap coefficient (co-localization) of HA-CRF1R+Flag-CRF2RSP in co-transfected cells under various stimulations or unstimulated conditions (overlap coefficient: 0, no overlap; 1, complete overlap; n=5-12 cells per condition). Example cell shown illustrates how the regions of interest were drawn for image quantification. Cell surface co-localization values were determined as follows: Total overlap expression coefficient – intracellular overlap expression coefficient. One-way ANOVA followed by posthoc Tukey’s multiple comparisons were performed for graphs (D-G) and p values are shown in the results section. Bar graphs showing peak [Ca2+] signals or increase in cAMP levels in HEK293 cells expressing CRF1R, CRF2RSP, and co-expressing CRF1R+CRF2RSP in response to various agonist stimulation (100nM). (A) Stimulation of CRF1R with all agonists resulted in similar peak Ca 2+ responses, whereas Ucn2 stimulation of CRF2RSP expressing cells resulted in ~2 fold-higher peak Ca2+ responses. In CRF1R+CRF2RSP co-expressing cells, CRF+Ucn2 stimulation resulted in ~1.5-fold higher peak Ca2+ signal compared with stimulation with CRF or Ucn1 alone. (B) After stimulation with CRF, cells co-expressing both CRFRs showed ~2-fold higher peak Ca2+ signal compared with cells expressing CRF2RSP alone. Ucn2 stimulation resulted in ~2- fold higher peak Ca2+ signals in cells co-expressing both CRFRs and CRF2RSP alone compared with cells expressing CRF1R alone. Simultaneous stimulation with CRF+Ucn2 increased peak Ca2+ signal by ~2-fold in cells co-expressing both CRFRs compared with cells expressing individual CRFRs, whereas Ucn1, that is known to have equipotent and 10-fold higher binding affinities for both CRFRs, did not significantly alter peak Ca2+ signal when both CRF receptors were co-expressed. (C) Unlike the other agonists, stimulation of CRF1R with Ucn2 did not result in a measurable cAMP response. Ucn2 increased cAMP levels in CRF2RSP expressing cells and the levels were ~2-fold greater than those induced by CRF. (D) In contrast to Ca2+ signals, cAMP responses to CRF+Ucn2 stimulation were not higher in CRF1R+CRF2RSP co-expressing cells compared to cells expressing CRF2RSP alone. Data are mean ± SEM. Significance was calculated by one-way ANOVA Tukey’s multiple comparisons tests. *, P < 0.05; **, P < 0.005; ^, P < 0.0005. N=3 wells per condition and repeated 3 times. CRF1R+Flag-CRF2RSP co-expressing cells cytochalasin D treatment resulted in both receptors being trapped in aggregates, suggesting that trafficking of CRFR heteromers is Factin-dependent. Scale bar: 10 μm. Representative images are shown (n=2 coverslips per condition and each experiment repeated 3 times). (C) Ca2+ signals in response to CRF+Ucn2 stimulation. Bar graphs showing increased peak Ca2+ signals in CRF2RSP and CRF1R+CRF2RSP co-expressing, but not in CRF1R HEK293 cells after pre-treatment with cytochalasin D as compared with buffer treatment. Data are mean ± SEM. Significance was calculated by the two-tailed unpaired Student’s t test. **, P < 0.005. N=3 wells per condition and repeated 3 times.
Article Images (0)
×![]()
Bioz is the world’s most comprehensive AI search engine for scientific experimentation. The Bioz search engine offers researchers billions of data-driven product, technique, and protocol recommendations. Bioz taps into the latest advances in Artificial Intelligence (AI) – including Natural Language Processing (NLP), Machine Learning (ML) and Generative AI to mine and structure hundreds of millions of pages of complex and unstructured scientific papers. By harnessing the power of AI, Bioz provides researchers with an unprecedented amount of summarized scientific experimentation knowledge right at their fingertips, ultimately helping to speed up drug discovery and the rate of success in finding cures for diseases. Bioz is used by over 15 Million researchers from over 17,000 different universities and companies in 196 countries.
