Journal: The Plant Cell

Article Title: A Telomeric Avirulence Gene Determines Efficacy for the Rice Blast Resistance Gene Pi-ta

doi:

Figure Lengend Snippet: A Low-Copy Repeat Sequence Identifies Restriction Fragments Distal to the AVR-Pita Telomere That Are Deleted in Some Spontaneous Mutants. Genomic DNAs were digested with BglII for DNA gel blot analysis. Hybridization with the 10-kb XhoI fragment from cosmid A10H8 identified the 6.5-kb telomeric BglII fragment and an additional 4.0-kb fragment (arrows) that was altered in avr-pita − mutants. All avirulent laboratory strains inherited these two bands from the Chinese field isolate O-137 (lane 23) through the RFLP mapping strain 4224-7-8 (lane 2). The virulent mapping parent 6043 (lane 1) does not have these bands. Not shown are data consistent with this result but obtained by using SalI, EcoRI, and SacI. Except for lane 1, which contains DNA from the virulent parent 6043, each v lane contains DNA from a virulent mutant obtained from the first avirulent strain (A lanes) to its left. Lane 1, 6043 (v); lane 2, 4224-7-8 (A); lane 3, 4360-17-1 (A); lane 4, CP917 (v); lane 5, 4375-R-26 (A); lane 6, CP984 (v); lane 7, 4375-R-39 (A); lane 8, CP918 (v); lane 9, 4375-R-6 (A); lane 10, CP983 (v); lane 11, CP1614 (v); lane 12, CP1615 (v); lane 13, CP1631 (A); lane 14, CP1632 (v); lane 15, CP1634 (A); lane 16, CP1635 (v); lane 17, CP1637 (A); lane 18, CP1638 (v); lane 19, CP1640 (A); lane 20, CP1641 (v); lane 21, CP1643 (A); lane 22, CP1644 (v); and lane 23, O-137 (A). Markers at left identify the positions of λ HindIII DNA length standards, which are as follows (from the top): 23.1, 9.4, 6.6, 4.4, 2.3, 2.0, and 0.56 kb.

Article Snippet: Plasmid pCB783, containing the 791-bp telomeric SacI fragment, was digested first with KpnI and XhoI and then with Exonuclease III (New England Biolabs).

Techniques: Sequencing, Western Blot, Hybridization, Mutagenesis

Journal: Methods in molecular biology (Clifton, N.J.)

Article Title: Engineering and Flow-Cytometric Analysis of Chimeric LAGLIDADG Homing Endonucleases from Homologous I-OnuI-Family Enzymes

doi: 10.1007/978-1-62703-968-0_14

Figure Lengend Snippet: Example of assembly PCR primers and introduction of variation via degenerate codons. Each colored selection represents a single assembly primer; the sum of all primers is designed to produce the entire coding sequence shown. An NdeI restriction site (CATATG) has been added to the N-terminal end of the sequence, and an XhoI restriction site (CTCGAG) has been added to the C-terminal end. The magnified inset towards the C-terminal end of the sequence gives an example of introducing variation using the degenerate codon “RAA.” The “R” base designates the introduction of either a guanine (G) or adenine (A) base at that position, resulting in a translated protein sequence with either glutamic acid (E) or lysine (K)

Article Snippet: 12 The high fidelity (HF) version of the KpnI restriction enzyme is used for its compatibility with NdeI or XhoI enzymes in NEB Buffer #4.

Techniques: Polymerase Cycling Assembly, Selection, Sequencing

Journal: Journal of Biological Engineering

Article Title: AFM Imaging Reveals Multiple Conformational States of ADAMTS13

doi: 10.1186/s13036-018-0102-y

Figure Lengend Snippet: AFM system successfully imaged proteins . ( a ) WT- and GOF-ADAMTS13 plasmids were double digested by restriction enzymes HindIII and XhoI, and verified in agarose gel electrophoresis. ( b ) Purified WT- and GOF-ADAMTS13 were analyzed by SDS-PAGE under reducing conditions on a 7.5% gel and Western blotting with anti-His antibody. ( c ) AFM images of VWF-A1 (30 kDa), BSA (67 kDa), anti-His tag antibody (150 kDa) and commercial ADAMTS13 (190 kDa). The horizontal scale bar is 200 nm. The vertical scale bar indicates the height. ( d ) The plot of volumes of these four proteins versus their molecular weights. The data was well fitted into a straight line. The goodness of fit is indicated by R 2 . According to the linear relationship y = 5.31817*x + 256.175, the volume of purified WT-ADAMTS13 (red square) corresponds to the molecular weight of 213 kDa. Data were presented as mean ± SD.

Article Snippet: Restriction enzymes XhoI and HindIII-HF were purchased from NEB (Ipswich, MA, USA).

Techniques: Agarose Gel Electrophoresis, Purification, SDS Page, Western Blot, Molecular Weight

Journal: Nucleic Acids Research

Article Title: Structure of discontinuities in kinetoplast DNA-associated minicircles during S phase in Crithidia fasciculata

doi: 10.1093/nar/gkm1061

Figure Lengend Snippet: Ligation of discontinuities in kinetoplast-associated minicircles. Purified kDNA from 300 min after release from the hydroxyurea block were either treated with E. coli DNA ligase (+) or not (−) prior to digestion with XhoI and alkaline denaturing gel analysis. The gel was transferred and hybridized as in Figure 3 to identify released H and L single strands. Marker lanes: M1, minicircle single strand linears (ssl) and single strand circles (ssc); M2, denatured covalently closed minicircles (dcc) in addition to minicircle single strand linears (ssl) and single strand circles (ssc); M3, molecular weight markers.

Article Snippet: The remainders of the cell lysates were each ethanol precipitated and resuspended in 200 μl of 0.01 M Tris pH 8, 1 mM EDTA and 22 μl of 10 × NEB 3 buffer followed by digestion for 60 min at 37°C with Mlu I and XhoI restriction enzymes (New England Biolabs) to fragment the DNA.

Techniques: Ligation, Purification, Blocking Assay, Marker, Droplet Countercurrent Chromatography, Molecular Weight

Journal: Nucleic Acids Research

Article Title: Structure of discontinuities in kinetoplast DNA-associated minicircles during S phase in Crithidia fasciculata

doi: 10.1093/nar/gkm1061

Figure Lengend Snippet: Topoisomerase decatenation of XhoI-resistant catenated minicircle molecules. Purified kDNA prepared at 300 min was digested with XhoI and one-half was additionally treated with a type II DNA topoisomerase prior to neutral gel electrophoresis and Southern blotting using a minicircle probe. Catenated minicircles are indicated by a bracket. N/G, nicked or gapped minicircle DNA; L, unit-length linear minicircle DNA; CCC, covalently closed circular minicircle DNA.

Article Snippet: The remainders of the cell lysates were each ethanol precipitated and resuspended in 200 μl of 0.01 M Tris pH 8, 1 mM EDTA and 22 μl of 10 × NEB 3 buffer followed by digestion for 60 min at 37°C with Mlu I and XhoI restriction enzymes (New England Biolabs) to fragment the DNA.

Techniques: Purification, Nucleic Acid Electrophoresis, Southern Blot, Countercurrent Chromatography

Journal: Nucleic Acids Research

Article Title: Structure of discontinuities in kinetoplast DNA-associated minicircles during S phase in Crithidia fasciculata

doi: 10.1093/nar/gkm1061

Figure Lengend Snippet: ( A ) Physical map of C. fasciculata minicircle DNA ( 36 ). The two-replication origins, oriA and oriB, are located 180° apart on the circular DNA. Specific nicks in nicked circular (form II) minicircles identified in free minicircles replicated in an isolated kinetoplast system define the initiation sites of the leading L strand and the initiation sites of the first H-strand Okazaki fragment at each origin ( 23 ). The nucleotide coordinates are indicated for the specific nicks in the H and L strands. The region from 1041 to 1240 nt has been shown to confer a static bend in the DNA ( 42 ) and is referred to as a bent helix. ( B ) Crithidia fasciculata minicircle replication schematic. Thin line, L strand; thick line, H strand; filled arrowheads, specific nicks; double arrowhead, XhoI site.

Article Snippet: The remainders of the cell lysates were each ethanol precipitated and resuspended in 200 μl of 0.01 M Tris pH 8, 1 mM EDTA and 22 μl of 10 × NEB 3 buffer followed by digestion for 60 min at 37°C with Mlu I and XhoI restriction enzymes (New England Biolabs) to fragment the DNA.

Techniques: Isolation

Journal: EBioMedicine

Article Title: A rationally designed nanoparticle for RNA interference therapy in B-lineage lymphoid malignancies

doi: 10.1016/j.ebiom.2014.10.013

Figure Lengend Snippet: Effect of CD22ΔE12 vs. CD22 WT on clonogenicity and self-renewal rate of ALL cells. [A1] Depicted is a representative 1% agarose gel showing the PCR products of FL CD22 and CD22ΔE12–14. [A.2] Subcloning of the CD22 FL or CD22ΔE12–14 genes into the lentiviral pCL6-2AEGwo vector through NheI and XhoI restriction sites was confirmed through restriction enzyme digestion and DNA sequencing. Depicted is a representative 1% agarose gel showing that the generated lentiviral constructs have the correct size FL CD22 (2.5-kb) or CD22ΔE12–14 (2.2-kb) inserts. [B.1] In order to confirm that the lentiviral vectors can be used to achieve expression of FL and truncated CD22 in human cells, 293T cells were transfected with lentiviral constructs for FL CD22, CD22ΔE12–14, as well as pCL6-2AEGwo lentiviral vector without any subcloned CD22. 48 h post transfection cells were examined for FL CD22 and CD22ΔE12–14 mRNA by RT-PCR using the P7, P9, and P10 primer pairs. The P7 primer set was used to amplify a 182-bp region (c.2180–c.2361) of the CD22 cDNA extending from Exon 11 to Exon 13 and spanning the entire Exon 12. The P9 primer set was used amplify a 160-bp region (c.2304–c.2463) of the CD22 cDNA extending from Exon 12 to Exon 14 and spanning the entire Exon 13. The P10 primer set was used to amplify a 213-bp region (c.433–c.645) of Exon 4 of the CD22 cDNA present in both wildtype CD22 and CD22ΔE12–14 mRNA species. As expected all primer sets yielded PCR products in cells transfected with the FL CD22 vector and only the P10 primer set yielded a PCR product in cells transfected with the CD22ΔE12–14 vector. [B.2 and B3] The increased expression levels of the full-length and truncated proteins in transduced 293-T cells (depicted in B.2) and ALL-1 cells (depicted in B.3) were confirmed to be similar by Western blot analysis done at 96 h post-transduction. [C D] ALL cell lines DAUDI (Burkitt's leukemia/B-ALL) (panels C1 C.2) and ALL1 (BCR-ABL + B-precursor ALL) (panel C3) were transduced (trans) with wildtype and mutant human CD22 genes using the pCL6-2AEGwo lentiviral vector and then assayed for colony formation in semi-solid methylcellulose cultures without additional stroma support or cytokines. Colony formation was examined using an inverted Nikon Eclipse TS100 microscope with an Epifluorescence attachment. Images were taken using a Digital Sight DS-2MBW Nikon camera (System magnification: 100× or 200 × as indicated). Green fluorescence of colonies resulting from GFP expression confirms successful transduction of the cell lines. [D] Depicted are bar graphs comparing the mean colony numbers in cultures of untransduced and transduced cells.

Article Snippet: The correct PCR products (FL: 2541-bp and ΔE12–14: 2208-bp) were ligated into the 8497-bp lentiviral vector pCL6-2AEGwo through the NheI and XhoI restriction sites (underlined) using the Quick Ligase kit (New England Biolabs catalog no. M2200L) following the manufacturer's instructions.

Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Subcloning, Plasmid Preparation, DNA Sequencing, Generated, Construct, Expressing, Transfection, Reverse Transcription Polymerase Chain Reaction, Western Blot, Transduction, Mutagenesis, Microscopy, Fluorescence

Journal: BMC Biotechnology

Article Title: Effects of size and topology of DNA molecules on intracellular delivery with non-viral gene carriers

doi: 10.1186/1472-6750-8-23

Figure Lengend Snippet: Structure of the DNA molecules used in this study. A . Structure of the parent c-DNA. B . l-DNA formed by restriction digest of c-DNA with the enzyme Xho I. The size of the linearized plasmid was 4272 bp, C . pcr-DNA (2209 bp) generated by site-specific primers that amplified the region of the c-DNA containing the HTLV promoter, the hOPG open reading frame, and the SV40 Poly-A site. D . Structure of the parent c-DNA used in transfection. E . l-DNA formed by digest of pEGFP-N2 with the enzyme Cla I, which cuts in the vector backbone. F . pcr-DNA (1713 bp) generated by primers that are complementary to the sequence upstream of the CMV promoter and downstream of the polyA site.

Article Snippet: Linear DNA (l-DNA) Purified c-DNA was linearized using the restriction enzyme, Xho I (New England Biolabs; Pickering, ON) for pORF9-hTNFRS11b or Cla I (Invitrogen; Burlington, ON) for pEGFP-N2, Restriction digestion were set up with 5 μg of DNA per 50 μL of reaction volume containing 3 units of enzyme and incubated at 37°C for 16 hours.

Techniques: Plasmid Preparation, Polymerase Chain Reaction, Generated, Amplification, Transfection, Sequencing

Journal: Methods (San Diego, Calif.)

Article Title: Analyzing the Branch Migration Activities of Eukaryotic Proteins

doi: 10.1016/j.ymeth.2010.02.010

Figure Lengend Snippet: Production of joint molecules used to test the branch migration activity of proteins. (A) Joint molecules with a 3′ displaced ssDNA tail are produced by RAD51 using gapped DNA and pBS II K (+) dsDNA linearized with XhoI. (B) Joint molecules with

Article Snippet: To prepare the linear dsDNA fragment, perform a digest of pBS II K (+) plasmid DNA first with the restriction endonuclease XhoI, and then with AlwNI (New England Biolabs).

Techniques: Migration, Activity Assay, Produced

Journal: Methods (San Diego, Calif.)

Article Title: Analyzing the Branch Migration Activities of Eukaryotic Proteins

doi: 10.1016/j.ymeth.2010.02.010

Figure Lengend Snippet: The scheme used to produce gapped DNA. i) pBS II K (+) plasmid DNA is digested with XhoI and AlwNI. ii) The large DNA fragment from this digest is purified by gel electrophoresis in agarose gels, and then iii) annealed to circular ssDNA to generate gapped

Article Snippet: To prepare the linear dsDNA fragment, perform a digest of pBS II K (+) plasmid DNA first with the restriction endonuclease XhoI, and then with AlwNI (New England Biolabs).

Techniques: Plasmid Preparation, Purification, Nucleic Acid Electrophoresis

Journal: Methods (San Diego, Calif.)

Article Title: Analyzing the Branch Migration Activities of Eukaryotic Proteins

doi: 10.1016/j.ymeth.2010.02.010

Figure Lengend Snippet: Illustration of the 0.8% agarose gel used to purify the large (2065 bp) dsDNA fragment of pBS II K (+) following digestion with XhoI and AlwNI. After electrophoresis, lanes A, C, and E are excised from the gel and stained with ethidium bromide (dashed

Article Snippet: To prepare the linear dsDNA fragment, perform a digest of pBS II K (+) plasmid DNA first with the restriction endonuclease XhoI, and then with AlwNI (New England Biolabs).

Techniques: Agarose Gel Electrophoresis, Electrophoresis, Staining

Journal: Nature genetics

Article Title: Selective propagation of functional mtDNA during oogenesis restricts the transmission of a deleterious mitochondrial variant

doi: 10.1038/ng.2920

Figure Lengend Snippet: mtDNA replication is reduced in 16-cell cysts of homoplasmic mt:CoI T300I germaria at 29°C. ( a ) Mutated nucleotide and amino acid residue (red) in mt:CoI T300I , including XhoI site (yellow). ( b ) Eclosion rate (mean±s.d., from total > 50 animals in 5 groups) of wt, homoplasmic and heteroplasmic mt:CoI T300I animals at 18°C and 29°C. * indicates zero mt:CoI T300I eclosed at 29°C. ( c ) COX activities of wt and mt:CoI T300I flies were examined on consecutive days shifting to 29°C. Data represent 3 biological replicates. Values were normalized with average COX activities of wt at 29°C 0 day and shown as mean±s.d. ( d ) Quantification of EdU puncta (mean±s.d.) in posterior cyst of region 2B at 18°C (wt n= 7, mt:CoI T300I n= 7) or 29°C (wt n= 5, mt:CoI T300I n= 8). The number of EdU puncta in mt:CoI T300I at 29°C is significantly less than that at 18°C or wild type at 29°C ( P

Article Snippet: Molecular confirmation and quantification of heteroplasmy A 4 kb mtDNA fragment spanning the XhoI site in mt:CoI was PCR amplified from total animal DNA as described previously , and purified using the Thermo Scientific gel purification kit.

Techniques:

Journal: Nature genetics

Article Title: Selective propagation of functional mtDNA during oogenesis restricts the transmission of a deleterious mitochondrial variant

doi: 10.1038/ng.2920

Figure Lengend Snippet: Germline selection against mt:CoI T300I at the restrictive temperature. ( a ) Frequency of mt:CoI T300I mutation in heteroplasmic flies maintained at 29°C or 18°C over generations. ( b ) XhoI digestion of PCR fragment spanning mt:CoI , amplified from single larvae produced by the same heteroplasmic mother at 18°C or 29°C. ( c ) Proportion of mutant mtDNA in 10 single larvae at 18°C or 29°C, calculated by quantifying band intensity in b . Average level of mutant mtDNA, 18°C, 83±5%; 29°C, 60±9%, n=10, P

Article Snippet: Molecular confirmation and quantification of heteroplasmy A 4 kb mtDNA fragment spanning the XhoI site in mt:CoI was PCR amplified from total animal DNA as described previously , and purified using the Thermo Scientific gel purification kit.

Techniques: Selection, Mutagenesis, Polymerase Chain Reaction, Amplification, Produced

Journal: mSphere

Article Title: A Simple and Universal System for Gene Manipulation in Aspergillus fumigatus: In Vitro-Assembled Cas9-Guide RNA Ribonucleoproteins Coupled with Microhomology Repair Templates

doi: 10.1128/mSphere.00446-17

Figure Lengend Snippet: Southern blot analysis of Δ pksP mutant generated in the Af293 background. (A) Schematic representation of the genomic locus of the Af293 and Δ pksP strains. Deletion of the pksP gene was carried out using the HygR cassette. The cleavage sites of the dual in vitro -assembled Cas9 RNPs are marked by thick vertical lines. XhoI cutting sites are indicated in the pksP locus of the wild-type and Δ pksP strains. (B) Southern blot analysis of 6 arbitrarily selected colonies after digesting genomic DNA with the XhoI restriction enzyme. The wild type (WT) produced a 1.8-kb band that matches the expected wild-type banding pattern. Lanes 1, 2, 4, 5, and 6 displayed a 3.8-kb band which matches the expected pksP deletion banding pattern. The colony in lane 3 displayed a 7.6-kb band, likely containing a tandem integration of the HygR repair template at the pksP locus.

Article Snippet: Following quanti fication by a NanoDrop spectrophotometer and integrity verification by agarose gel electrophoresis, the genomic DNA was digested overnight at 37°C using the restriction enzyme XhoI and was separated on an agarose gel before being transferred to a Biodyne B modified nylon membrane (Thermo Scientific).

Techniques: Southern Blot, Mutagenesis, Generated, In Vitro, Produced

Journal: Research in Pharmaceutical Sciences

Article Title: Exposition of hepatitis B surface antigen (HBsAg) on the surface of HEK293T cell and evaluation of its expression

doi: 10.4103/1735-5362.192485

Figure Lengend Snippet: (A) Digestion on extracted plasmid of one of positive clones with NheI and XhoI confirmed HBsAg fragment insertion in pcDNA vector. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested circular plasmid. Column 3: 696 bp and 5501 bp bands that confirmed cloning. (B) Digestion of recombinant plasmid with BglII enzyme. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested plasmid. Column 3: A 6197 bp linearized plasmid.

Article Snippet: The extracted plasmid of one of the resulted clones and pcDNA 3.1 Hygro (+) plasmid (Invitrogen, USA) were digested by NheI and XhoI restriction enzymes (Thermoscience, USA) separately.

Techniques: Plasmid Preparation, Clone Assay, Recombinant

Journal: Osong Public Health and Research Perspectives

Article Title: Cloning, Expression, and Purification of Hyperthermophile α-Amylase from Pyrococcus woesei

doi: 10.1016/j.phrp.2015.10.003

Figure Lengend Snippet: (A) Digestion of pTY-α-amylase with Nhe I and Xho I restriction enzymes. Lane 1: pTYB2 digested with Nhe I and Xho I; lane2: pTY-α-amylase digested with Nhe I and Xho I; lane 3: PCR product of α-amylase. (B) SDS-PAGE analysis of α-amylase expression. Lane 1: before IPTG induction; lane 2: after IPTG induction; lane 3: 16 hours after IPTG induction; lane 4: 20 hours after IPTG induction. (C) Western blot analysis of α-amylase with anti-intein polyclonal antibody. Lane1: α-amylase; lane 2: lysate of untransformed bacteria. IPTG = isopropyl- β-d-thiogalactopyranoside; M = molecular marker; SDS-PAGE = sodium dodecyl sulfate polyacrylamide gel electrophoresis.

Article Snippet: P. woesei chromosomal DNA was used as a source of the α-amylase gene and polymerase chain reaction (PCR) amplification was done with the following primers: 5′- GCTAGC TTGGAGCTTGAAGAGGGAG-3′ and 5′- GAGACC ACAATAACTCCATACGGAG-3′ containing recognition sites for restriction endonucleases Nhe I and Xho I (Fermentas; Vilnius, Lithuania).

Techniques: Polymerase Chain Reaction, SDS Page, Expressing, Western Blot, Marker, Polyacrylamide Gel Electrophoresis

Journal: The Korean Journal of Parasitology

Article Title: Evaluation of Protective Immune Response Induced by a DNA Vaccine Encoding GRA8 against Acute Toxoplasmosis in a Murine Model

doi: 10.3347/kjp.2018.56.4.325

Figure Lengend Snippet: T. gondii GRA8 was expressed successfully in ARPE-19 cells. (A) The coding sequence of the T. gondii GRA8 gene was amplified by PCR (814 bp) from the cDNA of T. gondii strain GFP-RH. (B) The PCR products were digested with the appropriate restriction enzymes and cloned into the XhoI and EcoRI sites of the pDsRed2-N1 expression vector, which contains the DsRed open reading frame. The constructed recombinant plasmid was named pDsRed2-GRA8. (C) ARPE-19 cells transfected with pDsRed2-GRA8 showed specific expression of GRA8 mRNA. (D) pDsRed2-GRA8 and the pDsRed2-N1 empty vector both expressed the DsRed2 protein, which localized to the cytoplasm of the transfected cells.

Article Snippet: The GRA8 fragments were cleaved from pGEM-GRA8 by using the restriction endonucleases XhoI and EcoRI and then were subcloned into the corresponding sites of the pDsRed2-N1 vector (Invitrogen Life Technologies) to construct pDsRed2-N1-GRA8 (pDsRed2-GRA8).

Techniques: Sequencing, Amplification, Polymerase Chain Reaction, Clone Assay, Expressing, Plasmid Preparation, Construct, Recombinant, Transfection

Journal: Protein expression and purification

Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris

doi: 10.1016/j.pep.2014.08.005

Figure Lengend Snippet: pJ915-rhChymase vector map The P. pastoris ] using 5’ XhoI and 3’ NotI restriction sites. The GAP promoter provides constitutive expression of the fusion protein and the plasmid contains a Zeocin resistance selectable marker gene. The plasmid is linearized at the SwaI restriction site prior to electroporation.

Article Snippet: The DNA encoding human Chymase (hChymase) with an added N-terminal Kex2 protease cleavage site was isolated from the previously described plasmid pPICzα-rhChymase [ ] using simultaneous digestion with XhoI and NotI restriction endonucleases (Thermo Scientific, FastDigest).

Techniques: Plasmid Preparation, Expressing, Marker, Electroporation

Journal: Iranian Journal of Veterinary Research

Article Title: Expression of HA1 antigen of H5N1 influenza virus as a potent candidate for vaccine in bacterial system

doi:

Figure Lengend Snippet: Construction and cloning of HA1 protein. (A) Digestion of pUC57 vector containing HA1 gene by enzymes BamHI and XhoI. M: Molecular marker. Lanes 1 and 2: Digested plasmid and HA1 gene. (B) Digestion of pET28a-HA1 vector by enzymes BamHI and XhoI. M: Molecular marker. Lane 1: Digested pET and HA1 gene. (C) PCR analysis for detection of HA1 gene in transformed E. coli clonies contained pET28a-HA1 construct by HA1 specific primers. M: Molecular marker. Lane 1: Positive control, Lane 2: Transformed bacterial clony (The 329 bp band was clear), and Lane 3: Negative control

Article Snippet: The synthesized sequence was removed from the pUC57 vector by digestion with BamHI and XhoI and then inserted into the linearized pET28a (+) expression vector (Novagen, USA) using T4 DNA ligase (Fermentas, USA), yielding pET28a-HA1 vector.

Techniques: Clone Assay, Plasmid Preparation, Marker, Positron Emission Tomography, Polymerase Chain Reaction, Transformation Assay, Construct, Positive Control, Negative Control

Journal: Journal of Virology

Article Title: Coxsackievirus and Adenovirus Receptor Amino-Terminal Immunoglobulin V-Related Domain Binds Adenovirus Type 2 and Fiber Knob from Adenovirus Type 12

doi:

Figure Lengend Snippet: Cloning of the Ad12 fiber knob and the extracellular domains of human CAR. (a) The Ad12 knob domain (line) begins at a conserved Thr-Leu-Trp-Thr motif (amino acids 409 to 412) and extends to the fiber protein carboxy terminus (Glu587). A fragment of Ad12 DNA encoding the entire knob domain and several amino acids from the preceding fiber shaft region (striped box) beginning at Ser401 was amplified by PCR using forward primer 1 and reverse primer 2. The resulting PCR product was cloned between the Nde I and Bam HI sites of pET15b. (b) The human CAR protein consists of an amino-terminal signal peptide (open box), two extracellular Ig-related domains (D1 and D2), a membrane-spanning region (TM), and a cytoplasmic domain (CYT). cDNA fragments encoding D1 and D1/D2 were amplified by PCR using forward primer 3 and reverse primers 4 and 5. The resulting PCR products were cloned between the Nco I and Xho I sites of pET20b. Similar D1- and D1/D2-encoding cDNA fragments were amplified by PCR using forward primer 6 and reverse primers 7 and 8. The resulting PCR products were cloned between the Nde I and Bam HI sites of pET15b. (c) pET vectors for protein expression in E. coli . The open and filled boxes represent bacterial signal peptides and hexahistidine tags, respectively. The restriction sites used in this study are shown, and the sequence of the pET15b-encoded 22-amino-acid carboxy-terminal extension of sD1 is given in single-letter code.

Article Snippet: Primers 3 through 5 (CCATGGGTATCACTACTCCTGAAGAGA, CTCGAGCGCACCTGAAGGCTTA, and CTCGAGTGAAGGAGGGACAAC, respectively [Fig. b]) were designed for cloning D1- and D1/D2-encoding PCR products between the Nco I and Xho I sites of expression vector pET20b (Novagen).

Techniques: Clone Assay, Amplification, Polymerase Chain Reaction, Positron Emission Tomography, Expressing, Sequencing

Journal: Brazilian Journal of Microbiology

Article Title: Expression of mouse beta defensin 2 in escherichia coli and its broad-spectrum antimicrobial activity

doi: 10.1590/S1517-838220110003000043

Figure Lengend Snippet: Schematic representation of the expression vector, pET32a-mBD2. The cDNA for mature mBD2 were amplified using PCR from the pcDNA3.1(+)-mBD2 plasmid. PCR product was cleaved by Xho I and Kpn I, and the mBD2 fragment was inserted into similarly digested pET32a(+) vector to construct the expression vector, pET32a-mBD2.

Article Snippet: The PCR conditions were following: 94°C, 4 min; 30 cycles of 94°C, 30 s; 58°C, 30 s; 72°C, 30 s; 72°C, 5 min. PCR product was cleaved by Xho I and Kpn I , and the mBD2 fragment was inserted into similarly digested pET32a(+) (Novagen, Shanghai, China) to construct the expression vector pET32a-mBD2.

Techniques: Expressing, Plasmid Preparation, Amplification, Polymerase Chain Reaction, Construct

Journal: Applied and Environmental Microbiology

Article Title: Isolation and Characterization of a Cyanophage Infecting the Toxic Cyanobacterium Microcystis aeruginosa

doi: 10.1128/AEM.72.2.1239-1247.2006

Figure Lengend Snippet: Ma-LMM01 genomic DNA digested with various restriction enzymes. Lanes 1 and 18, 1-kb ladder marker; lane 2, BamHI; lane 3, EcoRI; lane 4, EcoRV; lane 5, HincII; lane 6, HindIII; lane 7, NotI; lane 8, PstI; lane 9, SacI; lane 10, SalI; lane 11, ScaI; lane 12, SmaI; lanes 13 and 14, lambda/HindIII marker; lane 15, SpeI; lane 16, XhoI; lane 17, XbaI.

Article Snippet: Using the manufacturers' recommendations, we tested the sensitivity of the phage nucleic acid to RNase A (0.01 ng μl−1 ; 37°C for 1 h; Nippon Gene Co., Ltd.), DNase I (0.02 ng μl−1 ; 37°C for 1 h; Promega Co., Ltd.), and the following 14 restriction enzymes, which were incubated for 16 h: SpeI (0.5 U μl−1 ; 37°C; TOYOBO Co., Ltd.), XhoI (0.45 U μl−1 ; 37°C; TOYOBO Co., Ltd.), XbaI (0.5 U μl−1 ; 37°C; Roche Molecular Biochemicals), BamHI (0.6 U μl−1 ; 37°C; TOYOBO Co., Ltd.), EcoRI (0.5 U μl−1 ; 37°C; TOYOBO Co., Ltd.), EcoRV (0.6 U μl−1 ; 37°C; TOYOBO Co., Ltd.), HincII (0.5 U μl−1 ; 37°C; TOYOBO Co., Ltd.), HindIII (0.5 U μl−1 ; 37°C; Nippon Gene Co., Ltd.), NotI (0.5 U μl−1 ; 37°C; New England Biolabs Inc.), PstI (0.5 U μl−1 ; 37°C; TOYOBO Co., Ltd.), SacI (0.5 U μl−1 ; 37°C; TOYOBO Co., Ltd.), SalI (0.5 U μl−1 ; 37°C; TOYOBO Co., Ltd.), ScaI (0.5 U μl−1 ; 37°C; TOYOBO Co., Ltd.), and SmaI (0.6 U μl−1 ; 30°C; TOYOBO Co., Ltd.).

Techniques: Marker

Journal: Amino Acids

Article Title: Incorporation of tryptophan analogues into the lantibiotic nisin

doi: 10.1007/s00726-016-2186-3

Figure Lengend Snippet: Map of the plasmid pCZnisA–trpRS. sczA , encoding the repressor of P czcD ; P czcD, a zinc-inducible promoter; nisA , encoding NisA; trpRS , encoding tryptophanyl-tRNA synthetase; T, terminator; BamHI and XhoI, restriction sites; repA and repC , encoding plasmid replication proteins; cmR , chloramphenicol resistance gene. Partly referred to (Mu et al. 2013 )

Article Snippet: Both PCR products were cut with BamHI and XhoI, and the digested products were purified (Roche Switzerland) and ligated with T4 ligase (Thermo Scientific).

Techniques: Plasmid Preparation