Journal: PLoS ONE

Article Title: Multiresidue Method for Analysis of β Agonists in Swine Urine by Enzyme Linked Receptor Assay Based on β2 Adrenergic Receptor Expressed in HEK293 Cells

doi: 10.1371/journal.pone.0139176

Figure Lengend Snippet: Agarose gel electrophoresis analysis of 3 combinant expression plasmid. The plasmid was confirmed by PCR and double digestion using NcoI and XhoI. Lane 1 was the fragment of recombinant plasmid DNA pTriEx-1.1 Hygro-β 2 -AR. Lane 2 was the electrophoresis results of digested products containing 2 fragments (6951 bp and 1257 bp). A 3300 bp fragment (lane 3 and lane 4) was amplified by PCR from the recombinant plasmid, which was identical with the sum of the size of target gene and vector sequences between NcoI and XhoI.

Article Snippet: The restriction enzymes of NcoI and XhoI were purchased from NEB (Ipswich, MA, USA).

Techniques: Agarose Gel Electrophoresis, Expressing, Plasmid Preparation, Polymerase Chain Reaction, Recombinant, Electrophoresis, Amplification

Journal: Plant Physiology

Article Title: A Germination-Specific Endo-?-Mannanase Gene Is Expressed in the Micropylar Endosperm Cap of Tomato Seeds 1

doi:

Figure Lengend Snippet: Southern blots of tomato genomic DNA hybridized with full-length cDNAs of LeMAN1 (left) and LeMAN2 (right). Genomic DNA (10 μg) isolated from tomato leaves was digested with Bam HI ( Bam ), Xba I ( Xba ), and Xho I ( Xho ). Bands marked with arrows hybridized more strongly with LeMAN1 , whereas the band marked with an arrowhead hybridized more strongly to LeMAN2 (see text for details).

Article Snippet: Genomic DNA (10 μg) was digested with the restriction enzymes Bam HI, Xba I, and Xho I (New England Biolabs), separated on a 1.0% (w/v) agarose gel, and transferred to positively charged membranes (Hybond-N+ , Amersham Pharmacia Biotech).

Techniques: Isolation

Journal: Nucleic Acids Research

Article Title: Structure of discontinuities in kinetoplast DNA-associated minicircles during S phase in Crithidia fasciculata

doi: 10.1093/nar/gkm1061

Figure Lengend Snippet: Ligation of discontinuities in kinetoplast-associated minicircles. Purified kDNA from 300 min after release from the hydroxyurea block were either treated with E. coli DNA ligase (+) or not (−) prior to digestion with XhoI and alkaline denaturing gel analysis. The gel was transferred and hybridized as in Figure 3 to identify released H and L single strands. Marker lanes: M1, minicircle single strand linears (ssl) and single strand circles (ssc); M2, denatured covalently closed minicircles (dcc) in addition to minicircle single strand linears (ssl) and single strand circles (ssc); M3, molecular weight markers.

Article Snippet: The remainders of the cell lysates were each ethanol precipitated and resuspended in 200 μl of 0.01 M Tris pH 8, 1 mM EDTA and 22 μl of 10 × NEB 3 buffer followed by digestion for 60 min at 37°C with Mlu I and XhoI restriction enzymes (New England Biolabs) to fragment the DNA.

Techniques: Ligation, Purification, Blocking Assay, Marker, Droplet Countercurrent Chromatography, Molecular Weight

Journal: Nucleic Acids Research

Article Title: Structure of discontinuities in kinetoplast DNA-associated minicircles during S phase in Crithidia fasciculata

doi: 10.1093/nar/gkm1061

Figure Lengend Snippet: Topoisomerase decatenation of XhoI-resistant catenated minicircle molecules. Purified kDNA prepared at 300 min was digested with XhoI and one-half was additionally treated with a type II DNA topoisomerase prior to neutral gel electrophoresis and Southern blotting using a minicircle probe. Catenated minicircles are indicated by a bracket. N/G, nicked or gapped minicircle DNA; L, unit-length linear minicircle DNA; CCC, covalently closed circular minicircle DNA.

Article Snippet: The remainders of the cell lysates were each ethanol precipitated and resuspended in 200 μl of 0.01 M Tris pH 8, 1 mM EDTA and 22 μl of 10 × NEB 3 buffer followed by digestion for 60 min at 37°C with Mlu I and XhoI restriction enzymes (New England Biolabs) to fragment the DNA.

Techniques: Purification, Nucleic Acid Electrophoresis, Southern Blot, Countercurrent Chromatography

Journal: Nucleic Acids Research

Article Title: Structure of discontinuities in kinetoplast DNA-associated minicircles during S phase in Crithidia fasciculata

doi: 10.1093/nar/gkm1061

Figure Lengend Snippet: ( A ) Physical map of C. fasciculata minicircle DNA ( 36 ). The two-replication origins, oriA and oriB, are located 180° apart on the circular DNA. Specific nicks in nicked circular (form II) minicircles identified in free minicircles replicated in an isolated kinetoplast system define the initiation sites of the leading L strand and the initiation sites of the first H-strand Okazaki fragment at each origin ( 23 ). The nucleotide coordinates are indicated for the specific nicks in the H and L strands. The region from 1041 to 1240 nt has been shown to confer a static bend in the DNA ( 42 ) and is referred to as a bent helix. ( B ) Crithidia fasciculata minicircle replication schematic. Thin line, L strand; thick line, H strand; filled arrowheads, specific nicks; double arrowhead, XhoI site.

Article Snippet: The remainders of the cell lysates were each ethanol precipitated and resuspended in 200 μl of 0.01 M Tris pH 8, 1 mM EDTA and 22 μl of 10 × NEB 3 buffer followed by digestion for 60 min at 37°C with Mlu I and XhoI restriction enzymes (New England Biolabs) to fragment the DNA.

Techniques: Isolation

Journal: Journal of Biological Engineering

Article Title: AFM Imaging Reveals Multiple Conformational States of ADAMTS13

doi: 10.1186/s13036-018-0102-y

Figure Lengend Snippet: AFM system successfully imaged proteins . ( a ) WT- and GOF-ADAMTS13 plasmids were double digested by restriction enzymes HindIII and XhoI, and verified in agarose gel electrophoresis. ( b ) Purified WT- and GOF-ADAMTS13 were analyzed by SDS-PAGE under reducing conditions on a 7.5% gel and Western blotting with anti-His antibody. ( c ) AFM images of VWF-A1 (30 kDa), BSA (67 kDa), anti-His tag antibody (150 kDa) and commercial ADAMTS13 (190 kDa). The horizontal scale bar is 200 nm. The vertical scale bar indicates the height. ( d ) The plot of volumes of these four proteins versus their molecular weights. The data was well fitted into a straight line. The goodness of fit is indicated by R 2 . According to the linear relationship y = 5.31817*x + 256.175, the volume of purified WT-ADAMTS13 (red square) corresponds to the molecular weight of 213 kDa. Data were presented as mean ± SD.

Article Snippet: Restriction enzymes XhoI and HindIII-HF were purchased from NEB (Ipswich, MA, USA).

Techniques: Agarose Gel Electrophoresis, Purification, SDS Page, Western Blot, Molecular Weight

Journal: PLoS Genetics

Article Title: Novel Roles for Selected Genes in Meiotic DNA Processing

doi: 10.1371/journal.pgen.0030222

Figure Lengend Snippet: Assessment of def1 Δ in Meiosis and Mitosis (A) Immunocytology of nuclear spreads of SK1 wild-type and def1Δ strains after 8 h of sporulation. The meiosis-specific subunit of cohesin, Rec8, was tagged with multiple Haemagglutinin (HA) epitopes. Using antibodies for HA and Zip1 allowed analysis of sister chormatid cohesion and synaptonemal complex formation, respectively. It can be seen in the wild-type example that all 16 chromosomes have long cohesin axes and close to full chromosome synapsis except for the rDNA region on Chromosome XII. Whereas from the first panel for def1Δ it can be seen that axes are aligned but synapsis is minimal. The second and third panels for def1Δ again show aligned axes, but homologues are only partially synapsed. However, as shown in the final panel, synapsis was observed in some meiotic nuclei of the def1Δ strain. Polycomplexes (PCs) of Zip1 were observed in 20% of the nuclei counted for def1Δ at this time point whereas less than 1% PCs were observed for the wild type. (B) Time course of the meiotic nuclei counted using immunocytology for both wild type and def1Δ during meiosis. The def1Δ mutant synapsis phenotype represented in (A) was counted as “aligned” axes in the Rec8 analysis graph. At least 200 nuclei were counted per time point. (C) Ectopic URA3 - ARG4 interval on Chromosome III described in Figure 3 . XhoI and EcoRI restriction sites are indicated by “X” and “E,” respectively. To detect NCOs, COs, and DSBs, DNA is digested with XhoI and EcoRI then probed with HIS4 sequences (hisU; [ 44 ]). For graphs (D–F), wild-type and def1Δ are represented by blue squares and pink diamonds, respectively. The corresponding XhoI and EcoRI double digest Southern blots, the XhoI single digest Southern blots, together with the molecular analyses, are presented in Figure S5 . (D) Molecular analysis for DSB (DSB2) signal/total lane signal from Southern blots of DNA extracted from synchronized meiotic cultures. (E) Molecular analysis for NCO (NCO1) signal/total lane signal from Southern blots of DNA extracted from synchronized meiotic cultures. (F) Molecular analysis for CO (CO1') signal/total lane signal from Southern blots of DNA extracted from synchronized meiotic cultures. (G) Southern blot of DNA isolated from wild-type and def1Δ SK1 strains containing the ectopic URA3 - ARG4 interval on Chromosome III. DNA was digested with XhoI and EcoRI then probed to detect NCOs, COs, and DSBs; mw represents the 1-kb molecular weight marker (Fermentas).

Article Snippet: The DNA from the indicated times after initiation of sporulation were digested with XhoI then probed to detect COs and DSBs; mw1 represents the λ-HindIII molecular weight marker (Fermentas) and mw2 represents the 1-kb molecular weight marker (Fermentas). (E) Molecular analysis for DSB (DSB1 + DSB2) signal/total lane signal from Southern blots of DNA extracted from synchronized meiotic cultures. (F) Molecular analysis for CO1 signal/total lane signal from Southern blots of DNA extracted from synchronized meiotic cultures. (G) Molecular analysis for CO2 signal/total lane signal from Southern blots of DNA extracted from synchronized meiotic cultures. (H) Molecular analysis for CO (CO1 + CO2) signal/total lane signal from Southern blots of DNA extracted from synchronized meiotic cultures. (676 KB DOC) Click here for additional data file.

Techniques: Mutagenesis, Southern Blot, Isolation, Molecular Weight, Marker

Journal: PLoS Genetics

Article Title: Novel Roles for Selected Genes in Meiotic DNA Processing

doi: 10.1371/journal.pgen.0030222

Figure Lengend Snippet: Assessment of YGL250W , SOH1 , and BRE5 (A) Schematic representation of Chromosome II from the diploid W303 background which consists of two LYS2 heteroalleles ( lys2–5′nde I − and lys2–3′nde I − ). These were used to measure meiotic gene conversion (see Materials and Methods ). (B) Spot test of wild type, ygl250wΔ , soh1Δ , and bre5Δ on haploid selection plates and haploid selection plates without lysine to measure meiotic gene conversion. The reduction in meiotic gene conversion of ygl250wΔ , soh1Δ , and bre5Δ was further assessed by random spore analysis ( Table 1 ). (C) Southern blot of DNA isolated from wild type, soh1Δ , and ygl250wΔ SK1 strains containing the ectopic URA3 - ARG4 interval on Chromosome III. The DNA from the indicated times after initiation of sporulation were digested with XhoI then probed to detect COs and DSBs; mw1 represents the λ-HindIII molecular weight marker (Fermentas) and mw2 represents the 1-kb molecular weight marker (Fermentas). The full-sized Southern blots are presented in Figure S1 . For graphs (D–G), wild type, ygl250wΔ , and soh1Δ are represented by black diamonds, black circles, and white squares, respectively. The corresponding XhoI-digested Southern blots are presented in Figure 3 C. (D) Pre-meiotic DNA replication was assessed for synchronized meiotic cultures by fluorescence-activated cell sorting (FACS) and the change from 2c to 4c DNA content was plotted over time. (E) Nuclear divisions (MI and MII) of the synchronized meiotic cultures in (E) were assessed with fluorescence microscopy using 4′,6-diamidino-2-phenylindole (DAPI) staining to visualize nuclear division. (F) Molecular analysis for DSB (DSB1) signal/total lane signal from Southern blots of DNA extracted from synchronized meiotic cultures. (G) Molecular analysis for CO (CO2) signal/total lane signal from Southern blots of DNA extracted from synchronized meiotic cultures.

Article Snippet: The DNA from the indicated times after initiation of sporulation were digested with XhoI then probed to detect COs and DSBs; mw1 represents the λ-HindIII molecular weight marker (Fermentas) and mw2 represents the 1-kb molecular weight marker (Fermentas). (E) Molecular analysis for DSB (DSB1 + DSB2) signal/total lane signal from Southern blots of DNA extracted from synchronized meiotic cultures. (F) Molecular analysis for CO1 signal/total lane signal from Southern blots of DNA extracted from synchronized meiotic cultures. (G) Molecular analysis for CO2 signal/total lane signal from Southern blots of DNA extracted from synchronized meiotic cultures. (H) Molecular analysis for CO (CO1 + CO2) signal/total lane signal from Southern blots of DNA extracted from synchronized meiotic cultures. (676 KB DOC) Click here for additional data file.

Techniques: Spot Test, Selection, Southern Blot, Isolation, Molecular Weight, Marker, Fluorescence, FACS, Microscopy, Staining

Journal: PLoS ONE

Article Title: Protection against Th17 Cells Differentiation by an Interleukin-23 Receptor Cytokine-Binding Homology Region

doi: 10.1371/journal.pone.0045625

Figure Lengend Snippet: Generation of IL23R-CHR protein. A, Restriction sites are indicated in bold, the translated amino acid and Trx-6×His-DDDDKA tag are shown in the box; B, IL23R-CHR gene from human spleen cDNA library amplified by PCR; C, One pET32a/IL23R-CHR clone digested with NcoI and XhoI and analyzed by agrose gel electrophoresis (1%). MW = molecular weight markers, bp. D, Trx-IL23R-CHR induced by IPTG in E.Coli BL21 (DE3), SDS-PAGE (15%), protein bands were stained with coomassie brilliant blue R250 reagent. Lane 2, uninduced bacterial lysate; Lane 3, IPTG induced bacterial lysate. E, Trx-IL23R-CHR purified from BL21 (DE3) lysate and cleaved by enterokinase, Lane 5, purified Trx-IL23R-CHR; Lane 6, purified IL23R-CHR. F, Western blot using mouse mAbs against human IL23R (Lane 8). Lane 1, 4 and 7 in D, E, F: molecular weight markers, KD.

Article Snippet: After purification with Tianquick midi purification kit (Tiangen, China), the IL23R-CHR gene was digested with NcoI and XhoI (takara) and inserted into pET32a following the manufacturer’s instructions (Novagen, Germany).

Techniques: cDNA Library Assay, Amplification, Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Molecular Weight, SDS Page, Staining, Purification, Western Blot

Journal: International Journal of Molecular Medicine

Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis

doi: 10.3892/ijmm.2019.4355

Figure Lengend Snippet: Construction of the knockdown vector pCB309-PFUFT. The FSH1 cDNA was ligated into pUC-PUT after DNA digestion by Xho I and Hin dIII to construct plasmid pUC-PFUFT. The two plasmids, pUC-PFUFT and pCB309 were digested by Spe I and Sac I and ligated with T4 DNA ligase to construct the final FSH1 double stranded RNA interference plasmid pCB309-PFUFT. FSH1, family of serine hydrolases 1.

Article Snippet: First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

Techniques: Plasmid Preparation, Construct

Journal: Nature genetics

Article Title: Selective propagation of functional mtDNA during oogenesis restricts the transmission of a deleterious mitochondrial variant

doi: 10.1038/ng.2920

Figure Lengend Snippet: mtDNA replication is reduced in 16-cell cysts of homoplasmic mt:CoI T300I germaria at 29°C. ( a ) Mutated nucleotide and amino acid residue (red) in mt:CoI T300I , including XhoI site (yellow). ( b ) Eclosion rate (mean±s.d., from total > 50 animals in 5 groups) of wt, homoplasmic and heteroplasmic mt:CoI T300I animals at 18°C and 29°C. * indicates zero mt:CoI T300I eclosed at 29°C. ( c ) COX activities of wt and mt:CoI T300I flies were examined on consecutive days shifting to 29°C. Data represent 3 biological replicates. Values were normalized with average COX activities of wt at 29°C 0 day and shown as mean±s.d. ( d ) Quantification of EdU puncta (mean±s.d.) in posterior cyst of region 2B at 18°C (wt n= 7, mt:CoI T300I n= 7) or 29°C (wt n= 5, mt:CoI T300I n= 8). The number of EdU puncta in mt:CoI T300I at 29°C is significantly less than that at 18°C or wild type at 29°C ( P

Article Snippet: Molecular confirmation and quantification of heteroplasmy A 4 kb mtDNA fragment spanning the XhoI site in mt:CoI was PCR amplified from total animal DNA as described previously , and purified using the Thermo Scientific gel purification kit.

Techniques:

Journal: Nature genetics

Article Title: Selective propagation of functional mtDNA during oogenesis restricts the transmission of a deleterious mitochondrial variant

doi: 10.1038/ng.2920

Figure Lengend Snippet: Germline selection against mt:CoI T300I at the restrictive temperature. ( a ) Frequency of mt:CoI T300I mutation in heteroplasmic flies maintained at 29°C or 18°C over generations. ( b ) XhoI digestion of PCR fragment spanning mt:CoI , amplified from single larvae produced by the same heteroplasmic mother at 18°C or 29°C. ( c ) Proportion of mutant mtDNA in 10 single larvae at 18°C or 29°C, calculated by quantifying band intensity in b . Average level of mutant mtDNA, 18°C, 83±5%; 29°C, 60±9%, n=10, P

Article Snippet: Molecular confirmation and quantification of heteroplasmy A 4 kb mtDNA fragment spanning the XhoI site in mt:CoI was PCR amplified from total animal DNA as described previously , and purified using the Thermo Scientific gel purification kit.

Techniques: Selection, Mutagenesis, Polymerase Chain Reaction, Amplification, Produced

Journal: Research in Pharmaceutical Sciences

Article Title: Exposition of hepatitis B surface antigen (HBsAg) on the surface of HEK293T cell and evaluation of its expression

doi: 10.4103/1735-5362.192485

Figure Lengend Snippet: (A) Digestion on extracted plasmid of one of positive clones with NheI and XhoI confirmed HBsAg fragment insertion in pcDNA vector. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested circular plasmid. Column 3: 696 bp and 5501 bp bands that confirmed cloning. (B) Digestion of recombinant plasmid with BglII enzyme. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested plasmid. Column 3: A 6197 bp linearized plasmid.

Article Snippet: The extracted plasmid of one of the resulted clones and pcDNA 3.1 Hygro (+) plasmid (Invitrogen, USA) were digested by NheI and XhoI restriction enzymes (Thermoscience, USA) separately.

Techniques: Plasmid Preparation, Clone Assay, Recombinant

Journal: Journal of Virology

Article Title: Coxsackievirus and Adenovirus Receptor Amino-Terminal Immunoglobulin V-Related Domain Binds Adenovirus Type 2 and Fiber Knob from Adenovirus Type 12

doi:

Figure Lengend Snippet: Cloning of the Ad12 fiber knob and the extracellular domains of human CAR. (a) The Ad12 knob domain (line) begins at a conserved Thr-Leu-Trp-Thr motif (amino acids 409 to 412) and extends to the fiber protein carboxy terminus (Glu587). A fragment of Ad12 DNA encoding the entire knob domain and several amino acids from the preceding fiber shaft region (striped box) beginning at Ser401 was amplified by PCR using forward primer 1 and reverse primer 2. The resulting PCR product was cloned between the Nde I and Bam HI sites of pET15b. (b) The human CAR protein consists of an amino-terminal signal peptide (open box), two extracellular Ig-related domains (D1 and D2), a membrane-spanning region (TM), and a cytoplasmic domain (CYT). cDNA fragments encoding D1 and D1/D2 were amplified by PCR using forward primer 3 and reverse primers 4 and 5. The resulting PCR products were cloned between the Nco I and Xho I sites of pET20b. Similar D1- and D1/D2-encoding cDNA fragments were amplified by PCR using forward primer 6 and reverse primers 7 and 8. The resulting PCR products were cloned between the Nde I and Bam HI sites of pET15b. (c) pET vectors for protein expression in E. coli . The open and filled boxes represent bacterial signal peptides and hexahistidine tags, respectively. The restriction sites used in this study are shown, and the sequence of the pET15b-encoded 22-amino-acid carboxy-terminal extension of sD1 is given in single-letter code.

Article Snippet: Primers 3 through 5 (CCATGGGTATCACTACTCCTGAAGAGA, CTCGAGCGCACCTGAAGGCTTA, and CTCGAGTGAAGGAGGGACAAC, respectively [Fig. b]) were designed for cloning D1- and D1/D2-encoding PCR products between the Nco I and Xho I sites of expression vector pET20b (Novagen).

Techniques: Clone Assay, Amplification, Polymerase Chain Reaction, Positron Emission Tomography, Expressing, Sequencing

Journal: Iranian Journal of Veterinary Research

Article Title: Expression of HA1 antigen of H5N1 influenza virus as a potent candidate for vaccine in bacterial system

doi:

Figure Lengend Snippet: Construction and cloning of HA1 protein. (A) Digestion of pUC57 vector containing HA1 gene by enzymes BamHI and XhoI. M: Molecular marker. Lanes 1 and 2: Digested plasmid and HA1 gene. (B) Digestion of pET28a-HA1 vector by enzymes BamHI and XhoI. M: Molecular marker. Lane 1: Digested pET and HA1 gene. (C) PCR analysis for detection of HA1 gene in transformed E. coli clonies contained pET28a-HA1 construct by HA1 specific primers. M: Molecular marker. Lane 1: Positive control, Lane 2: Transformed bacterial clony (The 329 bp band was clear), and Lane 3: Negative control

Article Snippet: The synthesized sequence was removed from the pUC57 vector by digestion with BamHI and XhoI and then inserted into the linearized pET28a (+) expression vector (Novagen, USA) using T4 DNA ligase (Fermentas, USA), yielding pET28a-HA1 vector.

Techniques: Clone Assay, Plasmid Preparation, Marker, Positron Emission Tomography, Polymerase Chain Reaction, Transformation Assay, Construct, Positive Control, Negative Control

Journal: Scientific Reports

Article Title: A Botrytis cinerea KLP-7 Kinesin acts as a Virulence Determinant during Plant Infection

doi: 10.1038/s41598-017-09409-5

Figure Lengend Snippet: An abnormal T-DNA integration in KLP-7 . (A) Hygromycin phosphotransferase ( hph ) gene insertion in BCM-29. The expected PCR product size is 1.1 kb. Lane 1, Ladder of 10 kb; lane 2, WT, lane 3, BCM-29, lane 4, positive control (PC) ( hph ) ( B) . Southern hybridization showing the integration of 4.1 kb fragment of hph gene in genome of BCM 29. Total genomic DNA was digested with Xho I and probed with the hph probe; ( C) Schematic presentation integration of T-DNA in BCM 29. Specific primers were used for the confirmation of T-DNA insertion shown by arrows. The T-DNA insertion point is 116 bp from KLP-7 start codon ( D) Insertion of T-DNA in B. cinerea genome. Junction site are shown in bold letters.

Article Snippet: For this purpose, genomic DNA (20 µg) was first digested with Xho I, the fragments were separated on 0.8% agarose gel for 8 h and then transferred to a nylon membrane (Millipore, USA).

Techniques: Polymerase Chain Reaction, Positive Control, Hybridization