xho i Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs xho i
    Map of the integrative vector pMAJIIc. Ori , replication origin; ap , neo and kan , ampicillin, neomycin and kanamycin resistance, respectively; amy , amy DNA fragment (106–912) of X . citri ; mCherry , fluorescent protein; araC , the arabinose repressor; pBAD the arabinose promoter. The polylinker region for in-frame ligation of ORFs/genes to the 5’-end of mCherry, which allows the expression of protein fusions having C-terminal mCherry, is composed of unique sites for Nhe I, Nde I, Kpn I, Sal I and <t>Xho</t> I. Not I and Xba I sites, can be used for cloning intended for the expression of proteins carrying N-terminal mCherry fusions. Unique restriction sites are shown in bold letters. The nucleotide sequence of pMAJIIc plasmid was deposited in the GenBank database under the accession number MT119765.
    Xho I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4760 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/New England Biolabs
    Average 99 stars, based on 4760 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher xho i
    Construction of the knockdown vector pCB309-PFUFT. The <t>FSH1</t> cDNA was ligated into pUC-PUT after DNA digestion by <t>Xho</t> I and Hin dIII to construct plasmid pUC-PFUFT. The two plasmids, pUC-PFUFT and pCB309 were digested by Spe I and Sac I and ligated with T4 DNA ligase to construct the final FSH1 double stranded RNA interference plasmid pCB309-PFUFT. FSH1, family of serine hydrolases 1.
    Xho I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 5479 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/Thermo Fisher
    Average 99 stars, based on 5479 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    xhoi  (TaKaRa)
    99
    TaKaRa xhoi
    Generation of <t>IL23R-CHR</t> protein. A, Restriction sites are indicated in bold, the translated amino acid and Trx-6×His-DDDDKA tag are shown in the box; B, IL23R-CHR gene from human spleen cDNA library amplified by PCR; C, One pET32a/IL23R-CHR clone digested with NcoI and <t>XhoI</t> and analyzed by agrose gel electrophoresis (1%). MW = molecular weight markers, bp. D, Trx-IL23R-CHR induced by IPTG in E.Coli BL21 (DE3), SDS-PAGE (15%), protein bands were stained with coomassie brilliant blue R250 reagent. Lane 2, uninduced bacterial lysate; Lane 3, IPTG induced bacterial lysate. E, Trx-IL23R-CHR purified from BL21 (DE3) lysate and cleaved by enterokinase, Lane 5, purified Trx-IL23R-CHR; Lane 6, purified IL23R-CHR. F, Western blot using mouse mAbs against human IL23R (Lane 8). Lane 1, 4 and 7 in D, E, F: molecular weight markers, KD.
    Xhoi, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 5956 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xhoi/product/TaKaRa
    Average 99 stars, based on 5956 article reviews
    Price from $9.99 to $1999.99
    xhoi - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Millipore xho
    Cloning of the Ad12 fiber knob and the extracellular domains of human CAR. (a) The Ad12 knob domain (line) begins at a conserved Thr-Leu-Trp-Thr motif (amino acids 409 to 412) and extends to the fiber protein carboxy terminus (Glu587). A fragment of Ad12 DNA encoding the entire knob domain and several amino acids from the preceding fiber shaft region (striped box) beginning at Ser401 was amplified by PCR using forward primer 1 and reverse primer 2. The resulting PCR product was cloned between the Nde I and Bam HI sites of pET15b. (b) The human CAR protein consists of an amino-terminal signal peptide (open box), two extracellular Ig-related domains <t>(D1</t> and D2), a membrane-spanning region (TM), and a cytoplasmic domain (CYT). cDNA fragments encoding D1 and D1/D2 were amplified by PCR using forward primer 3 and reverse primers 4 and 5. The resulting PCR products were cloned between the Nco I and <t>Xho</t> I sites of pET20b. Similar D1- and D1/D2-encoding cDNA fragments were amplified by PCR using forward primer 6 and reverse primers 7 and 8. The resulting PCR products were cloned between the Nde I and Bam HI sites of pET15b. (c) pET vectors for protein expression in E. coli . The open and filled boxes represent bacterial signal peptides and hexahistidine tags, respectively. The restriction sites used in this study are shown, and the sequence of the pET15b-encoded 22-amino-acid carboxy-terminal extension of sD1 is given in single-letter code.
    Xho, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 5521 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho/product/Millipore
    Average 99 stars, based on 5521 article reviews
    Price from $9.99 to $1999.99
    xho - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    92
    Promega xho i
    Identification and expression of plasmid pEGFP-N1-MeCP2. (A) The pEGFP-N1-MeCP2 plasmid was identified by digestion with Pst I and <t>Xho</t> I. M: Marker. (B) The EGFP-MeCP2 fusion protein was detected by western blot using anti-EGFP antibody. 1: EGFP-SH-SY5Y cells (SH-SY5Y cells transfected with pEGFP-N1); 2: O-MeCP2-SH-SY5Y cells (SH-SY5Y cells transfected with pEGFP-N1-MeCP2). MeCP2: X-linked methyl-CpG binding protein 2.
    Xho I, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 3654 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/Promega
    Average 92 stars, based on 3654 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    92
    Stratagene xho i site
    Organization of the dystroglycan gene and position of the floxed Neo cassette. a Schematic representation of the Dag1 +/+ allele, the targeting vector, the Dag1 allele after incomplete homologous recombination ( Dag1 Neo ) and the neo-deleted allele ( Dag1 ΔNeo ). The 5′ arm of the construct consisted of a 3.2 kb fragment amplified from the Dag1 intron. The 3′ arm was 4 kb in length and consisted of the exon 3′ region, harbouring four mutations (red asterisks) hitting the α/β-DG interface, and flanked by intronic sequences and the 3′-UTR, respectively. A <t>Xho</t> I (X) site in the 5′ arm was mutated for cloning purposes. The floxed neomycin cassette (Neo) and the Herpes simplex thymidine kinase (TK) acted as positive and negative selection markers, respectively. Selected restriction enzyme cleavage sites are indicated above the gene (B: Bam HI; H: Hin dIII and X: Xho I). Primers used for genotyping are also indicated as black arrows. b A representative PCR genotyping analysis of the Dag1 Neo/ + mouse. The PCR product was amplified from genomic DNA using primers spanning the Neo cassette region
    Xho I Site, supplied by Stratagene, used in various techniques. Bioz Stars score: 92/100, based on 416 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i site/product/Stratagene
    Average 92 stars, based on 416 article reviews
    Price from $9.99 to $1999.99
    xho i site - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    90
    Stratagene xho i fragment
    Organization of the dystroglycan gene and position of the floxed Neo cassette. a Schematic representation of the Dag1 +/+ allele, the targeting vector, the Dag1 allele after incomplete homologous recombination ( Dag1 Neo ) and the neo-deleted allele ( Dag1 ΔNeo ). The 5′ arm of the construct consisted of a 3.2 kb fragment amplified from the Dag1 intron. The 3′ arm was 4 kb in length and consisted of the exon 3′ region, harbouring four mutations (red asterisks) hitting the α/β-DG interface, and flanked by intronic sequences and the 3′-UTR, respectively. A <t>Xho</t> I (X) site in the 5′ arm was mutated for cloning purposes. The floxed neomycin cassette (Neo) and the Herpes simplex thymidine kinase (TK) acted as positive and negative selection markers, respectively. Selected restriction enzyme cleavage sites are indicated above the gene (B: Bam HI; H: Hin dIII and X: Xho I). Primers used for genotyping are also indicated as black arrows. b A representative PCR genotyping analysis of the Dag1 Neo/ + mouse. The PCR product was amplified from genomic DNA using primers spanning the Neo cassette region
    Xho I Fragment, supplied by Stratagene, used in various techniques. Bioz Stars score: 90/100, based on 170 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i fragment/product/Stratagene
    Average 90 stars, based on 170 article reviews
    Price from $9.99 to $1999.99
    xho i fragment - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher xho i restriction enzymes
    Identification of PPA1 minimal promoter. (A) Determination of transcription start site of PPA1 gene. Total RNA was isolated from MCF7 cells and analyzed by primer extension analysis using a primer complementary to the -20 to -1 region of exon 1 of PPA1 gene. The sequencing reaction was set using same primer as in primer extension. Both the sequencing reaction products (A, T, G and C) and primer extension product (PE) were run on a 7.5% urea-polyacrylamide gel. (B) Schematic representation of 5’-deletion constructs of PPA1 promoter. All the deletion constructs were generated by <t>PCR</t> using pGL3-1217 construct as template and cloned into the Kpn-I and <t>Xho-I</t> restriction site of pGL3-Basic vector. (C) Promoter activity of all the 5’-deleted promoter constructs was determined by Dual-Luciferase assay. MCF7 cells were transfected with promoter constructs and after 24 h luciferase assay was carried out using Dual-Luciferase assay kit (Promega). Each transfection was conducted in triplicate and the results are represented as mean ± S.E.M.
    Xho I Restriction Enzymes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 338 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i restriction enzymes/product/Thermo Fisher
    Average 99 stars, based on 338 article reviews
    Price from $9.99 to $1999.99
    xho i restriction enzymes - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Millipore nde i xho i
    Identification of PPA1 minimal promoter. (A) Determination of transcription start site of PPA1 gene. Total RNA was isolated from MCF7 cells and analyzed by primer extension analysis using a primer complementary to the -20 to -1 region of exon 1 of PPA1 gene. The sequencing reaction was set using same primer as in primer extension. Both the sequencing reaction products (A, T, G and C) and primer extension product (PE) were run on a 7.5% urea-polyacrylamide gel. (B) Schematic representation of 5’-deletion constructs of PPA1 promoter. All the deletion constructs were generated by <t>PCR</t> using pGL3-1217 construct as template and cloned into the Kpn-I and <t>Xho-I</t> restriction site of pGL3-Basic vector. (C) Promoter activity of all the 5’-deleted promoter constructs was determined by Dual-Luciferase assay. MCF7 cells were transfected with promoter constructs and after 24 h luciferase assay was carried out using Dual-Luciferase assay kit (Promega). Each transfection was conducted in triplicate and the results are represented as mean ± S.E.M.
    Nde I Xho I, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 64 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nde i xho i/product/Millipore
    Average 99 stars, based on 64 article reviews
    Price from $9.99 to $1999.99
    nde i xho i - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Millipore bamh i xho i
    Identification of PPA1 minimal promoter. (A) Determination of transcription start site of PPA1 gene. Total RNA was isolated from MCF7 cells and analyzed by primer extension analysis using a primer complementary to the -20 to -1 region of exon 1 of PPA1 gene. The sequencing reaction was set using same primer as in primer extension. Both the sequencing reaction products (A, T, G and C) and primer extension product (PE) were run on a 7.5% urea-polyacrylamide gel. (B) Schematic representation of 5’-deletion constructs of PPA1 promoter. All the deletion constructs were generated by <t>PCR</t> using pGL3-1217 construct as template and cloned into the Kpn-I and <t>Xho-I</t> restriction site of pGL3-Basic vector. (C) Promoter activity of all the 5’-deleted promoter constructs was determined by Dual-Luciferase assay. MCF7 cells were transfected with promoter constructs and after 24 h luciferase assay was carried out using Dual-Luciferase assay kit (Promega). Each transfection was conducted in triplicate and the results are represented as mean ± S.E.M.
    Bamh I Xho I, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamh i xho i/product/Millipore
    Average 99 stars, based on 39 article reviews
    Price from $9.99 to $1999.99
    bamh i xho i - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    Map of the integrative vector pMAJIIc. Ori , replication origin; ap , neo and kan , ampicillin, neomycin and kanamycin resistance, respectively; amy , amy DNA fragment (106–912) of X . citri ; mCherry , fluorescent protein; araC , the arabinose repressor; pBAD the arabinose promoter. The polylinker region for in-frame ligation of ORFs/genes to the 5’-end of mCherry, which allows the expression of protein fusions having C-terminal mCherry, is composed of unique sites for Nhe I, Nde I, Kpn I, Sal I and Xho I. Not I and Xba I sites, can be used for cloning intended for the expression of proteins carrying N-terminal mCherry fusions. Unique restriction sites are shown in bold letters. The nucleotide sequence of pMAJIIc plasmid was deposited in the GenBank database under the accession number MT119765.

    Journal: PLoS ONE

    Article Title: mCherry fusions enable the subcellular localization of periplasmic and cytoplasmic proteins in Xanthomonas sp.

    doi: 10.1371/journal.pone.0236185

    Figure Lengend Snippet: Map of the integrative vector pMAJIIc. Ori , replication origin; ap , neo and kan , ampicillin, neomycin and kanamycin resistance, respectively; amy , amy DNA fragment (106–912) of X . citri ; mCherry , fluorescent protein; araC , the arabinose repressor; pBAD the arabinose promoter. The polylinker region for in-frame ligation of ORFs/genes to the 5’-end of mCherry, which allows the expression of protein fusions having C-terminal mCherry, is composed of unique sites for Nhe I, Nde I, Kpn I, Sal I and Xho I. Not I and Xba I sites, can be used for cloning intended for the expression of proteins carrying N-terminal mCherry fusions. Unique restriction sites are shown in bold letters. The nucleotide sequence of pMAJIIc plasmid was deposited in the GenBank database under the accession number MT119765.

    Article Snippet: The PCR-amplified fragment was cleaned up by phenol/chloroform extraction and ethanol-precipitation [ ] and then digested with Xho I and Not I (New England Biolabs).

    Techniques: Plasmid Preparation, Ligation, Expressing, Clone Assay, Sequencing

    Construction of the knockdown vector pCB309-PFUFT. The FSH1 cDNA was ligated into pUC-PUT after DNA digestion by Xho I and Hin dIII to construct plasmid pUC-PFUFT. The two plasmids, pUC-PFUFT and pCB309 were digested by Spe I and Sac I and ligated with T4 DNA ligase to construct the final FSH1 double stranded RNA interference plasmid pCB309-PFUFT. FSH1, family of serine hydrolases 1.

    Journal: International Journal of Molecular Medicine

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis

    doi: 10.3892/ijmm.2019.4355

    Figure Lengend Snippet: Construction of the knockdown vector pCB309-PFUFT. The FSH1 cDNA was ligated into pUC-PUT after DNA digestion by Xho I and Hin dIII to construct plasmid pUC-PFUFT. The two plasmids, pUC-PFUFT and pCB309 were digested by Spe I and Sac I and ligated with T4 DNA ligase to construct the final FSH1 double stranded RNA interference plasmid pCB309-PFUFT. FSH1, family of serine hydrolases 1.

    Article Snippet: First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

    Techniques: Plasmid Preparation, Construct

    Generation of IL23R-CHR protein. A, Restriction sites are indicated in bold, the translated amino acid and Trx-6×His-DDDDKA tag are shown in the box; B, IL23R-CHR gene from human spleen cDNA library amplified by PCR; C, One pET32a/IL23R-CHR clone digested with NcoI and XhoI and analyzed by agrose gel electrophoresis (1%). MW = molecular weight markers, bp. D, Trx-IL23R-CHR induced by IPTG in E.Coli BL21 (DE3), SDS-PAGE (15%), protein bands were stained with coomassie brilliant blue R250 reagent. Lane 2, uninduced bacterial lysate; Lane 3, IPTG induced bacterial lysate. E, Trx-IL23R-CHR purified from BL21 (DE3) lysate and cleaved by enterokinase, Lane 5, purified Trx-IL23R-CHR; Lane 6, purified IL23R-CHR. F, Western blot using mouse mAbs against human IL23R (Lane 8). Lane 1, 4 and 7 in D, E, F: molecular weight markers, KD.

    Journal: PLoS ONE

    Article Title: Protection against Th17 Cells Differentiation by an Interleukin-23 Receptor Cytokine-Binding Homology Region

    doi: 10.1371/journal.pone.0045625

    Figure Lengend Snippet: Generation of IL23R-CHR protein. A, Restriction sites are indicated in bold, the translated amino acid and Trx-6×His-DDDDKA tag are shown in the box; B, IL23R-CHR gene from human spleen cDNA library amplified by PCR; C, One pET32a/IL23R-CHR clone digested with NcoI and XhoI and analyzed by agrose gel electrophoresis (1%). MW = molecular weight markers, bp. D, Trx-IL23R-CHR induced by IPTG in E.Coli BL21 (DE3), SDS-PAGE (15%), protein bands were stained with coomassie brilliant blue R250 reagent. Lane 2, uninduced bacterial lysate; Lane 3, IPTG induced bacterial lysate. E, Trx-IL23R-CHR purified from BL21 (DE3) lysate and cleaved by enterokinase, Lane 5, purified Trx-IL23R-CHR; Lane 6, purified IL23R-CHR. F, Western blot using mouse mAbs against human IL23R (Lane 8). Lane 1, 4 and 7 in D, E, F: molecular weight markers, KD.

    Article Snippet: After purification with Tianquick midi purification kit (Tiangen, China), the IL23R-CHR gene was digested with NcoI and XhoI (takara) and inserted into pET32a following the manufacturer’s instructions (Novagen, Germany).

    Techniques: cDNA Library Assay, Amplification, Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Molecular Weight, SDS Page, Staining, Purification, Western Blot

    Identification of recombinant pEGFP-KDR-TK by restriction enzyme digestion ( Sal I/ Xho I) and electrophoresis. Lane 1: DNA markers (λDNA/ Hin dIII); Lane 2-5: pEGFP-KDR-TK was digested with Sal I/ Xho I.

    Journal:

    Article Title: Expression of thymidine kinase mediated by a novel non-viral delivery system under the control of vascular endothelial growth factor receptor 2 promoter selectively kills human umbilical vein endothelial cells

    doi: 10.3748/wjg.14.224

    Figure Lengend Snippet: Identification of recombinant pEGFP-KDR-TK by restriction enzyme digestion ( Sal I/ Xho I) and electrophoresis. Lane 1: DNA markers (λDNA/ Hin dIII); Lane 2-5: pEGFP-KDR-TK was digested with Sal I/ Xho I.

    Article Snippet: The 2.2-kb KDR-TK fragment was extracted from pBluescript II KDR-TK by a double digestion with Xho I and Sal I (Takara Biotechnology Co.,Ltd, Dalian, China) and identified by electrophoresis and DNA sequencing.

    Techniques: Recombinant, Electrophoresis

    Cloning of the Ad12 fiber knob and the extracellular domains of human CAR. (a) The Ad12 knob domain (line) begins at a conserved Thr-Leu-Trp-Thr motif (amino acids 409 to 412) and extends to the fiber protein carboxy terminus (Glu587). A fragment of Ad12 DNA encoding the entire knob domain and several amino acids from the preceding fiber shaft region (striped box) beginning at Ser401 was amplified by PCR using forward primer 1 and reverse primer 2. The resulting PCR product was cloned between the Nde I and Bam HI sites of pET15b. (b) The human CAR protein consists of an amino-terminal signal peptide (open box), two extracellular Ig-related domains (D1 and D2), a membrane-spanning region (TM), and a cytoplasmic domain (CYT). cDNA fragments encoding D1 and D1/D2 were amplified by PCR using forward primer 3 and reverse primers 4 and 5. The resulting PCR products were cloned between the Nco I and Xho I sites of pET20b. Similar D1- and D1/D2-encoding cDNA fragments were amplified by PCR using forward primer 6 and reverse primers 7 and 8. The resulting PCR products were cloned between the Nde I and Bam HI sites of pET15b. (c) pET vectors for protein expression in E. coli . The open and filled boxes represent bacterial signal peptides and hexahistidine tags, respectively. The restriction sites used in this study are shown, and the sequence of the pET15b-encoded 22-amino-acid carboxy-terminal extension of sD1 is given in single-letter code.

    Journal: Journal of Virology

    Article Title: Coxsackievirus and Adenovirus Receptor Amino-Terminal Immunoglobulin V-Related Domain Binds Adenovirus Type 2 and Fiber Knob from Adenovirus Type 12

    doi:

    Figure Lengend Snippet: Cloning of the Ad12 fiber knob and the extracellular domains of human CAR. (a) The Ad12 knob domain (line) begins at a conserved Thr-Leu-Trp-Thr motif (amino acids 409 to 412) and extends to the fiber protein carboxy terminus (Glu587). A fragment of Ad12 DNA encoding the entire knob domain and several amino acids from the preceding fiber shaft region (striped box) beginning at Ser401 was amplified by PCR using forward primer 1 and reverse primer 2. The resulting PCR product was cloned between the Nde I and Bam HI sites of pET15b. (b) The human CAR protein consists of an amino-terminal signal peptide (open box), two extracellular Ig-related domains (D1 and D2), a membrane-spanning region (TM), and a cytoplasmic domain (CYT). cDNA fragments encoding D1 and D1/D2 were amplified by PCR using forward primer 3 and reverse primers 4 and 5. The resulting PCR products were cloned between the Nco I and Xho I sites of pET20b. Similar D1- and D1/D2-encoding cDNA fragments were amplified by PCR using forward primer 6 and reverse primers 7 and 8. The resulting PCR products were cloned between the Nde I and Bam HI sites of pET15b. (c) pET vectors for protein expression in E. coli . The open and filled boxes represent bacterial signal peptides and hexahistidine tags, respectively. The restriction sites used in this study are shown, and the sequence of the pET15b-encoded 22-amino-acid carboxy-terminal extension of sD1 is given in single-letter code.

    Article Snippet: Primers 3 through 5 (CCATGGGTATCACTACTCCTGAAGAGA, CTCGAGCGCACCTGAAGGCTTA, and CTCGAGTGAAGGAGGGACAAC, respectively [Fig. b]) were designed for cloning D1- and D1/D2-encoding PCR products between the Nco I and Xho I sites of expression vector pET20b (Novagen).

    Techniques: Clone Assay, Amplification, Polymerase Chain Reaction, Positron Emission Tomography, Expressing, Sequencing

    Construction and cloning of HA1 protein. (A) Digestion of pUC57 vector containing HA1 gene by enzymes BamHI and XhoI. M: Molecular marker. Lanes 1 and 2: Digested plasmid and HA1 gene. (B) Digestion of pET28a-HA1 vector by enzymes BamHI and XhoI. M: Molecular marker. Lane 1: Digested pET and HA1 gene. (C) PCR analysis for detection of HA1 gene in transformed E. coli clonies contained pET28a-HA1 construct by HA1 specific primers. M: Molecular marker. Lane 1: Positive control, Lane 2: Transformed bacterial clony (The 329 bp band was clear), and Lane 3: Negative control

    Journal: Iranian Journal of Veterinary Research

    Article Title: Expression of HA1 antigen of H5N1 influenza virus as a potent candidate for vaccine in bacterial system

    doi:

    Figure Lengend Snippet: Construction and cloning of HA1 protein. (A) Digestion of pUC57 vector containing HA1 gene by enzymes BamHI and XhoI. M: Molecular marker. Lanes 1 and 2: Digested plasmid and HA1 gene. (B) Digestion of pET28a-HA1 vector by enzymes BamHI and XhoI. M: Molecular marker. Lane 1: Digested pET and HA1 gene. (C) PCR analysis for detection of HA1 gene in transformed E. coli clonies contained pET28a-HA1 construct by HA1 specific primers. M: Molecular marker. Lane 1: Positive control, Lane 2: Transformed bacterial clony (The 329 bp band was clear), and Lane 3: Negative control

    Article Snippet: The synthesized sequence was removed from the pUC57 vector by digestion with BamHI and XhoI and then inserted into the linearized pET28a (+) expression vector (Novagen, USA) using T4 DNA ligase (Fermentas, USA), yielding pET28a-HA1 vector.

    Techniques: Clone Assay, Plasmid Preparation, Marker, Positron Emission Tomography, Polymerase Chain Reaction, Transformation Assay, Construct, Positive Control, Negative Control

    An abnormal T-DNA integration in KLP-7 . (A) Hygromycin phosphotransferase ( hph ) gene insertion in BCM-29. The expected PCR product size is 1.1 kb. Lane 1, Ladder of 10 kb; lane 2, WT, lane 3, BCM-29, lane 4, positive control (PC) ( hph ) ( B) . Southern hybridization showing the integration of 4.1 kb fragment of hph gene in genome of BCM 29. Total genomic DNA was digested with Xho I and probed with the hph probe; ( C) Schematic presentation integration of T-DNA in BCM 29. Specific primers were used for the confirmation of T-DNA insertion shown by arrows. The T-DNA insertion point is 116 bp from KLP-7 start codon ( D) Insertion of T-DNA in B. cinerea genome. Junction site are shown in bold letters.

    Journal: Scientific Reports

    Article Title: A Botrytis cinerea KLP-7 Kinesin acts as a Virulence Determinant during Plant Infection

    doi: 10.1038/s41598-017-09409-5

    Figure Lengend Snippet: An abnormal T-DNA integration in KLP-7 . (A) Hygromycin phosphotransferase ( hph ) gene insertion in BCM-29. The expected PCR product size is 1.1 kb. Lane 1, Ladder of 10 kb; lane 2, WT, lane 3, BCM-29, lane 4, positive control (PC) ( hph ) ( B) . Southern hybridization showing the integration of 4.1 kb fragment of hph gene in genome of BCM 29. Total genomic DNA was digested with Xho I and probed with the hph probe; ( C) Schematic presentation integration of T-DNA in BCM 29. Specific primers were used for the confirmation of T-DNA insertion shown by arrows. The T-DNA insertion point is 116 bp from KLP-7 start codon ( D) Insertion of T-DNA in B. cinerea genome. Junction site are shown in bold letters.

    Article Snippet: For this purpose, genomic DNA (20 µg) was first digested with Xho I, the fragments were separated on 0.8% agarose gel for 8 h and then transferred to a nylon membrane (Millipore, USA).

    Techniques: Polymerase Chain Reaction, Positive Control, Hybridization

    Identification and expression of plasmid pEGFP-N1-MeCP2. (A) The pEGFP-N1-MeCP2 plasmid was identified by digestion with Pst I and Xho I. M: Marker. (B) The EGFP-MeCP2 fusion protein was detected by western blot using anti-EGFP antibody. 1: EGFP-SH-SY5Y cells (SH-SY5Y cells transfected with pEGFP-N1); 2: O-MeCP2-SH-SY5Y cells (SH-SY5Y cells transfected with pEGFP-N1-MeCP2). MeCP2: X-linked methyl-CpG binding protein 2.

    Journal: Neural Regeneration Research

    Article Title: Is X-linked methyl-CpG binding protein 2 a new target for the treatment of Parkinson's disease

    doi: 10.3969/j.issn.1673-5374.2013.21.003

    Figure Lengend Snippet: Identification and expression of plasmid pEGFP-N1-MeCP2. (A) The pEGFP-N1-MeCP2 plasmid was identified by digestion with Pst I and Xho I. M: Marker. (B) The EGFP-MeCP2 fusion protein was detected by western blot using anti-EGFP antibody. 1: EGFP-SH-SY5Y cells (SH-SY5Y cells transfected with pEGFP-N1); 2: O-MeCP2-SH-SY5Y cells (SH-SY5Y cells transfected with pEGFP-N1-MeCP2). MeCP2: X-linked methyl-CpG binding protein 2.

    Article Snippet: Pst I and Xho I (Promega, Madison, WI, USA) restriction sites were included in the primers (underlined) to facilitate the ligation of cDNA products into pEGFP-N1 vector (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China).

    Techniques: Expressing, Plasmid Preparation, Marker, Western Blot, Transfection, Binding Assay

    Organization of the dystroglycan gene and position of the floxed Neo cassette. a Schematic representation of the Dag1 +/+ allele, the targeting vector, the Dag1 allele after incomplete homologous recombination ( Dag1 Neo ) and the neo-deleted allele ( Dag1 ΔNeo ). The 5′ arm of the construct consisted of a 3.2 kb fragment amplified from the Dag1 intron. The 3′ arm was 4 kb in length and consisted of the exon 3′ region, harbouring four mutations (red asterisks) hitting the α/β-DG interface, and flanked by intronic sequences and the 3′-UTR, respectively. A Xho I (X) site in the 5′ arm was mutated for cloning purposes. The floxed neomycin cassette (Neo) and the Herpes simplex thymidine kinase (TK) acted as positive and negative selection markers, respectively. Selected restriction enzyme cleavage sites are indicated above the gene (B: Bam HI; H: Hin dIII and X: Xho I). Primers used for genotyping are also indicated as black arrows. b A representative PCR genotyping analysis of the Dag1 Neo/ + mouse. The PCR product was amplified from genomic DNA using primers spanning the Neo cassette region

    Journal: BMC Research Notes

    Article Title: Evaluation of the effect of a floxed Neo cassette within the dystroglycan (Dag1) gene

    doi: 10.1186/s13104-017-2926-9

    Figure Lengend Snippet: Organization of the dystroglycan gene and position of the floxed Neo cassette. a Schematic representation of the Dag1 +/+ allele, the targeting vector, the Dag1 allele after incomplete homologous recombination ( Dag1 Neo ) and the neo-deleted allele ( Dag1 ΔNeo ). The 5′ arm of the construct consisted of a 3.2 kb fragment amplified from the Dag1 intron. The 3′ arm was 4 kb in length and consisted of the exon 3′ region, harbouring four mutations (red asterisks) hitting the α/β-DG interface, and flanked by intronic sequences and the 3′-UTR, respectively. A Xho I (X) site in the 5′ arm was mutated for cloning purposes. The floxed neomycin cassette (Neo) and the Herpes simplex thymidine kinase (TK) acted as positive and negative selection markers, respectively. Selected restriction enzyme cleavage sites are indicated above the gene (B: Bam HI; H: Hin dIII and X: Xho I). Primers used for genotyping are also indicated as black arrows. b A representative PCR genotyping analysis of the Dag1 Neo/ + mouse. The PCR product was amplified from genomic DNA using primers spanning the Neo cassette region

    Article Snippet: To allow the linearization of the targeting vector that is necessary for the recombination and integration of the construct into the ES cells genome, site-directed mutagenesis was used to mutate a Xho I site in the 5′ arm using the QuikChange site-directed mutagenesis kit (Stratagene® ) and the following primers: forward 5′-AGTTCCTTCCTGCCT A GAGTGGGTGTTCCCT-3′ and reverse 5′-AGGGAACACCCACTC T AGGCAGGAAGGAACT-3′ (mutated nucleotides in bold).

    Techniques: Plasmid Preparation, Homologous Recombination, Construct, Amplification, Clone Assay, Selection, Polymerase Chain Reaction

    Identification of PPA1 minimal promoter. (A) Determination of transcription start site of PPA1 gene. Total RNA was isolated from MCF7 cells and analyzed by primer extension analysis using a primer complementary to the -20 to -1 region of exon 1 of PPA1 gene. The sequencing reaction was set using same primer as in primer extension. Both the sequencing reaction products (A, T, G and C) and primer extension product (PE) were run on a 7.5% urea-polyacrylamide gel. (B) Schematic representation of 5’-deletion constructs of PPA1 promoter. All the deletion constructs were generated by PCR using pGL3-1217 construct as template and cloned into the Kpn-I and Xho-I restriction site of pGL3-Basic vector. (C) Promoter activity of all the 5’-deleted promoter constructs was determined by Dual-Luciferase assay. MCF7 cells were transfected with promoter constructs and after 24 h luciferase assay was carried out using Dual-Luciferase assay kit (Promega). Each transfection was conducted in triplicate and the results are represented as mean ± S.E.M.

    Journal: PLoS ONE

    Article Title: Identification of Critical Elements for Regulation of Inorganic Pyrophosphatase (PPA1) in MCF7 Breast Cancer Cells

    doi: 10.1371/journal.pone.0124864

    Figure Lengend Snippet: Identification of PPA1 minimal promoter. (A) Determination of transcription start site of PPA1 gene. Total RNA was isolated from MCF7 cells and analyzed by primer extension analysis using a primer complementary to the -20 to -1 region of exon 1 of PPA1 gene. The sequencing reaction was set using same primer as in primer extension. Both the sequencing reaction products (A, T, G and C) and primer extension product (PE) were run on a 7.5% urea-polyacrylamide gel. (B) Schematic representation of 5’-deletion constructs of PPA1 promoter. All the deletion constructs were generated by PCR using pGL3-1217 construct as template and cloned into the Kpn-I and Xho-I restriction site of pGL3-Basic vector. (C) Promoter activity of all the 5’-deleted promoter constructs was determined by Dual-Luciferase assay. MCF7 cells were transfected with promoter constructs and after 24 h luciferase assay was carried out using Dual-Luciferase assay kit (Promega). Each transfection was conducted in triplicate and the results are represented as mean ± S.E.M.

    Article Snippet: Both PCR product and pGL3-basic vector were digested with Kpn-I and Xho-I restriction enzymes (Fermentas).

    Techniques: Isolation, Sequencing, Construct, Generated, Polymerase Chain Reaction, Clone Assay, Plasmid Preparation, Activity Assay, Luciferase, Transfection