xho i Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs xho i
    Structure of the <t>DNA</t> molecules used in this study. A . Structure of the parent c-DNA. B . l-DNA formed by restriction digest of c-DNA with the enzyme Xho I. The size of the linearized plasmid was 4272 bp, C . pcr-DNA (2209 bp) generated by site-specific primers that amplified the region of the c-DNA containing the HTLV promoter, the hOPG open reading frame, and the SV40 Poly-A site. D . Structure of the parent c-DNA used in transfection. E . l-DNA formed by digest of pEGFP-N2 with the enzyme Cla I, which cuts in the vector backbone. F . pcr-DNA (1713 bp) generated by primers that are complementary to the sequence upstream of the CMV promoter and downstream of the polyA site.
    Xho I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3877 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/New England Biolabs
    Average 99 stars, based on 3877 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher xho i
    (A) Digestion of pTY-α-amylase with <t>Nhe</t> I and <t>Xho</t> I restriction enzymes. Lane 1: pTYB2 digested with Nhe I and Xho I; lane2: pTY-α-amylase digested with Nhe I and Xho I; lane 3: PCR product of α-amylase. (B) SDS-PAGE analysis of α-amylase expression. Lane 1: before IPTG induction; lane 2: after IPTG induction; lane 3: 16 hours after IPTG induction; lane 4: 20 hours after IPTG induction. (C) Western blot analysis of α-amylase with anti-intein polyclonal antibody. Lane1: α-amylase; lane 2: lysate of untransformed bacteria. IPTG = isopropyl- β-d-thiogalactopyranoside; M = molecular marker; SDS-PAGE = sodium dodecyl sulfate polyacrylamide gel electrophoresis.
    Xho I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 4046 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/Thermo Fisher
    Average 99 stars, based on 4046 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    TaKaRa xho i
    Detection of tracts of <t>DNA</t> repair synthesis during gap-directed MMR in NPE. Covalently closed (lanes 1–3), A-strand-gap-carrying (lanes 4–6) or C-strand-gap-carrying pMM1 AC (lanes 7–9) was incubated in NPE, and sampled at the indicated times. DNA was purified and digested with Xmn I and either Bam HI (upper, A to G repair) or <t>Xho</t> I (middle, C to T repair). To analyze the incorporation of radioactivity, DNA was digested with Drd I (bottom). α-[ 32 P]-dCTP was preferentially incorporated into the 1 kb fragment corresponding to the shorter path between the gap and the mismatch in both 5’-gap- and 3’-gap-directed MMR. DOI: http://dx.doi.org/10.7554/eLife.15155.005
    Xho I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 3469 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/TaKaRa
    Average 99 stars, based on 3469 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Millipore xho i
    Schematic representation of the expression vector, pET32a-mBD2. The cDNA for mature mBD2 were amplified using <t>PCR</t> from the pcDNA3.1(+)-mBD2 plasmid. PCR product was cleaved by <t>Xho</t> I and Kpn I, and the mBD2 fragment was inserted into similarly digested pET32a(+) vector to construct the expression vector, pET32a-mBD2.
    Xho I, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 12345 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/Millipore
    Average 99 stars, based on 12345 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    87
    Fisher Scientific xho i
    Schematic representation of the expression vector, pET32a-mBD2. The cDNA for mature mBD2 were amplified using <t>PCR</t> from the pcDNA3.1(+)-mBD2 plasmid. PCR product was cleaved by <t>Xho</t> I and Kpn I, and the mBD2 fragment was inserted into similarly digested pET32a(+) vector to construct the expression vector, pET32a-mBD2.
    Xho I, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 87/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/Fisher Scientific
    Average 87 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    97
    Promega xho i
    Identification and expression of plasmid pEGFP-N1-MeCP2. (A) The pEGFP-N1-MeCP2 plasmid was identified by digestion with Pst I and <t>Xho</t> I. M: Marker. (B) The EGFP-MeCP2 fusion protein was detected by western blot using anti-EGFP antibody. 1: EGFP-SH-SY5Y cells (SH-SY5Y cells transfected with pEGFP-N1); 2: O-MeCP2-SH-SY5Y cells (SH-SY5Y cells transfected with pEGFP-N1-MeCP2). MeCP2: X-linked methyl-CpG binding protein 2.
    Xho I, supplied by Promega, used in various techniques. Bioz Stars score: 97/100, based on 3039 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/Promega
    Average 97 stars, based on 3039 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-04
    97/100 stars
      Buy from Supplier

    93
    Toyobo xho i
    Identification and expression of plasmid pEGFP-N1-MeCP2. (A) The pEGFP-N1-MeCP2 plasmid was identified by digestion with Pst I and <t>Xho</t> I. M: Marker. (B) The EGFP-MeCP2 fusion protein was detected by western blot using anti-EGFP antibody. 1: EGFP-SH-SY5Y cells (SH-SY5Y cells transfected with pEGFP-N1); 2: O-MeCP2-SH-SY5Y cells (SH-SY5Y cells transfected with pEGFP-N1-MeCP2). MeCP2: X-linked methyl-CpG binding protein 2.
    Xho I, supplied by Toyobo, used in various techniques. Bioz Stars score: 93/100, based on 77 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/Toyobo
    Average 93 stars, based on 77 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    xho i  (Roche)
    93
    Roche xho i
    Restriction profiles obtained after <t>Acs</t> I (A) and <t>Xho</t> I (B) digestion of a portion of the citrate synthase gene amplified from 10 tick-borne ehrlichial species by PCR using consensus primers EHR-CS136F–EHR-CS778R. Lanes: M, molecular weight markers (in thousands); 1, HGE agent; 2, E. equi ; 3, E. phagocytophila ; 4, A. marginale ; 5, A. centrale ; 6, E. canis ; 7, E. chaffeensis ; 8, E. muris ; 9, Ehrlichia sp. detected in I. ovatus ; 10, C. ruminantium .
    Xho I, supplied by Roche, used in various techniques. Bioz Stars score: 93/100, based on 275 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/Roche
    Average 93 stars, based on 275 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    93
    Stratagene xho i
    Size of cDNA synthesised from mRNA isolated from protoscoleces of E. granulosus . After the second-strand cDNA was synthesised by adding 2μl of [α-32P] dATP to the reaction, the cDNA was fractioned through a CL-2B column after being linked with EcoR I adapters and digested with <t>Xho</t> I to create an Xho I cut end. Fractions 5 to 11 (1μl of elution) were run on an agarose gel and exposed for 4 h to an X-ray film before being developed. Standard RNA markers, in nucleotides are shown on the left hand of the figure.
    Xho I, supplied by Stratagene, used in various techniques. Bioz Stars score: 93/100, based on 896 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/Stratagene
    Average 93 stars, based on 896 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    94
    Addgene inc xho i
    Size of cDNA synthesised from mRNA isolated from protoscoleces of E. granulosus . After the second-strand cDNA was synthesised by adding 2μl of [α-32P] dATP to the reaction, the cDNA was fractioned through a CL-2B column after being linked with EcoR I adapters and digested with <t>Xho</t> I to create an Xho I cut end. Fractions 5 to 11 (1μl of elution) were run on an agarose gel and exposed for 4 h to an X-ray film before being developed. Standard RNA markers, in nucleotides are shown on the left hand of the figure.
    Xho I, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 232 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/Addgene inc
    Average 94 stars, based on 232 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    94
    GE Healthcare xho i
    Genomic RFLP analysis using different restriction enzymes and 3 RAPD markers unassigned by in silico analysis. The hybridization patterns were revealed by the different probes, A: LEM536/320/OPAY8, B: LEM496/300/OPAD17 and C: M106/200/OPAY9. Tested isolates correspond to L. major (FMH; L. maj ), L. archibaldi (GEBRE; L. arch ), L. donovani (HU3; L. don ), L. tropica (DBKM; L. tro ) and L. infantum (LEM1163; L. inf ). <t>EcoR</t> I, Pst I , Hind III, <t>Xho</t> I on top of the panel indicate the restriction enzyme used to digest the total Leishmania DNAs.
    Xho I, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 94/100, based on 703 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/GE Healthcare
    Average 94 stars, based on 703 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    86
    Boehringer Mannheim xho i
    PFGE profiles of genomic DNAs West Lothian, Highland, and central Scotland outbreak isolates cleaved with <t>Xba</t> I (lanes 2 to 4), <t>Xho</t> I (lanes 5 to 7), Not I (lanes 8 to 10), and Sfi I (lanes 11 to 13). Lanes 1 and 14, bacteriophage lambda concatemer size markers. The unnumbered lanes correspond to lanes 1 to 14 from left to right, respectively.
    Xho I, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 86/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/Boehringer Mannheim
    Average 86 stars, based on 66 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    93
    Thermo Fisher fastdigest xho i
    PFGE profiles of genomic DNAs West Lothian, Highland, and central Scotland outbreak isolates cleaved with <t>Xba</t> I (lanes 2 to 4), <t>Xho</t> I (lanes 5 to 7), Not I (lanes 8 to 10), and Sfi I (lanes 11 to 13). Lanes 1 and 14, bacteriophage lambda concatemer size markers. The unnumbered lanes correspond to lanes 1 to 14 from left to right, respectively.
    Fastdigest Xho I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fastdigest xho i/product/Thermo Fisher
    Average 93 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    fastdigest xho i - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    93
    Stratagene xho i site
    Organization of the dystroglycan gene and position of the floxed Neo cassette. a Schematic representation of the Dag1 +/+ allele, the targeting vector, the Dag1 allele after incomplete homologous recombination ( Dag1 Neo ) and the neo-deleted allele ( Dag1 ΔNeo ). The 5′ arm of the construct consisted of a 3.2 kb fragment amplified from the Dag1 intron. The 3′ arm was 4 kb in length and consisted of the exon 3′ region, harbouring four mutations (red asterisks) hitting the α/β-DG interface, and flanked by intronic sequences and the 3′-UTR, respectively. A <t>Xho</t> I (X) site in the 5′ arm was mutated for cloning purposes. The floxed neomycin cassette (Neo) and the Herpes simplex thymidine kinase (TK) acted as positive and negative selection markers, respectively. Selected restriction enzyme cleavage sites are indicated above the gene (B: Bam HI; H: Hin dIII and X: Xho I). Primers used for genotyping are also indicated as black arrows. b A representative PCR genotyping analysis of the Dag1 Neo/ + mouse. The PCR product was amplified from genomic DNA using primers spanning the Neo cassette region
    Xho I Site, supplied by Stratagene, used in various techniques. Bioz Stars score: 93/100, based on 375 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i site/product/Stratagene
    Average 93 stars, based on 375 article reviews
    Price from $9.99 to $1999.99
    xho i site - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    82
    Roche endonuclease xho i
    Organization of the dystroglycan gene and position of the floxed Neo cassette. a Schematic representation of the Dag1 +/+ allele, the targeting vector, the Dag1 allele after incomplete homologous recombination ( Dag1 Neo ) and the neo-deleted allele ( Dag1 ΔNeo ). The 5′ arm of the construct consisted of a 3.2 kb fragment amplified from the Dag1 intron. The 3′ arm was 4 kb in length and consisted of the exon 3′ region, harbouring four mutations (red asterisks) hitting the α/β-DG interface, and flanked by intronic sequences and the 3′-UTR, respectively. A <t>Xho</t> I (X) site in the 5′ arm was mutated for cloning purposes. The floxed neomycin cassette (Neo) and the Herpes simplex thymidine kinase (TK) acted as positive and negative selection markers, respectively. Selected restriction enzyme cleavage sites are indicated above the gene (B: Bam HI; H: Hin dIII and X: Xho I). Primers used for genotyping are also indicated as black arrows. b A representative PCR genotyping analysis of the Dag1 Neo/ + mouse. The PCR product was amplified from genomic DNA using primers spanning the Neo cassette region
    Endonuclease Xho I, supplied by Roche, used in various techniques. Bioz Stars score: 82/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/endonuclease xho i/product/Roche
    Average 82 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    endonuclease xho i - by Bioz Stars, 2020-04
    82/100 stars
      Buy from Supplier

    92
    Thermo Fisher bamh i xho i
    Organization of the dystroglycan gene and position of the floxed Neo cassette. a Schematic representation of the Dag1 +/+ allele, the targeting vector, the Dag1 allele after incomplete homologous recombination ( Dag1 Neo ) and the neo-deleted allele ( Dag1 ΔNeo ). The 5′ arm of the construct consisted of a 3.2 kb fragment amplified from the Dag1 intron. The 3′ arm was 4 kb in length and consisted of the exon 3′ region, harbouring four mutations (red asterisks) hitting the α/β-DG interface, and flanked by intronic sequences and the 3′-UTR, respectively. A <t>Xho</t> I (X) site in the 5′ arm was mutated for cloning purposes. The floxed neomycin cassette (Neo) and the Herpes simplex thymidine kinase (TK) acted as positive and negative selection markers, respectively. Selected restriction enzyme cleavage sites are indicated above the gene (B: Bam HI; H: Hin dIII and X: Xho I). Primers used for genotyping are also indicated as black arrows. b A representative PCR genotyping analysis of the Dag1 Neo/ + mouse. The PCR product was amplified from genomic DNA using primers spanning the Neo cassette region
    Bamh I Xho I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamh i xho i/product/Thermo Fisher
    Average 92 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    bamh i xho i - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    88
    Millipore xho i digested pet28a
    Organization of the dystroglycan gene and position of the floxed Neo cassette. a Schematic representation of the Dag1 +/+ allele, the targeting vector, the Dag1 allele after incomplete homologous recombination ( Dag1 Neo ) and the neo-deleted allele ( Dag1 ΔNeo ). The 5′ arm of the construct consisted of a 3.2 kb fragment amplified from the Dag1 intron. The 3′ arm was 4 kb in length and consisted of the exon 3′ region, harbouring four mutations (red asterisks) hitting the α/β-DG interface, and flanked by intronic sequences and the 3′-UTR, respectively. A <t>Xho</t> I (X) site in the 5′ arm was mutated for cloning purposes. The floxed neomycin cassette (Neo) and the Herpes simplex thymidine kinase (TK) acted as positive and negative selection markers, respectively. Selected restriction enzyme cleavage sites are indicated above the gene (B: Bam HI; H: Hin dIII and X: Xho I). Primers used for genotyping are also indicated as black arrows. b A representative PCR genotyping analysis of the Dag1 Neo/ + mouse. The PCR product was amplified from genomic DNA using primers spanning the Neo cassette region
    Xho I Digested Pet28a, supplied by Millipore, used in various techniques. Bioz Stars score: 88/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i digested pet28a/product/Millipore
    Average 88 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    xho i digested pet28a - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    99
    Millipore bamhi xho i
    Organization of the dystroglycan gene and position of the floxed Neo cassette. a Schematic representation of the Dag1 +/+ allele, the targeting vector, the Dag1 allele after incomplete homologous recombination ( Dag1 Neo ) and the neo-deleted allele ( Dag1 ΔNeo ). The 5′ arm of the construct consisted of a 3.2 kb fragment amplified from the Dag1 intron. The 3′ arm was 4 kb in length and consisted of the exon 3′ region, harbouring four mutations (red asterisks) hitting the α/β-DG interface, and flanked by intronic sequences and the 3′-UTR, respectively. A <t>Xho</t> I (X) site in the 5′ arm was mutated for cloning purposes. The floxed neomycin cassette (Neo) and the Herpes simplex thymidine kinase (TK) acted as positive and negative selection markers, respectively. Selected restriction enzyme cleavage sites are indicated above the gene (B: Bam HI; H: Hin dIII and X: Xho I). Primers used for genotyping are also indicated as black arrows. b A representative PCR genotyping analysis of the Dag1 Neo/ + mouse. The PCR product was amplified from genomic DNA using primers spanning the Neo cassette region
    Bamhi Xho I, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi xho i/product/Millipore
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    bamhi xho i - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    87
    Thermo Fisher xho i cla i
    Organization of the dystroglycan gene and position of the floxed Neo cassette. a Schematic representation of the Dag1 +/+ allele, the targeting vector, the Dag1 allele after incomplete homologous recombination ( Dag1 Neo ) and the neo-deleted allele ( Dag1 ΔNeo ). The 5′ arm of the construct consisted of a 3.2 kb fragment amplified from the Dag1 intron. The 3′ arm was 4 kb in length and consisted of the exon 3′ region, harbouring four mutations (red asterisks) hitting the α/β-DG interface, and flanked by intronic sequences and the 3′-UTR, respectively. A <t>Xho</t> I (X) site in the 5′ arm was mutated for cloning purposes. The floxed neomycin cassette (Neo) and the Herpes simplex thymidine kinase (TK) acted as positive and negative selection markers, respectively. Selected restriction enzyme cleavage sites are indicated above the gene (B: Bam HI; H: Hin dIII and X: Xho I). Primers used for genotyping are also indicated as black arrows. b A representative PCR genotyping analysis of the Dag1 Neo/ + mouse. The PCR product was amplified from genomic DNA using primers spanning the Neo cassette region
    Xho I Cla I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i cla i/product/Thermo Fisher
    Average 87 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    xho i cla i - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    82
    Stratagene xho i digested pbluescript
    Organization of the dystroglycan gene and position of the floxed Neo cassette. a Schematic representation of the Dag1 +/+ allele, the targeting vector, the Dag1 allele after incomplete homologous recombination ( Dag1 Neo ) and the neo-deleted allele ( Dag1 ΔNeo ). The 5′ arm of the construct consisted of a 3.2 kb fragment amplified from the Dag1 intron. The 3′ arm was 4 kb in length and consisted of the exon 3′ region, harbouring four mutations (red asterisks) hitting the α/β-DG interface, and flanked by intronic sequences and the 3′-UTR, respectively. A <t>Xho</t> I (X) site in the 5′ arm was mutated for cloning purposes. The floxed neomycin cassette (Neo) and the Herpes simplex thymidine kinase (TK) acted as positive and negative selection markers, respectively. Selected restriction enzyme cleavage sites are indicated above the gene (B: Bam HI; H: Hin dIII and X: Xho I). Primers used for genotyping are also indicated as black arrows. b A representative PCR genotyping analysis of the Dag1 Neo/ + mouse. The PCR product was amplified from genomic DNA using primers spanning the Neo cassette region
    Xho I Digested Pbluescript, supplied by Stratagene, used in various techniques. Bioz Stars score: 82/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i digested pbluescript/product/Stratagene
    Average 82 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    xho i digested pbluescript - by Bioz Stars, 2020-04
    82/100 stars
      Buy from Supplier

    94
    Millipore xho i digested pet21b
    Organization of the dystroglycan gene and position of the floxed Neo cassette. a Schematic representation of the Dag1 +/+ allele, the targeting vector, the Dag1 allele after incomplete homologous recombination ( Dag1 Neo ) and the neo-deleted allele ( Dag1 ΔNeo ). The 5′ arm of the construct consisted of a 3.2 kb fragment amplified from the Dag1 intron. The 3′ arm was 4 kb in length and consisted of the exon 3′ region, harbouring four mutations (red asterisks) hitting the α/β-DG interface, and flanked by intronic sequences and the 3′-UTR, respectively. A <t>Xho</t> I (X) site in the 5′ arm was mutated for cloning purposes. The floxed neomycin cassette (Neo) and the Herpes simplex thymidine kinase (TK) acted as positive and negative selection markers, respectively. Selected restriction enzyme cleavage sites are indicated above the gene (B: Bam HI; H: Hin dIII and X: Xho I). Primers used for genotyping are also indicated as black arrows. b A representative PCR genotyping analysis of the Dag1 Neo/ + mouse. The PCR product was amplified from genomic DNA using primers spanning the Neo cassette region
    Xho I Digested Pet21b, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i digested pet21b/product/Millipore
    Average 94 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    xho i digested pet21b - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    95
    Millipore xho i digested pet21d
    Organization of the dystroglycan gene and position of the floxed Neo cassette. a Schematic representation of the Dag1 +/+ allele, the targeting vector, the Dag1 allele after incomplete homologous recombination ( Dag1 Neo ) and the neo-deleted allele ( Dag1 ΔNeo ). The 5′ arm of the construct consisted of a 3.2 kb fragment amplified from the Dag1 intron. The 3′ arm was 4 kb in length and consisted of the exon 3′ region, harbouring four mutations (red asterisks) hitting the α/β-DG interface, and flanked by intronic sequences and the 3′-UTR, respectively. A <t>Xho</t> I (X) site in the 5′ arm was mutated for cloning purposes. The floxed neomycin cassette (Neo) and the Herpes simplex thymidine kinase (TK) acted as positive and negative selection markers, respectively. Selected restriction enzyme cleavage sites are indicated above the gene (B: Bam HI; H: Hin dIII and X: Xho I). Primers used for genotyping are also indicated as black arrows. b A representative PCR genotyping analysis of the Dag1 Neo/ + mouse. The PCR product was amplified from genomic DNA using primers spanning the Neo cassette region
    Xho I Digested Pet21d, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i digested pet21d/product/Millipore
    Average 95 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    xho i digested pet21d - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    93
    Promega xho i restriction site
    Organization of the dystroglycan gene and position of the floxed Neo cassette. a Schematic representation of the Dag1 +/+ allele, the targeting vector, the Dag1 allele after incomplete homologous recombination ( Dag1 Neo ) and the neo-deleted allele ( Dag1 ΔNeo ). The 5′ arm of the construct consisted of a 3.2 kb fragment amplified from the Dag1 intron. The 3′ arm was 4 kb in length and consisted of the exon 3′ region, harbouring four mutations (red asterisks) hitting the α/β-DG interface, and flanked by intronic sequences and the 3′-UTR, respectively. A <t>Xho</t> I (X) site in the 5′ arm was mutated for cloning purposes. The floxed neomycin cassette (Neo) and the Herpes simplex thymidine kinase (TK) acted as positive and negative selection markers, respectively. Selected restriction enzyme cleavage sites are indicated above the gene (B: Bam HI; H: Hin dIII and X: Xho I). Primers used for genotyping are also indicated as black arrows. b A representative PCR genotyping analysis of the Dag1 Neo/ + mouse. The PCR product was amplified from genomic DNA using primers spanning the Neo cassette region
    Xho I Restriction Site, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 65 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i restriction site/product/Promega
    Average 93 stars, based on 65 article reviews
    Price from $9.99 to $1999.99
    xho i restriction site - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    95
    Millipore xho i digested pet22
    Organization of the dystroglycan gene and position of the floxed Neo cassette. a Schematic representation of the Dag1 +/+ allele, the targeting vector, the Dag1 allele after incomplete homologous recombination ( Dag1 Neo ) and the neo-deleted allele ( Dag1 ΔNeo ). The 5′ arm of the construct consisted of a 3.2 kb fragment amplified from the Dag1 intron. The 3′ arm was 4 kb in length and consisted of the exon 3′ region, harbouring four mutations (red asterisks) hitting the α/β-DG interface, and flanked by intronic sequences and the 3′-UTR, respectively. A <t>Xho</t> I (X) site in the 5′ arm was mutated for cloning purposes. The floxed neomycin cassette (Neo) and the Herpes simplex thymidine kinase (TK) acted as positive and negative selection markers, respectively. Selected restriction enzyme cleavage sites are indicated above the gene (B: Bam HI; H: Hin dIII and X: Xho I). Primers used for genotyping are also indicated as black arrows. b A representative PCR genotyping analysis of the Dag1 Neo/ + mouse. The PCR product was amplified from genomic DNA using primers spanning the Neo cassette region
    Xho I Digested Pet22, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i digested pet22/product/Millipore
    Average 95 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    xho i digested pet22 - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    94
    Thermo Fisher xho i restriction enzyme
    Verification of the presence of Z2827-M67/3'UTR plasmid. (A) Colony PCR. Lane 1, DNA ladder mix; lanes 2, 4, 5, 6 and 8, a 2600 bp band is related to the presence of the 3'UTR fragment in the correct orientation; lane 9, negative control. (B) Digestion of the plasmid with Xho I. Lane 1, DNA ladder mix; Lane 2, the digestion products including the 880 bp and 9500 bp bands are related to the <t>ITGA4</t> 3'UTR fragment and backbone plasmid, respectively.
    Xho I Restriction Enzyme, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i restriction enzyme/product/Thermo Fisher
    Average 94 stars, based on 39 article reviews
    Price from $9.99 to $1999.99
    xho i restriction enzyme - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    86
    Entelechon GmbH xho i restriction sites
    Verification of the presence of Z2827-M67/3'UTR plasmid. (A) Colony PCR. Lane 1, DNA ladder mix; lanes 2, 4, 5, 6 and 8, a 2600 bp band is related to the presence of the 3'UTR fragment in the correct orientation; lane 9, negative control. (B) Digestion of the plasmid with Xho I. Lane 1, DNA ladder mix; Lane 2, the digestion products including the 880 bp and 9500 bp bands are related to the <t>ITGA4</t> 3'UTR fragment and backbone plasmid, respectively.
    Xho I Restriction Sites, supplied by Entelechon GmbH, used in various techniques. Bioz Stars score: 86/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i restriction sites/product/Entelechon GmbH
    Average 86 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    xho i restriction sites - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    86
    Roche restriction enzyme xho i
    Verification of the presence of Z2827-M67/3'UTR plasmid. (A) Colony PCR. Lane 1, DNA ladder mix; lanes 2, 4, 5, 6 and 8, a 2600 bp band is related to the presence of the 3'UTR fragment in the correct orientation; lane 9, negative control. (B) Digestion of the plasmid with Xho I. Lane 1, DNA ladder mix; Lane 2, the digestion products including the 880 bp and 9500 bp bands are related to the <t>ITGA4</t> 3'UTR fragment and backbone plasmid, respectively.
    Restriction Enzyme Xho I, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzyme xho i/product/Roche
    Average 86 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    restriction enzyme xho i - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    85
    Thermo Fisher xho i digested pbac1
    Verification of the presence of Z2827-M67/3'UTR plasmid. (A) Colony PCR. Lane 1, DNA ladder mix; lanes 2, 4, 5, 6 and 8, a 2600 bp band is related to the presence of the 3'UTR fragment in the correct orientation; lane 9, negative control. (B) Digestion of the plasmid with Xho I. Lane 1, DNA ladder mix; Lane 2, the digestion products including the 880 bp and 9500 bp bands are related to the <t>ITGA4</t> 3'UTR fragment and backbone plasmid, respectively.
    Xho I Digested Pbac1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i digested pbac1/product/Thermo Fisher
    Average 85 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    xho i digested pbac1 - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    81
    Thermo Fisher xho i treated pcdm8
    Verification of the presence of Z2827-M67/3'UTR plasmid. (A) Colony PCR. Lane 1, DNA ladder mix; lanes 2, 4, 5, 6 and 8, a 2600 bp band is related to the presence of the 3'UTR fragment in the correct orientation; lane 9, negative control. (B) Digestion of the plasmid with Xho I. Lane 1, DNA ladder mix; Lane 2, the digestion products including the 880 bp and 9500 bp bands are related to the <t>ITGA4</t> 3'UTR fragment and backbone plasmid, respectively.
    Xho I Treated Pcdm8, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 81/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i treated pcdm8/product/Thermo Fisher
    Average 81 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    xho i treated pcdm8 - by Bioz Stars, 2020-04
    81/100 stars
      Buy from Supplier

    Image Search Results


    Structure of the DNA molecules used in this study. A . Structure of the parent c-DNA. B . l-DNA formed by restriction digest of c-DNA with the enzyme Xho I. The size of the linearized plasmid was 4272 bp, C . pcr-DNA (2209 bp) generated by site-specific primers that amplified the region of the c-DNA containing the HTLV promoter, the hOPG open reading frame, and the SV40 Poly-A site. D . Structure of the parent c-DNA used in transfection. E . l-DNA formed by digest of pEGFP-N2 with the enzyme Cla I, which cuts in the vector backbone. F . pcr-DNA (1713 bp) generated by primers that are complementary to the sequence upstream of the CMV promoter and downstream of the polyA site.

    Journal: BMC Biotechnology

    Article Title: Effects of size and topology of DNA molecules on intracellular delivery with non-viral gene carriers

    doi: 10.1186/1472-6750-8-23

    Figure Lengend Snippet: Structure of the DNA molecules used in this study. A . Structure of the parent c-DNA. B . l-DNA formed by restriction digest of c-DNA with the enzyme Xho I. The size of the linearized plasmid was 4272 bp, C . pcr-DNA (2209 bp) generated by site-specific primers that amplified the region of the c-DNA containing the HTLV promoter, the hOPG open reading frame, and the SV40 Poly-A site. D . Structure of the parent c-DNA used in transfection. E . l-DNA formed by digest of pEGFP-N2 with the enzyme Cla I, which cuts in the vector backbone. F . pcr-DNA (1713 bp) generated by primers that are complementary to the sequence upstream of the CMV promoter and downstream of the polyA site.

    Article Snippet: Linear DNA (l-DNA) Purified c-DNA was linearized using the restriction enzyme, Xho I (New England Biolabs; Pickering, ON) for pORF9-hTNFRS11b or Cla I (Invitrogen; Burlington, ON) for pEGFP-N2, Restriction digestion were set up with 5 μg of DNA per 50 μL of reaction volume containing 3 units of enzyme and incubated at 37°C for 16 hours.

    Techniques: Plasmid Preparation, Polymerase Chain Reaction, Generated, Amplification, Transfection, Sequencing

    (A) Digestion of pTY-α-amylase with Nhe I and Xho I restriction enzymes. Lane 1: pTYB2 digested with Nhe I and Xho I; lane2: pTY-α-amylase digested with Nhe I and Xho I; lane 3: PCR product of α-amylase. (B) SDS-PAGE analysis of α-amylase expression. Lane 1: before IPTG induction; lane 2: after IPTG induction; lane 3: 16 hours after IPTG induction; lane 4: 20 hours after IPTG induction. (C) Western blot analysis of α-amylase with anti-intein polyclonal antibody. Lane1: α-amylase; lane 2: lysate of untransformed bacteria. IPTG = isopropyl- β-d-thiogalactopyranoside; M = molecular marker; SDS-PAGE = sodium dodecyl sulfate polyacrylamide gel electrophoresis.

    Journal: Osong Public Health and Research Perspectives

    Article Title: Cloning, Expression, and Purification of Hyperthermophile α-Amylase from Pyrococcus woesei

    doi: 10.1016/j.phrp.2015.10.003

    Figure Lengend Snippet: (A) Digestion of pTY-α-amylase with Nhe I and Xho I restriction enzymes. Lane 1: pTYB2 digested with Nhe I and Xho I; lane2: pTY-α-amylase digested with Nhe I and Xho I; lane 3: PCR product of α-amylase. (B) SDS-PAGE analysis of α-amylase expression. Lane 1: before IPTG induction; lane 2: after IPTG induction; lane 3: 16 hours after IPTG induction; lane 4: 20 hours after IPTG induction. (C) Western blot analysis of α-amylase with anti-intein polyclonal antibody. Lane1: α-amylase; lane 2: lysate of untransformed bacteria. IPTG = isopropyl- β-d-thiogalactopyranoside; M = molecular marker; SDS-PAGE = sodium dodecyl sulfate polyacrylamide gel electrophoresis.

    Article Snippet: P. woesei chromosomal DNA was used as a source of the α-amylase gene and polymerase chain reaction (PCR) amplification was done with the following primers: 5′- GCTAGC TTGGAGCTTGAAGAGGGAG-3′ and 5′- GAGACC ACAATAACTCCATACGGAG-3′ containing recognition sites for restriction endonucleases Nhe I and Xho I (Fermentas; Vilnius, Lithuania).

    Techniques: Polymerase Chain Reaction, SDS Page, Expressing, Western Blot, Marker, Polyacrylamide Gel Electrophoresis

    Detection of tracts of DNA repair synthesis during gap-directed MMR in NPE. Covalently closed (lanes 1–3), A-strand-gap-carrying (lanes 4–6) or C-strand-gap-carrying pMM1 AC (lanes 7–9) was incubated in NPE, and sampled at the indicated times. DNA was purified and digested with Xmn I and either Bam HI (upper, A to G repair) or Xho I (middle, C to T repair). To analyze the incorporation of radioactivity, DNA was digested with Drd I (bottom). α-[ 32 P]-dCTP was preferentially incorporated into the 1 kb fragment corresponding to the shorter path between the gap and the mismatch in both 5’-gap- and 3’-gap-directed MMR. DOI: http://dx.doi.org/10.7554/eLife.15155.005

    Journal: eLife

    Article Title: MutSα maintains the mismatch repair capability by inhibiting PCNA unloading

    doi: 10.7554/eLife.15155

    Figure Lengend Snippet: Detection of tracts of DNA repair synthesis during gap-directed MMR in NPE. Covalently closed (lanes 1–3), A-strand-gap-carrying (lanes 4–6) or C-strand-gap-carrying pMM1 AC (lanes 7–9) was incubated in NPE, and sampled at the indicated times. DNA was purified and digested with Xmn I and either Bam HI (upper, A to G repair) or Xho I (middle, C to T repair). To analyze the incorporation of radioactivity, DNA was digested with Drd I (bottom). α-[ 32 P]-dCTP was preferentially incorporated into the 1 kb fragment corresponding to the shorter path between the gap and the mismatch in both 5’-gap- and 3’-gap-directed MMR. DOI: http://dx.doi.org/10.7554/eLife.15155.005

    Article Snippet: The mismatch-carrying DNA was treated with Xho I (Takara Bio, Kusatsu, Japan) to digest DNA whose mismatch base was edited by T7 DNA polymerase.

    Techniques: Incubation, Purification, Radioactivity

    Generation of IL23R-CHR protein. A, Restriction sites are indicated in bold, the translated amino acid and Trx-6×His-DDDDKA tag are shown in the box; B, IL23R-CHR gene from human spleen cDNA library amplified by PCR; C, One pET32a/IL23R-CHR clone digested with NcoI and XhoI and analyzed by agrose gel electrophoresis (1%). MW = molecular weight markers, bp. D, Trx-IL23R-CHR induced by IPTG in E.Coli BL21 (DE3), SDS-PAGE (15%), protein bands were stained with coomassie brilliant blue R250 reagent. Lane 2, uninduced bacterial lysate; Lane 3, IPTG induced bacterial lysate. E, Trx-IL23R-CHR purified from BL21 (DE3) lysate and cleaved by enterokinase, Lane 5, purified Trx-IL23R-CHR; Lane 6, purified IL23R-CHR. F, Western blot using mouse mAbs against human IL23R (Lane 8). Lane 1, 4 and 7 in D, E, F: molecular weight markers, KD.

    Journal: PLoS ONE

    Article Title: Protection against Th17 Cells Differentiation by an Interleukin-23 Receptor Cytokine-Binding Homology Region

    doi: 10.1371/journal.pone.0045625

    Figure Lengend Snippet: Generation of IL23R-CHR protein. A, Restriction sites are indicated in bold, the translated amino acid and Trx-6×His-DDDDKA tag are shown in the box; B, IL23R-CHR gene from human spleen cDNA library amplified by PCR; C, One pET32a/IL23R-CHR clone digested with NcoI and XhoI and analyzed by agrose gel electrophoresis (1%). MW = molecular weight markers, bp. D, Trx-IL23R-CHR induced by IPTG in E.Coli BL21 (DE3), SDS-PAGE (15%), protein bands were stained with coomassie brilliant blue R250 reagent. Lane 2, uninduced bacterial lysate; Lane 3, IPTG induced bacterial lysate. E, Trx-IL23R-CHR purified from BL21 (DE3) lysate and cleaved by enterokinase, Lane 5, purified Trx-IL23R-CHR; Lane 6, purified IL23R-CHR. F, Western blot using mouse mAbs against human IL23R (Lane 8). Lane 1, 4 and 7 in D, E, F: molecular weight markers, KD.

    Article Snippet: After purification with Tianquick midi purification kit (Tiangen, China), the IL23R-CHR gene was digested with NcoI and XhoI (takara) and inserted into pET32a following the manufacturer’s instructions (Novagen, Germany).

    Techniques: cDNA Library Assay, Amplification, Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Molecular Weight, SDS Page, Staining, Purification, Western Blot

    Detection of LTB, CTB and bar genes and phosphoacetyl transferase (PAT) in putative transgenic plant leaf tissues. (a) PCR amplification of LTB (217 bp), CTB (292 bp) and bar (302 bp) from transgenic rice genomic DNA. Lane 1 is the size marker. Lane 2 is the binary vector (pMJ103-LTB-CTB). Lane 3 is the wild-type. Lanes 4–28 are transgenic rice plants. (b) Lateral flow assay using the Trait LL lateral flow test kit (Strategic diagnostics). Lane 1 is the wild-type. Lanes 2–26 are transgenic rice plants. (c) Southern hybridization analysis of chromosomal DNA in transgenic rice. Genomic DNA from wild-type untransformed or independent transgenic rice T 0 lines carrying the pMJ103-LTB-CTB construct was hybridized with a probe specific for the LTB coding region. A total of 10 μg of total leaf genomic DNA from transgenic rice plants was digested with Xho I, which cuts at a single site within the binary vector pMJ103-LTB-CTB. (d) LTB and CTB gene transcripts in transgenic plants were detected by RT-PCR. Plant RNA was isolated from selected transgenic plant rice seeds and RT-PCR was performed using a primer pair that specifically amplified 107- and 111-bp DNA fragments of the LTB and CTB genes (lanes 2 to 8). Lane 1 shows the RNA of non-transgenic plants used as a negative control.

    Journal: SpringerPlus

    Article Title: Expression and functional validation of heat-labile enterotoxin B (LTB) and cholera toxin B (CTB) subunits in transgenic rice (Oryza sativa)

    doi: 10.1186/s40064-015-0847-4

    Figure Lengend Snippet: Detection of LTB, CTB and bar genes and phosphoacetyl transferase (PAT) in putative transgenic plant leaf tissues. (a) PCR amplification of LTB (217 bp), CTB (292 bp) and bar (302 bp) from transgenic rice genomic DNA. Lane 1 is the size marker. Lane 2 is the binary vector (pMJ103-LTB-CTB). Lane 3 is the wild-type. Lanes 4–28 are transgenic rice plants. (b) Lateral flow assay using the Trait LL lateral flow test kit (Strategic diagnostics). Lane 1 is the wild-type. Lanes 2–26 are transgenic rice plants. (c) Southern hybridization analysis of chromosomal DNA in transgenic rice. Genomic DNA from wild-type untransformed or independent transgenic rice T 0 lines carrying the pMJ103-LTB-CTB construct was hybridized with a probe specific for the LTB coding region. A total of 10 μg of total leaf genomic DNA from transgenic rice plants was digested with Xho I, which cuts at a single site within the binary vector pMJ103-LTB-CTB. (d) LTB and CTB gene transcripts in transgenic plants were detected by RT-PCR. Plant RNA was isolated from selected transgenic plant rice seeds and RT-PCR was performed using a primer pair that specifically amplified 107- and 111-bp DNA fragments of the LTB and CTB genes (lanes 2 to 8). Lane 1 shows the RNA of non-transgenic plants used as a negative control.

    Article Snippet: Flanking DNA sequencing and PCR of homozygous transgenic plants Genomic DNA (500 ng) from the third-generation (T3 ) transgenic plants was digested with the restriction enzyme Xho I (2 U, Takara) and ligated with 5 U of T4 DNA ligase (Takara) in a 20-μl reaction volume.

    Techniques: CtB Assay, Transgenic Assay, Polymerase Chain Reaction, Amplification, Marker, Plasmid Preparation, Lateral Flow Assay, Flow Cytometry, Hybridization, Construct, Reverse Transcription Polymerase Chain Reaction, Isolation, Negative Control

    Schematic representations of the HSV-1 genome and viruses used in this study. The wild-type HSV-1 genome is shown in line 1. The unique long (U L ), unique short (U s ), and terminal repeat segments (a, b, c, a′, b′, and c′) are indicated. The coordinates of the Bam Q and Bam F fragments in the viral genome are indicated, and these regions are expanded in line 2. Line 3 shows the predicted open reading frames in the Bam Q and Bam F regions of wild-type virus. Solid arrowheads mark translation stop sites and show the direction of transcription; arrow length indicates approximate transcript size. The U L 22 transcript designated with an open arrow possesses a translational stop site beyond the boundaries of the Bam Q fragment. R2507 (line 4) is a derivative of the parental strain Δ305. Thus, R2507 possesses a deletion in the Bam Q fragment which removes 500 bp, including a portion of the U L 23 gene encoding the viral tk and a portion of the U L 24 gene. These disrupted transcripts are denoted by an X at the locations of their stop sites in the wild-type genome. In R2507, a 1.8-kb tk expression cassette containing the viral tk gene under control of the ICP27 promoter (27p) has been inserted approximately 200 bp upstream of the U L ). RD177 (line 5) and RF177 (line 6) were generated for the present study as described in Materials and Methods. Both viruses express the GFP under control of a cytomegalovirus promoter (Cp). The small solid rectangles in lines 5 and 6 indicate that the GFP cassette was inserted 45 bp 5′ of the U L 49 stop site. The deletion in the Bam Q locus present in R2507 and RD177 was repaired in RF177. Restriction sites: Bam, Bam HI; E, Eco RV; X, Xho I; N, Nsi I; Bg, Bgl II.

    Journal: Journal of Virology

    Article Title: Assembly of Infectious Herpes Simplex Virus Type 1 Virions in the Absence of Full-Length VP22

    doi:

    Figure Lengend Snippet: Schematic representations of the HSV-1 genome and viruses used in this study. The wild-type HSV-1 genome is shown in line 1. The unique long (U L ), unique short (U s ), and terminal repeat segments (a, b, c, a′, b′, and c′) are indicated. The coordinates of the Bam Q and Bam F fragments in the viral genome are indicated, and these regions are expanded in line 2. Line 3 shows the predicted open reading frames in the Bam Q and Bam F regions of wild-type virus. Solid arrowheads mark translation stop sites and show the direction of transcription; arrow length indicates approximate transcript size. The U L 22 transcript designated with an open arrow possesses a translational stop site beyond the boundaries of the Bam Q fragment. R2507 (line 4) is a derivative of the parental strain Δ305. Thus, R2507 possesses a deletion in the Bam Q fragment which removes 500 bp, including a portion of the U L 23 gene encoding the viral tk and a portion of the U L 24 gene. These disrupted transcripts are denoted by an X at the locations of their stop sites in the wild-type genome. In R2507, a 1.8-kb tk expression cassette containing the viral tk gene under control of the ICP27 promoter (27p) has been inserted approximately 200 bp upstream of the U L ). RD177 (line 5) and RF177 (line 6) were generated for the present study as described in Materials and Methods. Both viruses express the GFP under control of a cytomegalovirus promoter (Cp). The small solid rectangles in lines 5 and 6 indicate that the GFP cassette was inserted 45 bp 5′ of the U L 49 stop site. The deletion in the Bam Q locus present in R2507 and RD177 was repaired in RF177. Restriction sites: Bam, Bam HI; E, Eco RV; X, Xho I; N, Nsi I; Bg, Bgl II.

    Article Snippet: The UL 49 gene in pJB175 was disrupted from the Nsi I site at 105760 to the Xho I site at 105530 by insertion of the 1,344-bp Nsi I- Xho I fragment of pEGFP-C1 (Clontech) to yield pJB177.

    Techniques: Expressing, Generated

    Restriction enzyme analysis of recombinant pcDNA3-NS and pcDNA3-myc-PPP2R5A. M: DNA markers; lane 1: undigested pCDNA3-NS; lane 2: digestion of pCDNA3-NS by Bam HI/ Xho I and 1 680-bp fragment was released; lane 3: undigested pcDNA3-myc-PPP2R5A; lane 4:

    Journal: World Journal of Gastroenterology : WJG

    Article Title: Screening and identification of proteins interacting with nucleostemin

    doi: 10.3748/wjg.v11.i31.4812

    Figure Lengend Snippet: Restriction enzyme analysis of recombinant pcDNA3-NS and pcDNA3-myc-PPP2R5A. M: DNA markers; lane 1: undigested pCDNA3-NS; lane 2: digestion of pCDNA3-NS by Bam HI/ Xho I and 1 680-bp fragment was released; lane 3: undigested pcDNA3-myc-PPP2R5A; lane 4:

    Article Snippet: The full length of NS cDNA was cut by Bam HI and Xho I restriction endonucleases from pCDNA3-NS, then inserted into the downstream of the Gal4 DNA-binding domain of the bait vector pGBKT7 (Clontech Laboratories) with T4 DNA ligase.

    Techniques: Recombinant

    Identification of the recombinant clone of NS and its expression in yeast cell. A: Analysis of pGBKT7-NS with restriction enzyme digestion. M: DNA markers; lane 1: undigested pGBKT7-NS; lane 2: digestion of pGBKT7-NS with Bam HI/ Xho I and 1 680-bp fragment

    Journal: World Journal of Gastroenterology : WJG

    Article Title: Screening and identification of proteins interacting with nucleostemin

    doi: 10.3748/wjg.v11.i31.4812

    Figure Lengend Snippet: Identification of the recombinant clone of NS and its expression in yeast cell. A: Analysis of pGBKT7-NS with restriction enzyme digestion. M: DNA markers; lane 1: undigested pGBKT7-NS; lane 2: digestion of pGBKT7-NS with Bam HI/ Xho I and 1 680-bp fragment

    Article Snippet: The full length of NS cDNA was cut by Bam HI and Xho I restriction endonucleases from pCDNA3-NS, then inserted into the downstream of the Gal4 DNA-binding domain of the bait vector pGBKT7 (Clontech Laboratories) with T4 DNA ligase.

    Techniques: Recombinant, Expressing

    Schematic representation of the expression vector, pET32a-mBD2. The cDNA for mature mBD2 were amplified using PCR from the pcDNA3.1(+)-mBD2 plasmid. PCR product was cleaved by Xho I and Kpn I, and the mBD2 fragment was inserted into similarly digested pET32a(+) vector to construct the expression vector, pET32a-mBD2.

    Journal: Brazilian Journal of Microbiology

    Article Title: Expression of mouse beta defensin 2 in escherichia coli and its broad-spectrum antimicrobial activity

    doi: 10.1590/S1517-838220110003000043

    Figure Lengend Snippet: Schematic representation of the expression vector, pET32a-mBD2. The cDNA for mature mBD2 were amplified using PCR from the pcDNA3.1(+)-mBD2 plasmid. PCR product was cleaved by Xho I and Kpn I, and the mBD2 fragment was inserted into similarly digested pET32a(+) vector to construct the expression vector, pET32a-mBD2.

    Article Snippet: The PCR conditions were following: 94°C, 4 min; 30 cycles of 94°C, 30 s; 58°C, 30 s; 72°C, 30 s; 72°C, 5 min. PCR product was cleaved by Xho I and Kpn I , and the mBD2 fragment was inserted into similarly digested pET32a(+) (Novagen, Shanghai, China) to construct the expression vector pET32a-mBD2.

    Techniques: Expressing, Plasmid Preparation, Amplification, Polymerase Chain Reaction, Construct

    Cloning of the Ad12 fiber knob and the extracellular domains of human CAR. (a) The Ad12 knob domain (line) begins at a conserved Thr-Leu-Trp-Thr motif (amino acids 409 to 412) and extends to the fiber protein carboxy terminus (Glu587). A fragment of Ad12 DNA encoding the entire knob domain and several amino acids from the preceding fiber shaft region (striped box) beginning at Ser401 was amplified by PCR using forward primer 1 and reverse primer 2. The resulting PCR product was cloned between the Nde I and Bam HI sites of pET15b. (b) The human CAR protein consists of an amino-terminal signal peptide (open box), two extracellular Ig-related domains (D1 and D2), a membrane-spanning region (TM), and a cytoplasmic domain (CYT). cDNA fragments encoding D1 and D1/D2 were amplified by PCR using forward primer 3 and reverse primers 4 and 5. The resulting PCR products were cloned between the Nco I and Xho I sites of pET20b. Similar D1- and D1/D2-encoding cDNA fragments were amplified by PCR using forward primer 6 and reverse primers 7 and 8. The resulting PCR products were cloned between the Nde I and Bam HI sites of pET15b. (c) pET vectors for protein expression in E. coli . The open and filled boxes represent bacterial signal peptides and hexahistidine tags, respectively. The restriction sites used in this study are shown, and the sequence of the pET15b-encoded 22-amino-acid carboxy-terminal extension of sD1 is given in single-letter code.

    Journal: Journal of Virology

    Article Title: Coxsackievirus and Adenovirus Receptor Amino-Terminal Immunoglobulin V-Related Domain Binds Adenovirus Type 2 and Fiber Knob from Adenovirus Type 12

    doi:

    Figure Lengend Snippet: Cloning of the Ad12 fiber knob and the extracellular domains of human CAR. (a) The Ad12 knob domain (line) begins at a conserved Thr-Leu-Trp-Thr motif (amino acids 409 to 412) and extends to the fiber protein carboxy terminus (Glu587). A fragment of Ad12 DNA encoding the entire knob domain and several amino acids from the preceding fiber shaft region (striped box) beginning at Ser401 was amplified by PCR using forward primer 1 and reverse primer 2. The resulting PCR product was cloned between the Nde I and Bam HI sites of pET15b. (b) The human CAR protein consists of an amino-terminal signal peptide (open box), two extracellular Ig-related domains (D1 and D2), a membrane-spanning region (TM), and a cytoplasmic domain (CYT). cDNA fragments encoding D1 and D1/D2 were amplified by PCR using forward primer 3 and reverse primers 4 and 5. The resulting PCR products were cloned between the Nco I and Xho I sites of pET20b. Similar D1- and D1/D2-encoding cDNA fragments were amplified by PCR using forward primer 6 and reverse primers 7 and 8. The resulting PCR products were cloned between the Nde I and Bam HI sites of pET15b. (c) pET vectors for protein expression in E. coli . The open and filled boxes represent bacterial signal peptides and hexahistidine tags, respectively. The restriction sites used in this study are shown, and the sequence of the pET15b-encoded 22-amino-acid carboxy-terminal extension of sD1 is given in single-letter code.

    Article Snippet: Primers 3 through 5 (CCATGGGTATCACTACTCCTGAAGAGA, CTCGAGCGCACCTGAAGGCTTA, and CTCGAGTGAAGGAGGGACAAC, respectively [Fig. b]) were designed for cloning D1- and D1/D2-encoding PCR products between the Nco I and Xho I sites of expression vector pET20b (Novagen).

    Techniques: Clone Assay, Amplification, Polymerase Chain Reaction, Positron Emission Tomography, Expressing, Sequencing

    Construction and cloning of HA1 protein. (A) Digestion of pUC57 vector containing HA1 gene by enzymes BamHI and XhoI. M: Molecular marker. Lanes 1 and 2: Digested plasmid and HA1 gene. (B) Digestion of pET28a-HA1 vector by enzymes BamHI and XhoI. M: Molecular marker. Lane 1: Digested pET and HA1 gene. (C) PCR analysis for detection of HA1 gene in transformed E. coli clonies contained pET28a-HA1 construct by HA1 specific primers. M: Molecular marker. Lane 1: Positive control, Lane 2: Transformed bacterial clony (The 329 bp band was clear), and Lane 3: Negative control

    Journal: Iranian Journal of Veterinary Research

    Article Title: Expression of HA1 antigen of H5N1 influenza virus as a potent candidate for vaccine in bacterial system

    doi:

    Figure Lengend Snippet: Construction and cloning of HA1 protein. (A) Digestion of pUC57 vector containing HA1 gene by enzymes BamHI and XhoI. M: Molecular marker. Lanes 1 and 2: Digested plasmid and HA1 gene. (B) Digestion of pET28a-HA1 vector by enzymes BamHI and XhoI. M: Molecular marker. Lane 1: Digested pET and HA1 gene. (C) PCR analysis for detection of HA1 gene in transformed E. coli clonies contained pET28a-HA1 construct by HA1 specific primers. M: Molecular marker. Lane 1: Positive control, Lane 2: Transformed bacterial clony (The 329 bp band was clear), and Lane 3: Negative control

    Article Snippet: The synthesized sequence was removed from the pUC57 vector by digestion with BamHI and XhoI and then inserted into the linearized pET28a (+) expression vector (Novagen, USA) using T4 DNA ligase (Fermentas, USA), yielding pET28a-HA1 vector.

    Techniques: Clone Assay, Plasmid Preparation, Marker, Positron Emission Tomography, Polymerase Chain Reaction, Transformation Assay, Construct, Positive Control, Negative Control

    Identification and expression of plasmid pEGFP-N1-MeCP2. (A) The pEGFP-N1-MeCP2 plasmid was identified by digestion with Pst I and Xho I. M: Marker. (B) The EGFP-MeCP2 fusion protein was detected by western blot using anti-EGFP antibody. 1: EGFP-SH-SY5Y cells (SH-SY5Y cells transfected with pEGFP-N1); 2: O-MeCP2-SH-SY5Y cells (SH-SY5Y cells transfected with pEGFP-N1-MeCP2). MeCP2: X-linked methyl-CpG binding protein 2.

    Journal: Neural Regeneration Research

    Article Title: Is X-linked methyl-CpG binding protein 2 a new target for the treatment of Parkinson's disease

    doi: 10.3969/j.issn.1673-5374.2013.21.003

    Figure Lengend Snippet: Identification and expression of plasmid pEGFP-N1-MeCP2. (A) The pEGFP-N1-MeCP2 plasmid was identified by digestion with Pst I and Xho I. M: Marker. (B) The EGFP-MeCP2 fusion protein was detected by western blot using anti-EGFP antibody. 1: EGFP-SH-SY5Y cells (SH-SY5Y cells transfected with pEGFP-N1); 2: O-MeCP2-SH-SY5Y cells (SH-SY5Y cells transfected with pEGFP-N1-MeCP2). MeCP2: X-linked methyl-CpG binding protein 2.

    Article Snippet: Pst I and Xho I (Promega, Madison, WI, USA) restriction sites were included in the primers (underlined) to facilitate the ligation of cDNA products into pEGFP-N1 vector (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China).

    Techniques: Expressing, Plasmid Preparation, Marker, Western Blot, Transfection, Binding Assay

    Restriction profiles obtained after Acs I (A) and Xho I (B) digestion of a portion of the citrate synthase gene amplified from 10 tick-borne ehrlichial species by PCR using consensus primers EHR-CS136F–EHR-CS778R. Lanes: M, molecular weight markers (in thousands); 1, HGE agent; 2, E. equi ; 3, E. phagocytophila ; 4, A. marginale ; 5, A. centrale ; 6, E. canis ; 7, E. chaffeensis ; 8, E. muris ; 9, Ehrlichia sp. detected in I. ovatus ; 10, C. ruminantium .

    Journal: Journal of Clinical Microbiology

    Article Title: Citrate Synthase Gene Sequence: a New Tool for Phylogenetic Analysis and Identification of Ehrlichia

    doi: 10.1128/JCM.39.9.3031-3039.2001

    Figure Lengend Snippet: Restriction profiles obtained after Acs I (A) and Xho I (B) digestion of a portion of the citrate synthase gene amplified from 10 tick-borne ehrlichial species by PCR using consensus primers EHR-CS136F–EHR-CS778R. Lanes: M, molecular weight markers (in thousands); 1, HGE agent; 2, E. equi ; 3, E. phagocytophila ; 4, A. marginale ; 5, A. centrale ; 6, E. canis ; 7, E. chaffeensis ; 8, E. muris ; 9, Ehrlichia sp. detected in I. ovatus ; 10, C. ruminantium .

    Article Snippet: Amplified products were digested with Acs I (Roche, Mannheim, Germany) and Xho I (Roche) for tick-borne Ehrlichia species and Rca I (Roche) for Neorickettsia genogroup ehrlichial species.

    Techniques: Amplification, Polymerase Chain Reaction, Molecular Weight

    Size of cDNA synthesised from mRNA isolated from protoscoleces of E. granulosus . After the second-strand cDNA was synthesised by adding 2μl of [α-32P] dATP to the reaction, the cDNA was fractioned through a CL-2B column after being linked with EcoR I adapters and digested with Xho I to create an Xho I cut end. Fractions 5 to 11 (1μl of elution) were run on an agarose gel and exposed for 4 h to an X-ray film before being developed. Standard RNA markers, in nucleotides are shown on the left hand of the figure.

    Journal: Biological Procedures Online

    Article Title: Recombinant antigens for immunodiagnosis of cystic echinococcosis

    doi: 10.1251/bpo74

    Figure Lengend Snippet: Size of cDNA synthesised from mRNA isolated from protoscoleces of E. granulosus . After the second-strand cDNA was synthesised by adding 2μl of [α-32P] dATP to the reaction, the cDNA was fractioned through a CL-2B column after being linked with EcoR I adapters and digested with Xho I to create an Xho I cut end. Fractions 5 to 11 (1μl of elution) were run on an agarose gel and exposed for 4 h to an X-ray film before being developed. Standard RNA markers, in nucleotides are shown on the left hand of the figure.

    Article Snippet: The kinase was inactivated by heating at 70°C for 30 min, then the reaction allowed to equilibrate to RT for 5 min. 3' termini was cut by Xho I restriction enzyme as the Oligo(dT) linker-primer containing the enzyme cutting site with adding 28 ml of Xho I buffer supplement and 3 ml of Xho I (40 U/ml) (all supplied by Stratagene).Then the reaction was incubated at 37°C for 90 min, the cDNA was precipitated by adding 1/10 volume of 10 × STE buffer and 2.5 volume of 100% (v/v) ethanol overnight at -20°C and the reaction mix centrifuged at maximum speed for 60 min at 4°C.

    Techniques: Isolation, Agarose Gel Electrophoresis

    Genomic RFLP analysis using different restriction enzymes and 3 RAPD markers unassigned by in silico analysis. The hybridization patterns were revealed by the different probes, A: LEM536/320/OPAY8, B: LEM496/300/OPAD17 and C: M106/200/OPAY9. Tested isolates correspond to L. major (FMH; L. maj ), L. archibaldi (GEBRE; L. arch ), L. donovani (HU3; L. don ), L. tropica (DBKM; L. tro ) and L. infantum (LEM1163; L. inf ). EcoR I, Pst I , Hind III, Xho I on top of the panel indicate the restriction enzyme used to digest the total Leishmania DNAs.

    Journal: PLoS ONE

    Article Title: Screening and Characterization of RAPD Markers in Viscerotropic Leishmania Parasites

    doi: 10.1371/journal.pone.0109773

    Figure Lengend Snippet: Genomic RFLP analysis using different restriction enzymes and 3 RAPD markers unassigned by in silico analysis. The hybridization patterns were revealed by the different probes, A: LEM536/320/OPAY8, B: LEM496/300/OPAD17 and C: M106/200/OPAY9. Tested isolates correspond to L. major (FMH; L. maj ), L. archibaldi (GEBRE; L. arch ), L. donovani (HU3; L. don ), L. tropica (DBKM; L. tro ) and L. infantum (LEM1163; L. inf ). EcoR I, Pst I , Hind III, Xho I on top of the panel indicate the restriction enzyme used to digest the total Leishmania DNAs.

    Article Snippet: Southern blotting of genomic RFLP and PCR products Southern blot analyses were performed by digesting 8 µg of DNA of 5 parasite strains representative of the L. major (MHOM/TN/90/FMH), L. archibaldi (MHOM/ET/72/GEBREI), L. donovani (MHOM/ET/67/HU3), L. tropica (MCAN/IN/71/DBKM), and L. infantum (MHOM/FR/78/LEM1163) species with 50–100 units EcoR I, Pst I, Hind III or Xho I (HVD-Amersham, Athens, Greece) restriction enzymes, as previously described .

    Techniques: In Silico, Hybridization

    PFGE profiles of genomic DNAs West Lothian, Highland, and central Scotland outbreak isolates cleaved with Xba I (lanes 2 to 4), Xho I (lanes 5 to 7), Not I (lanes 8 to 10), and Sfi I (lanes 11 to 13). Lanes 1 and 14, bacteriophage lambda concatemer size markers. The unnumbered lanes correspond to lanes 1 to 14 from left to right, respectively.

    Journal: Journal of Clinical Microbiology

    Article Title: Characterization of a Recurrent Clonal Type of Escherichia coli O157:H7 Causing Major Outbreaks of Infection in Scotland

    doi:

    Figure Lengend Snippet: PFGE profiles of genomic DNAs West Lothian, Highland, and central Scotland outbreak isolates cleaved with Xba I (lanes 2 to 4), Xho I (lanes 5 to 7), Not I (lanes 8 to 10), and Sfi I (lanes 11 to 13). Lanes 1 and 14, bacteriophage lambda concatemer size markers. The unnumbered lanes correspond to lanes 1 to 14 from left to right, respectively.

    Article Snippet: Cleavage of the agarose-embedded DNA was achieved with Xba I (Promega, Southampton, United Kingdom), Not I (Promega), Sfi I (Promega), Xho I (Boehringer Mannheim, Lewes, United Kingdom), and Avr II (Boehringer Mannheim) according to the manufacturer's instructions.

    Techniques:

    Organization of the dystroglycan gene and position of the floxed Neo cassette. a Schematic representation of the Dag1 +/+ allele, the targeting vector, the Dag1 allele after incomplete homologous recombination ( Dag1 Neo ) and the neo-deleted allele ( Dag1 ΔNeo ). The 5′ arm of the construct consisted of a 3.2 kb fragment amplified from the Dag1 intron. The 3′ arm was 4 kb in length and consisted of the exon 3′ region, harbouring four mutations (red asterisks) hitting the α/β-DG interface, and flanked by intronic sequences and the 3′-UTR, respectively. A Xho I (X) site in the 5′ arm was mutated for cloning purposes. The floxed neomycin cassette (Neo) and the Herpes simplex thymidine kinase (TK) acted as positive and negative selection markers, respectively. Selected restriction enzyme cleavage sites are indicated above the gene (B: Bam HI; H: Hin dIII and X: Xho I). Primers used for genotyping are also indicated as black arrows. b A representative PCR genotyping analysis of the Dag1 Neo/ + mouse. The PCR product was amplified from genomic DNA using primers spanning the Neo cassette region

    Journal: BMC Research Notes

    Article Title: Evaluation of the effect of a floxed Neo cassette within the dystroglycan (Dag1) gene

    doi: 10.1186/s13104-017-2926-9

    Figure Lengend Snippet: Organization of the dystroglycan gene and position of the floxed Neo cassette. a Schematic representation of the Dag1 +/+ allele, the targeting vector, the Dag1 allele after incomplete homologous recombination ( Dag1 Neo ) and the neo-deleted allele ( Dag1 ΔNeo ). The 5′ arm of the construct consisted of a 3.2 kb fragment amplified from the Dag1 intron. The 3′ arm was 4 kb in length and consisted of the exon 3′ region, harbouring four mutations (red asterisks) hitting the α/β-DG interface, and flanked by intronic sequences and the 3′-UTR, respectively. A Xho I (X) site in the 5′ arm was mutated for cloning purposes. The floxed neomycin cassette (Neo) and the Herpes simplex thymidine kinase (TK) acted as positive and negative selection markers, respectively. Selected restriction enzyme cleavage sites are indicated above the gene (B: Bam HI; H: Hin dIII and X: Xho I). Primers used for genotyping are also indicated as black arrows. b A representative PCR genotyping analysis of the Dag1 Neo/ + mouse. The PCR product was amplified from genomic DNA using primers spanning the Neo cassette region

    Article Snippet: To allow the linearization of the targeting vector that is necessary for the recombination and integration of the construct into the ES cells genome, site-directed mutagenesis was used to mutate a Xho I site in the 5′ arm using the QuikChange site-directed mutagenesis kit (Stratagene® ) and the following primers: forward 5′-AGTTCCTTCCTGCCT A GAGTGGGTGTTCCCT-3′ and reverse 5′-AGGGAACACCCACTC T AGGCAGGAAGGAACT-3′ (mutated nucleotides in bold).

    Techniques: Plasmid Preparation, Homologous Recombination, Construct, Amplification, Clone Assay, Selection, Polymerase Chain Reaction

    Verification of the presence of Z2827-M67/3'UTR plasmid. (A) Colony PCR. Lane 1, DNA ladder mix; lanes 2, 4, 5, 6 and 8, a 2600 bp band is related to the presence of the 3'UTR fragment in the correct orientation; lane 9, negative control. (B) Digestion of the plasmid with Xho I. Lane 1, DNA ladder mix; Lane 2, the digestion products including the 880 bp and 9500 bp bands are related to the ITGA4 3'UTR fragment and backbone plasmid, respectively.

    Journal: Research in Pharmaceutical Sciences

    Article Title: The silencing effect of miR-30a on ITGA4 gene expression in vitro: an approach for gene therapy

    doi: 10.4103/1735-5362.217426

    Figure Lengend Snippet: Verification of the presence of Z2827-M67/3'UTR plasmid. (A) Colony PCR. Lane 1, DNA ladder mix; lanes 2, 4, 5, 6 and 8, a 2600 bp band is related to the presence of the 3'UTR fragment in the correct orientation; lane 9, negative control. (B) Digestion of the plasmid with Xho I. Lane 1, DNA ladder mix; Lane 2, the digestion products including the 880 bp and 9500 bp bands are related to the ITGA4 3'UTR fragment and backbone plasmid, respectively.

    Article Snippet: The ITGA4 3'UTR fragment and the ITGA4 expression vector were digested by Xho I restriction enzyme (Fermentas, USA) at 37 °C for overnight, and the linear plasmid was treated with calf intestinal alkaline phosphatase enzyme (Fermentas, USA) and ligated by T4 DNA ligase (Fermentas, USA).

    Techniques: Plasmid Preparation, Polymerase Chain Reaction, Negative Control