xbai Takara Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs xbai
    Xbai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 4855 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/New England Biolabs
    Average 95 stars, based on 4855 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    90
    Thermo Fisher restriction enzyme xbai
    Restriction Enzyme Xbai, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 51 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzyme xbai/product/Thermo Fisher
    Average 90 stars, based on 51 article reviews
    Price from $9.99 to $1999.99
    restriction enzyme xbai - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    TaKaRa restriction enzyme xbai
    Gel image of PFGE result. Genomic <t>DNA</t> was digested using <t>XbaI</t> enzyme and subjected to pulsed-field gel electrophoresis.
    Restriction Enzyme Xbai, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 56 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzyme xbai/product/TaKaRa
    Average 99 stars, based on 56 article reviews
    Price from $9.99 to $1999.99
    restriction enzyme xbai - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    xbai  (TaKaRa)
    90
    TaKaRa xbai
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Xbai, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 1314 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/TaKaRa
    Average 90 stars, based on 1314 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    78
    TaKaRa ecori xbai digested pvp16
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Ecori Xbai Digested Pvp16, supplied by TaKaRa, used in various techniques. Bioz Stars score: 78/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ecori xbai digested pvp16/product/TaKaRa
    Average 78 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    ecori xbai digested pvp16 - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    79
    TaKaRa pdnr 1
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Pdnr 1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 79/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pdnr 1/product/TaKaRa
    Average 79 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    pdnr 1 - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    80
    TaKaRa ecori xbai digested ptre tight
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Ecori Xbai Digested Ptre Tight, supplied by TaKaRa, used in various techniques. Bioz Stars score: 80/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ecori xbai digested ptre tight/product/TaKaRa
    Average 80 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    ecori xbai digested ptre tight - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    99
    TaKaRa xhoi xbai
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Xhoi Xbai, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xhoi xbai/product/TaKaRa
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    xhoi xbai - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    78
    TaKaRa xbai hindiii digested phsg396
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Xbai Hindiii Digested Phsg396, supplied by TaKaRa, used in various techniques. Bioz Stars score: 78/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai hindiii digested phsg396/product/TaKaRa
    Average 78 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    xbai hindiii digested phsg396 - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    78
    TaKaRa sali xbai site
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Sali Xbai Site, supplied by TaKaRa, used in various techniques. Bioz Stars score: 78/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sali xbai site/product/TaKaRa
    Average 78 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    sali xbai site - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    93
    TaKaRa ecori xbai digested pc4s1 plasmid
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Ecori Xbai Digested Pc4s1 Plasmid, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ecori xbai digested pc4s1 plasmid/product/TaKaRa
    Average 93 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    ecori xbai digested pc4s1 plasmid - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    79
    TaKaRa smai xbai restriction sites
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Smai Xbai Restriction Sites, supplied by TaKaRa, used in various techniques. Bioz Stars score: 79/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/smai xbai restriction sites/product/TaKaRa
    Average 79 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    smai xbai restriction sites - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    99
    TaKaRa ecori xbai
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Ecori Xbai, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ecori xbai/product/TaKaRa
    Average 99 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    ecori xbai - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    79
    TaKaRa xbai saci
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Xbai Saci, supplied by TaKaRa, used in various techniques. Bioz Stars score: 79/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai saci/product/TaKaRa
    Average 79 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    xbai saci - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    78
    TaKaRa xbai saci eyfp fragment
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Xbai Saci Eyfp Fragment, supplied by TaKaRa, used in various techniques. Bioz Stars score: 78/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai saci eyfp fragment/product/TaKaRa
    Average 78 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    xbai saci eyfp fragment - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    82
    TaKaRa bamhi xbai
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Bamhi Xbai, supplied by TaKaRa, used in various techniques. Bioz Stars score: 82/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi xbai/product/TaKaRa
    Average 82 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    bamhi xbai - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    78
    TaKaRa ecori xbai opened ptre
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Ecori Xbai Opened Ptre, supplied by TaKaRa, used in various techniques. Bioz Stars score: 78/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ecori xbai opened ptre/product/TaKaRa
    Average 78 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    ecori xbai opened ptre - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    79
    TaKaRa ecori xbai digested pegfp n1
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Ecori Xbai Digested Pegfp N1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 79/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ecori xbai digested pegfp n1/product/TaKaRa
    Average 79 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    ecori xbai digested pegfp n1 - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    78
    TaKaRa bamhi xbai linear pegfp c1 vector
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Bamhi Xbai Linear Pegfp C1 Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 78/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi xbai linear pegfp c1 vector/product/TaKaRa
    Average 78 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    bamhi xbai linear pegfp c1 vector - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    86
    TaKaRa xbai saci digested pbi221
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Xbai Saci Digested Pbi221, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai saci digested pbi221/product/TaKaRa
    Average 86 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    xbai saci digested pbi221 - by Bioz Stars, 2020-02
    86/100 stars
      Buy from Supplier

    99
    TaKaRa xbai endonuclease
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Xbai Endonuclease, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai endonuclease/product/TaKaRa
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    xbai endonuclease - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    75
    TaKaRa u slice xbai
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    U Slice Xbai, supplied by TaKaRa, used in various techniques. Bioz Stars score: 75/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/u slice xbai/product/TaKaRa
    Average 75 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    u slice xbai - by Bioz Stars, 2020-02
    75/100 stars
      Buy from Supplier

    82
    TaKaRa xbai digested lentivirus plvx puro vector
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Xbai Digested Lentivirus Plvx Puro Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 82/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai digested lentivirus plvx puro vector/product/TaKaRa
    Average 82 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    xbai digested lentivirus plvx puro vector - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    99
    TaKaRa pbi121
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Pbi121, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 808 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pbi121/product/TaKaRa
    Average 99 stars, based on 808 article reviews
    Price from $9.99 to $1999.99
    pbi121 - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    80
    TaKaRa noti xbai digested pcdna6 v5 hisb
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Noti Xbai Digested Pcdna6 V5 Hisb, supplied by TaKaRa, used in various techniques. Bioz Stars score: 80/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/noti xbai digested pcdna6 v5 hisb/product/TaKaRa
    Average 80 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    noti xbai digested pcdna6 v5 hisb - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    99
    TaKaRa xbai restriction endonuclease
    PFGE analysis of XDR K. pneumoniae isolates. In order to generate diagnostic genomic <t>DNA</t> fragmentation fingerprints, genomic DNA from each of the XDR K. pneumoniae isolates was digested using <t>XbaI</t> and subjected to pulsed-field gel electrophoresis. DNA fingerprints were revealed by Gel Red staining. For MLST-based categorization of the strains, the sequences of seven housekeeping genes (i.e., gapA, infB, mdh, pgi, phoE, rpoB , and tonB ) were analyzed, and the PFGE patterns have been organized according to a dendogram of 35 XDR K. pneumoniae isolates based on MLST analysis. In red text are those isolates with no detectable carbapenemase genes. The gray box highlights the prevalence of the ST11 sequence type.
    Xbai Restriction Endonuclease, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai restriction endonuclease/product/TaKaRa
    Average 99 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    xbai restriction endonuclease - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    89
    TaKaRa bamhi xbai digested pegfp c1
    PFGE analysis of XDR K. pneumoniae isolates. In order to generate diagnostic genomic <t>DNA</t> fragmentation fingerprints, genomic DNA from each of the XDR K. pneumoniae isolates was digested using <t>XbaI</t> and subjected to pulsed-field gel electrophoresis. DNA fingerprints were revealed by Gel Red staining. For MLST-based categorization of the strains, the sequences of seven housekeeping genes (i.e., gapA, infB, mdh, pgi, phoE, rpoB , and tonB ) were analyzed, and the PFGE patterns have been organized according to a dendogram of 35 XDR K. pneumoniae isolates based on MLST analysis. In red text are those isolates with no detectable carbapenemase genes. The gray box highlights the prevalence of the ST11 sequence type.
    Bamhi Xbai Digested Pegfp C1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 89/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi xbai digested pegfp c1/product/TaKaRa
    Average 89 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    bamhi xbai digested pegfp c1 - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    78
    TaKaRa xbai sali sites
    PFGE analysis of XDR K. pneumoniae isolates. In order to generate diagnostic genomic <t>DNA</t> fragmentation fingerprints, genomic DNA from each of the XDR K. pneumoniae isolates was digested using <t>XbaI</t> and subjected to pulsed-field gel electrophoresis. DNA fingerprints were revealed by Gel Red staining. For MLST-based categorization of the strains, the sequences of seven housekeeping genes (i.e., gapA, infB, mdh, pgi, phoE, rpoB , and tonB ) were analyzed, and the PFGE patterns have been organized according to a dendogram of 35 XDR K. pneumoniae isolates based on MLST analysis. In red text are those isolates with no detectable carbapenemase genes. The gray box highlights the prevalence of the ST11 sequence type.
    Xbai Sali Sites, supplied by TaKaRa, used in various techniques. Bioz Stars score: 78/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai sali sites/product/TaKaRa
    Average 78 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    xbai sali sites - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    77
    TaKaRa xhoi xbai digested egfp c3 plasmid
    PFGE analysis of XDR K. pneumoniae isolates. In order to generate diagnostic genomic <t>DNA</t> fragmentation fingerprints, genomic DNA from each of the XDR K. pneumoniae isolates was digested using <t>XbaI</t> and subjected to pulsed-field gel electrophoresis. DNA fingerprints were revealed by Gel Red staining. For MLST-based categorization of the strains, the sequences of seven housekeeping genes (i.e., gapA, infB, mdh, pgi, phoE, rpoB , and tonB ) were analyzed, and the PFGE patterns have been organized according to a dendogram of 35 XDR K. pneumoniae isolates based on MLST analysis. In red text are those isolates with no detectable carbapenemase genes. The gray box highlights the prevalence of the ST11 sequence type.
    Xhoi Xbai Digested Egfp C3 Plasmid, supplied by TaKaRa, used in various techniques. Bioz Stars score: 77/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xhoi xbai digested egfp c3 plasmid/product/TaKaRa
    Average 77 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    xhoi xbai digested egfp c3 plasmid - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    87
    TaKaRa plvxpuro egfp
    PFGE analysis of XDR K. pneumoniae isolates. In order to generate diagnostic genomic <t>DNA</t> fragmentation fingerprints, genomic DNA from each of the XDR K. pneumoniae isolates was digested using <t>XbaI</t> and subjected to pulsed-field gel electrophoresis. DNA fingerprints were revealed by Gel Red staining. For MLST-based categorization of the strains, the sequences of seven housekeeping genes (i.e., gapA, infB, mdh, pgi, phoE, rpoB , and tonB ) were analyzed, and the PFGE patterns have been organized according to a dendogram of 35 XDR K. pneumoniae isolates based on MLST analysis. In red text are those isolates with no detectable carbapenemase genes. The gray box highlights the prevalence of the ST11 sequence type.
    Plvxpuro Egfp, supplied by TaKaRa, used in various techniques. Bioz Stars score: 87/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plvxpuro egfp/product/TaKaRa
    Average 87 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    plvxpuro egfp - by Bioz Stars, 2020-02
    87/100 stars
      Buy from Supplier

    78
    TaKaRa xhoi xbai digested pegfp n1
    PFGE analysis of XDR K. pneumoniae isolates. In order to generate diagnostic genomic <t>DNA</t> fragmentation fingerprints, genomic DNA from each of the XDR K. pneumoniae isolates was digested using <t>XbaI</t> and subjected to pulsed-field gel electrophoresis. DNA fingerprints were revealed by Gel Red staining. For MLST-based categorization of the strains, the sequences of seven housekeeping genes (i.e., gapA, infB, mdh, pgi, phoE, rpoB , and tonB ) were analyzed, and the PFGE patterns have been organized according to a dendogram of 35 XDR K. pneumoniae isolates based on MLST analysis. In red text are those isolates with no detectable carbapenemase genes. The gray box highlights the prevalence of the ST11 sequence type.
    Xhoi Xbai Digested Pegfp N1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 78/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xhoi xbai digested pegfp n1/product/TaKaRa
    Average 78 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    xhoi xbai digested pegfp n1 - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    Image Search Results


    Gel image of PFGE result. Genomic DNA was digested using XbaI enzyme and subjected to pulsed-field gel electrophoresis.

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Clinical and Molecular Characteristics of Emerging Hypervirulent Klebsiella pneumoniae Bloodstream Infections in Mainland China

    doi: 10.1128/AAC.02523-14

    Figure Lengend Snippet: Gel image of PFGE result. Genomic DNA was digested using XbaI enzyme and subjected to pulsed-field gel electrophoresis.

    Article Snippet: Whole-cell genomic DNA representing each isolate was digested with the restriction enzyme XbaI (TaKaRa Biotechnology, Dalian, China) and separated by electrophoresis through 1% pulsed-field certified agarose (Bio-Rad, Richmond, CA, USA) by using a CHEF-Mapper (Bio-Rad).

    Techniques: Pulsed-Field Gel, Electrophoresis

    Point mutation in Hras gene in DMBA/TPA treated cells. ( A ) The A > T substitution causes the appearance of XbaI consensus site ( B ) XbaI digestion of Hras in MEF (left lane) and 308 cells (right lane). Two restriction fragments of 300 and 400 bp emerge in mutated Hras resulting from cleavage of full length 700 bp replicon in the newly formed XbaI restriction site. ( C ) Sequencing of Hras codon 61 reveals A > T transversion in of 308 cell line which is derived from early DMBA/TPA induced papillomas (ii). Mouse embryonic fibroblasts (MEFs) hold the typical A allele (i) .

    Journal: PLoS ONE

    Article Title: SNP Detection in mRNA in Living Cells Using Allele Specific FRET Probes

    doi: 10.1371/journal.pone.0072389

    Figure Lengend Snippet: Point mutation in Hras gene in DMBA/TPA treated cells. ( A ) The A > T substitution causes the appearance of XbaI consensus site ( B ) XbaI digestion of Hras in MEF (left lane) and 308 cells (right lane). Two restriction fragments of 300 and 400 bp emerge in mutated Hras resulting from cleavage of full length 700 bp replicon in the newly formed XbaI restriction site. ( C ) Sequencing of Hras codon 61 reveals A > T transversion in of 308 cell line which is derived from early DMBA/TPA induced papillomas (ii). Mouse embryonic fibroblasts (MEFs) hold the typical A allele (i) .

    Article Snippet: Primers sequence was as listed below: Forward : ctatagaggtgagctctgcctacc Reverse : ctacattgaaacatcagccaagac To confirm Hras mutation, restriction digestion was carried using XbaI restriction enzyme (Takara).

    Techniques: Mutagenesis, Sequencing, Derivative Assay

    (a) The distribution of PvuII genotypes among spontaneous abortion group and control groups ( P = 0.2). (b) The distribution of XbaI genotypes among spontaneous abortion group and control groups ( P = 0.1). The horizontal axis shows the three genotypes of each SNP, and the vertical axis shows the genotype frequencies in the spontaneous abortion and control groups.

    Journal: BioMed Research International

    Article Title: Association Study of Estrogen Receptor Alpha Gene Polymorphisms with Spontaneous Abortion: Is This a Possible Reason for Unexplained Spontaneous Abortion?

    doi: 10.1155/2013/256470

    Figure Lengend Snippet: (a) The distribution of PvuII genotypes among spontaneous abortion group and control groups ( P = 0.2). (b) The distribution of XbaI genotypes among spontaneous abortion group and control groups ( P = 0.1). The horizontal axis shows the three genotypes of each SNP, and the vertical axis shows the genotype frequencies in the spontaneous abortion and control groups.

    Article Snippet: PCR conditions were as follows: initial denaturation at 94°C for 5 min, 35 cycles with denaturation at 94°C for 45 sec, annealing at 53°C for 45 sec, and extension at 72°C for 45 sec followed by 1 cycle of a final extension at 72°C for 7 min. After performing the PCR, the amplification product of 346 bp was digested overnight at 37°C with PvuII and XbaI restriction enzymes (TaKaRa, Otsu, Japan).

    Techniques:

    Restriction map of recombinant plasmids. M1: 1 kb DNA ladder marker; lane 1: pVAX1-G250 / Hin dIII + Kpn I; lane 2: pVAX1 / Hin dIII + Kpn I; lane 3: PCR product of G250 . M2: 1 kb DNA ladder mark; lane 4: pVAX1-G250-GM / Kpn I + Xba I; lane 5: pVAX1-CAIX / Kpn I + Xba I; lane 6: PCR product of hGM-CSF ; M3: 150 bp DNA ladder marker.

    Journal: Oncology Letters

    Article Title: Construction of a fusion expression plasmid containing the G250 gene and human granulocyte-macrophage colony stimulating factor and its significance in renal cell carcinoma

    doi: 10.3892/ol.2010.230

    Figure Lengend Snippet: Restriction map of recombinant plasmids. M1: 1 kb DNA ladder marker; lane 1: pVAX1-G250 / Hin dIII + Kpn I; lane 2: pVAX1 / Hin dIII + Kpn I; lane 3: PCR product of G250 . M2: 1 kb DNA ladder mark; lane 4: pVAX1-G250-GM / Kpn I + Xba I; lane 5: pVAX1-CAIX / Kpn I + Xba I; lane 6: PCR product of hGM-CSF ; M3: 150 bp DNA ladder marker.

    Article Snippet: Ex-Taq DNA polymerase, T4 DNA ligase, restriction enzymes Xba I, Hin dIII and Kpn I, 1 kb DNA marker, 100 bp DNA marker, plasmid mini and gel extraction kits were from Takara Bio Inc., Japan.

    Techniques: Recombinant, Marker, Polymerase Chain Reaction

    PFGE profiles of S. dysenteriae type 1 strains after digestion with Xba I. Strains D1, D2, D44, 18, 21, and 25 represent the 2002 dysentery epidemic. Strain AZ11 was isolated from Aizal in 2003. Strains HU8, HU10, and HU29 were isolated during a 1988 outbreak in Tripura. BCH518 was isolated from a patient with a sporadic case in 1995 in Calcutta. Strains NK2217, NK2490, and NK2678 and strains NT4359, H14174, and H16576 were isolated from patients with sporadic cases of dysentery at BCRCH and IDH, respectively, in 2002. The molecular size marker (leftmost lane) used here is the PFG lambda ladder.

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Clonal Multidrug-Resistant Shigella dysenteriae Type 1 Strains Associated with Epidemic and Sporadic Dysenteries in Eastern India

    doi: 10.1128/AAC.48.2.681-684.2004

    Figure Lengend Snippet: PFGE profiles of S. dysenteriae type 1 strains after digestion with Xba I. Strains D1, D2, D44, 18, 21, and 25 represent the 2002 dysentery epidemic. Strain AZ11 was isolated from Aizal in 2003. Strains HU8, HU10, and HU29 were isolated during a 1988 outbreak in Tripura. BCH518 was isolated from a patient with a sporadic case in 1995 in Calcutta. Strains NK2217, NK2490, and NK2678 and strains NT4359, H14174, and H16576 were isolated from patients with sporadic cases of dysentery at BCRCH and IDH, respectively, in 2002. The molecular size marker (leftmost lane) used here is the PFG lambda ladder.

    Article Snippet: DNA fingerprinting was done by pulsed-field gel electrophoresis (PFGE) with the restriction enzyme Xba I (Takara Shuzo, Otsu, Japan) according to a standard procedure ( ).

    Techniques: Isolation, Marker

    Genetic relatedness of E. coli isolates with class 1 integrons indicated by XbaI -digested chromosomal DNA

    Journal: BMC Veterinary Research

    Article Title: Interrelationship between tetracycline resistance determinants, phylogenetic group affiliation and carriage of class 1 integrons in commensal Escherichia coli isolates from cattle farms

    doi: 10.1186/s12917-018-1661-3

    Figure Lengend Snippet: Genetic relatedness of E. coli isolates with class 1 integrons indicated by XbaI -digested chromosomal DNA

    Article Snippet: Briefly, following 18 to 20 h growth on TSA at 37 °C, genomic DNA was digested with 50 U XbaI (TaKaRa, Japan) for 2 h at 37 °C, then the DNA fragments were subsequently separated on a 1.0% SeaKem Gold agarose gel (Lonza, USA) in 0.5× Tris-borate-EDTA (TBE) buffer using a CHEFMapper gel apparatus (Bio-Rad Laboratories, California, USA).

    Techniques:

    Electrophoresis of PCR product and pUCm-T-ZNRD1 digested with enzymes. Lane 1: PCR product; Lane 2, 3: Marker (200 bp); Lane 4: recombinant of pUCm-T-ZNRD1 cleaved by EcoR V and Xba I; Lane 5: recombinant of pUCm-T-ZNRD1.

    Journal: World Journal of Gastroenterology : WJG

    Article Title: Effect of ZNRD1 gene antisense RNA on drug resistant gastric cancer cells

    doi: 10.3748/wjg.v9.i5.894

    Figure Lengend Snippet: Electrophoresis of PCR product and pUCm-T-ZNRD1 digested with enzymes. Lane 1: PCR product; Lane 2, 3: Marker (200 bp); Lane 4: recombinant of pUCm-T-ZNRD1 cleaved by EcoR V and Xba I; Lane 5: recombinant of pUCm-T-ZNRD1.

    Article Snippet: EcoR V, Xba I, BamH I, cloning vector pUCm-T and T4 DNA ligase were purchased from Takara; MTT, DEPC from Sigma.

    Techniques: Electrophoresis, Polymerase Chain Reaction, Marker, Recombinant

    Construction of pDART. Using pDSK519, a widely used shuttle vector, as a backbone, tliDEF was inserted by In-Fusion cloning, yielding pDAR. More specifically, pDSK519 was cut with XbaI, and the PCR-amplified tliDEF was inserted, pushing the single XbaI

    Journal: Applied and Environmental Microbiology

    Article Title: A Vector System for ABC Transporter-Mediated Secretion and Purification of Recombinant Proteins in Pseudomonas Species

    doi: 10.1128/AEM.03514-14

    Figure Lengend Snippet: Construction of pDART. Using pDSK519, a widely used shuttle vector, as a backbone, tliDEF was inserted by In-Fusion cloning, yielding pDAR. More specifically, pDSK519 was cut with XbaI, and the PCR-amplified tliDEF was inserted, pushing the single XbaI

    Article Snippet: Complementary sequences around the XbaI site of pDSK519 were added upstream of the tliDEF -sense and downstream of the tliDEF -XS-RBS primers for In-Fusion (TaKaRa) cloning, following the manufacturer's manual. pDSK519 was digested with XbaI so that the plasmid became linear for gene insertion by In-Fusion.

    Techniques: Plasmid Preparation, Clone Assay, Polymerase Chain Reaction, Amplification

    PFGE analysis of XDR K. pneumoniae isolates. In order to generate diagnostic genomic DNA fragmentation fingerprints, genomic DNA from each of the XDR K. pneumoniae isolates was digested using XbaI and subjected to pulsed-field gel electrophoresis. DNA fingerprints were revealed by Gel Red staining. For MLST-based categorization of the strains, the sequences of seven housekeeping genes (i.e., gapA, infB, mdh, pgi, phoE, rpoB , and tonB ) were analyzed, and the PFGE patterns have been organized according to a dendogram of 35 XDR K. pneumoniae isolates based on MLST analysis. In red text are those isolates with no detectable carbapenemase genes. The gray box highlights the prevalence of the ST11 sequence type.

    Journal: Frontiers in Microbiology

    Article Title: Extensively Drug-Resistant Klebsiella pneumoniae Causing Nosocomial Bloodstream Infections in China: Molecular Investigation of Antibiotic Resistance Determinants, Informing Therapy, and Clinical Outcomes

    doi: 10.3389/fmicb.2017.01230

    Figure Lengend Snippet: PFGE analysis of XDR K. pneumoniae isolates. In order to generate diagnostic genomic DNA fragmentation fingerprints, genomic DNA from each of the XDR K. pneumoniae isolates was digested using XbaI and subjected to pulsed-field gel electrophoresis. DNA fingerprints were revealed by Gel Red staining. For MLST-based categorization of the strains, the sequences of seven housekeeping genes (i.e., gapA, infB, mdh, pgi, phoE, rpoB , and tonB ) were analyzed, and the PFGE patterns have been organized according to a dendogram of 35 XDR K. pneumoniae isolates based on MLST analysis. In red text are those isolates with no detectable carbapenemase genes. The gray box highlights the prevalence of the ST11 sequence type.

    Article Snippet: Genomic DNA was extracted using an AxyPrep Bacterial Genomic DNA Miniprep kit, subjected to complete digestion with the restriction endonuclease XbaI (Takara Bio, Dalian, China), and the diagnostic DNA fragments then separated in a PFGE CHEF-Mapper XA system (Bio-Rad) using 0.5 × Tris-borate-EDTA buffer at 120 V for 19 h, with pulse times ranging from 5 to 35 s. DNA fragments were stained with Gel Red (Biotium, USA) and analyzed using Quality one software (Bio-Rad).

    Techniques: Diagnostic Assay, Pulsed-Field Gel, Electrophoresis, Staining, Sequencing