xbai Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs xba i
    Southern blot showing copy numbers of the 16D10i-2 RNAi transgene in transformed potato lines and controls. For each plant line, 15 µg <t>DNA</t> was digested with 50 U <t>Xba</t> I and separated on a 0.8% agarose gel. 82-4, PA99N82-4 advanced breeding line;
    Xba I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 2655 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xba i/product/New England Biolabs
    Average 95 stars, based on 2655 article reviews
    Price from $9.99 to $1999.99
    xba i - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Millipore xba i
    Dendrogram based on <t>Xba</t> I PFGE types identified among 31 E. coli strains. The data were sorted by the UPGMA method. AMP-ampicillin, TET-tetracycline, SUT- trimethoprim/sulfamethoxazole, CLO-chloramphenicol, CFL-cephalothin, AMC-amoxicillin/clavulanic acid, LVX- levofloxacin, CIP-ciprofloxacin, GEN-gentamicin, CRO-ceftriaxone, CTX-cefotaxime. *Isolates that show intermediate susceptibility to cephalotin.
    Xba I, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 429 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xba i/product/Millipore
    Average 95 stars, based on 429 article reviews
    Price from $9.99 to $1999.99
    xba i - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    90
    Thermo Fisher xba i
    Combined numerical analysis of PFGE results obtained after <t>Xba</t> I and <t>Dra</t> I digestions using the unweighted pair group method using arithmetic averages. A to I, individual patient isolates (A1, A2, etc., represent serial isolates from a same patient). The scale shows the Dice index.
    Xba I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 2792 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xba i/product/Thermo Fisher
    Average 90 stars, based on 2792 article reviews
    Price from $9.99 to $1999.99
    xba i - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher fastdigest xbai
    Combined numerical analysis of PFGE results obtained after <t>Xba</t> I and <t>Dra</t> I digestions using the unweighted pair group method using arithmetic averages. A to I, individual patient isolates (A1, A2, etc., represent serial isolates from a same patient). The scale shows the Dice index.
    Fastdigest Xbai, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 79 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fastdigest xbai/product/Thermo Fisher
    Average 90 stars, based on 79 article reviews
    Price from $9.99 to $1999.99
    fastdigest xbai - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    89
    GE Healthcare xbai
    Dendrograms generated by BioNumerics showing the results of cluster analysis on the basis of <t>XbaI-PFGE</t> of S. enterica serotype Typhimurium isolates. Similarity analysis was performed using the Dice coefficient, and clustering was by the unweighted pair group method with arithmetic averages. The different PFGE profiles and corresponding numbers of isolates, the types of bla genes (if present), and the phage types are indicated.
    Xbai, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 89/100, based on 312 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/GE Healthcare
    Average 89 stars, based on 312 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    95
    Promega xbai
    (A) Southern blot hybridization with the <t>p1-9</t> probe of <t>XbaI-digested</t> genomic DNAs of S. enterica serovar Typhimurium DT104 control strain BN9181 carrying SGI1 (lane 2), serovar Virchow control strain SV20 carrying SGI1-J4 (lane 3), serovar Kentucky strain
    Xbai, supplied by Promega, used in various techniques. Bioz Stars score: 95/100, based on 2300 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Promega
    Average 95 stars, based on 2300 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    xbai  (Roche)
    92
    Roche xbai
    Pulsed field gel electrophoresis of <t>XbaI-digested</t> DNA from the 59 ExPEC strains included in the study . Strain designation, phylogenetic group, ST assignation, clinical and geographical origin of isolation, <t>PFGE</t> cluster ( > 85% similarity), and PCR result for virulence genes that exhibited significant differences within the pathogenic groups are shown at right. This unweighted pair-group method with arithmetic mean dendrogram was generated in BioNumerics software (Applied Maths, St-Martens-Latem, Belgium) by using Dice coefficient with a 1.0% band position tolerance. The scale above the dendrogram indicates percent similarity. AS: abdominal sepsis; UTI: urinary tract infection; CI: cystitis; IS: intestinal sepsis; NBM: Newborn Meningitis; US: urosepsis; P?: posible pyelonephritis; C: colibacillosis; RS: respiratory sepsis; AP: acute pyelonephritis; AB: asymptomatic bacteriuria.
    Xbai, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 489 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Roche
    Average 92 stars, based on 489 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    90
    GenScript xbai
    Pulsed field gel electrophoresis of <t>XbaI-digested</t> DNA from the 59 ExPEC strains included in the study . Strain designation, phylogenetic group, ST assignation, clinical and geographical origin of isolation, <t>PFGE</t> cluster ( > 85% similarity), and PCR result for virulence genes that exhibited significant differences within the pathogenic groups are shown at right. This unweighted pair-group method with arithmetic mean dendrogram was generated in BioNumerics software (Applied Maths, St-Martens-Latem, Belgium) by using Dice coefficient with a 1.0% band position tolerance. The scale above the dendrogram indicates percent similarity. AS: abdominal sepsis; UTI: urinary tract infection; CI: cystitis; IS: intestinal sepsis; NBM: Newborn Meningitis; US: urosepsis; P?: posible pyelonephritis; C: colibacillosis; RS: respiratory sepsis; AP: acute pyelonephritis; AB: asymptomatic bacteriuria.
    Xbai, supplied by GenScript, used in various techniques. Bioz Stars score: 90/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/GenScript
    Average 90 stars, based on 66 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc xbai
    Pulsed field gel electrophoresis of <t>XbaI-digested</t> DNA from the 59 ExPEC strains included in the study . Strain designation, phylogenetic group, ST assignation, clinical and geographical origin of isolation, <t>PFGE</t> cluster ( > 85% similarity), and PCR result for virulence genes that exhibited significant differences within the pathogenic groups are shown at right. This unweighted pair-group method with arithmetic mean dendrogram was generated in BioNumerics software (Applied Maths, St-Martens-Latem, Belgium) by using Dice coefficient with a 1.0% band position tolerance. The scale above the dendrogram indicates percent similarity. AS: abdominal sepsis; UTI: urinary tract infection; CI: cystitis; IS: intestinal sepsis; NBM: Newborn Meningitis; US: urosepsis; P?: posible pyelonephritis; C: colibacillosis; RS: respiratory sepsis; AP: acute pyelonephritis; AB: asymptomatic bacteriuria.
    Xbai, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Cell Signaling Technology Inc
    Average 93 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    xbai  (TaKaRa)
    94
    TaKaRa xbai
    Pulsed field gel electrophoresis of <t>XbaI-digested</t> DNA from the 59 ExPEC strains included in the study . Strain designation, phylogenetic group, ST assignation, clinical and geographical origin of isolation, <t>PFGE</t> cluster ( > 85% similarity), and PCR result for virulence genes that exhibited significant differences within the pathogenic groups are shown at right. This unweighted pair-group method with arithmetic mean dendrogram was generated in BioNumerics software (Applied Maths, St-Martens-Latem, Belgium) by using Dice coefficient with a 1.0% band position tolerance. The scale above the dendrogram indicates percent similarity. AS: abdominal sepsis; UTI: urinary tract infection; CI: cystitis; IS: intestinal sepsis; NBM: Newborn Meningitis; US: urosepsis; P?: posible pyelonephritis; C: colibacillosis; RS: respiratory sepsis; AP: acute pyelonephritis; AB: asymptomatic bacteriuria.
    Xbai, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1108 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/TaKaRa
    Average 94 stars, based on 1108 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    89
    Boehringer Mannheim xbai
    Pulsed field gel electrophoresis of <t>XbaI-digested</t> DNA from the 59 ExPEC strains included in the study . Strain designation, phylogenetic group, ST assignation, clinical and geographical origin of isolation, <t>PFGE</t> cluster ( > 85% similarity), and PCR result for virulence genes that exhibited significant differences within the pathogenic groups are shown at right. This unweighted pair-group method with arithmetic mean dendrogram was generated in BioNumerics software (Applied Maths, St-Martens-Latem, Belgium) by using Dice coefficient with a 1.0% band position tolerance. The scale above the dendrogram indicates percent similarity. AS: abdominal sepsis; UTI: urinary tract infection; CI: cystitis; IS: intestinal sepsis; NBM: Newborn Meningitis; US: urosepsis; P?: posible pyelonephritis; C: colibacillosis; RS: respiratory sepsis; AP: acute pyelonephritis; AB: asymptomatic bacteriuria.
    Xbai, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 89/100, based on 58 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Boehringer Mannheim
    Average 89 stars, based on 58 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    xbai  (Toyobo)
    89
    Toyobo xbai
    Pulsed field gel electrophoresis of <t>XbaI-digested</t> DNA from the 59 ExPEC strains included in the study . Strain designation, phylogenetic group, ST assignation, clinical and geographical origin of isolation, <t>PFGE</t> cluster ( > 85% similarity), and PCR result for virulence genes that exhibited significant differences within the pathogenic groups are shown at right. This unweighted pair-group method with arithmetic mean dendrogram was generated in BioNumerics software (Applied Maths, St-Martens-Latem, Belgium) by using Dice coefficient with a 1.0% band position tolerance. The scale above the dendrogram indicates percent similarity. AS: abdominal sepsis; UTI: urinary tract infection; CI: cystitis; IS: intestinal sepsis; NBM: Newborn Meningitis; US: urosepsis; P?: posible pyelonephritis; C: colibacillosis; RS: respiratory sepsis; AP: acute pyelonephritis; AB: asymptomatic bacteriuria.
    Xbai, supplied by Toyobo, used in various techniques. Bioz Stars score: 89/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Toyobo
    Average 89 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    89
    Valiant xbai
    Genetic organization of the antibiotic resistance gene cluster of <t>SGI1</t> and the new SGI1-H variant of serovar Newport strains 01-2174 and 01-5348. The direction of transcription of the genes is indicated by arrows. Black and gray arrows correspond to SGI1 antibiotic resistance genes and chromosomal genes flanking SGI1, respectively. DR-L and DR-R are the left and right direct repeats, respectively, bracketing SGI1. IRi and IRt are 25-bp imperfect inverted repeats defining the left and right ends of complex class 1 integrons. PCRs used to assess the genetic organization of the antibiotic resistance genes (i.e., PCRs floR , A, B, C, D, E, and F) and the SGI1 junctions to the chromosome (i.e., PCRs LJ and RJ for left and right junctions, respectively) are indicated. Restriction sites: X, <t>XbaI;</t> H, HindIII.
    Xbai, supplied by Valiant, used in various techniques. Bioz Stars score: 89/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Valiant
    Average 89 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    89
    Bio-Rad xbai
    Fingerprinting profiles (A to S) of <t>XbaI-digested</t> genomic <t>DNA</t> using the Dice coefficient and UPGMA for Klebsiella pneumoniae cerebrospinal fluid isolates collected in Taiwan. Eight pulsotypes (C, E, H, I, J, N, P, and R) show a Dice similarity coefficient of more than 80%. Corresponding MLST (multilocus sequence typing) and capsule K serotype of each isolate were presented. *One nucleotide change; x, unidentified, non-virulent capsule K types, i.e., not for K1, K2, K5, K20, K54, K57 types.
    Xbai, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 89/100, based on 207 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Bio-Rad
    Average 89 stars, based on 207 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    90
    Promega enzyme xbai
    Fingerprinting profiles (A to S) of <t>XbaI-digested</t> genomic <t>DNA</t> using the Dice coefficient and UPGMA for Klebsiella pneumoniae cerebrospinal fluid isolates collected in Taiwan. Eight pulsotypes (C, E, H, I, J, N, P, and R) show a Dice similarity coefficient of more than 80%. Corresponding MLST (multilocus sequence typing) and capsule K serotype of each isolate were presented. *One nucleotide change; x, unidentified, non-virulent capsule K types, i.e., not for K1, K2, K5, K20, K54, K57 types.
    Enzyme Xbai, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/enzyme xbai/product/Promega
    Average 90 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    enzyme xbai - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    86
    Promega hindiii xbai
    Fingerprinting profiles (A to S) of <t>XbaI-digested</t> genomic <t>DNA</t> using the Dice coefficient and UPGMA for Klebsiella pneumoniae cerebrospinal fluid isolates collected in Taiwan. Eight pulsotypes (C, E, H, I, J, N, P, and R) show a Dice similarity coefficient of more than 80%. Corresponding MLST (multilocus sequence typing) and capsule K serotype of each isolate were presented. *One nucleotide change; x, unidentified, non-virulent capsule K types, i.e., not for K1, K2, K5, K20, K54, K57 types.
    Hindiii Xbai, supplied by Promega, used in various techniques. Bioz Stars score: 86/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hindiii xbai/product/Promega
    Average 86 stars, based on 34 article reviews
    Price from $9.99 to $1999.99
    hindiii xbai - by Bioz Stars, 2020-02
    86/100 stars
      Buy from Supplier

    91
    Thermo Fisher bamhi xbai
    Fingerprinting profiles (A to S) of <t>XbaI-digested</t> genomic <t>DNA</t> using the Dice coefficient and UPGMA for Klebsiella pneumoniae cerebrospinal fluid isolates collected in Taiwan. Eight pulsotypes (C, E, H, I, J, N, P, and R) show a Dice similarity coefficient of more than 80%. Corresponding MLST (multilocus sequence typing) and capsule K serotype of each isolate were presented. *One nucleotide change; x, unidentified, non-virulent capsule K types, i.e., not for K1, K2, K5, K20, K54, K57 types.
    Bamhi Xbai, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 65 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi xbai/product/Thermo Fisher
    Average 91 stars, based on 65 article reviews
    Price from $9.99 to $1999.99
    bamhi xbai - by Bioz Stars, 2020-02
    91/100 stars
      Buy from Supplier

    82
    Thermo Fisher hindiii xbai
    Fingerprinting profiles (A to S) of <t>XbaI-digested</t> genomic <t>DNA</t> using the Dice coefficient and UPGMA for Klebsiella pneumoniae cerebrospinal fluid isolates collected in Taiwan. Eight pulsotypes (C, E, H, I, J, N, P, and R) show a Dice similarity coefficient of more than 80%. Corresponding MLST (multilocus sequence typing) and capsule K serotype of each isolate were presented. *One nucleotide change; x, unidentified, non-virulent capsule K types, i.e., not for K1, K2, K5, K20, K54, K57 types.
    Hindiii Xbai, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 82/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hindiii xbai/product/Thermo Fisher
    Average 82 stars, based on 66 article reviews
    Price from $9.99 to $1999.99
    hindiii xbai - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    90
    Thermo Fisher xbai noti
    Fingerprinting profiles (A to S) of <t>XbaI-digested</t> genomic <t>DNA</t> using the Dice coefficient and UPGMA for Klebsiella pneumoniae cerebrospinal fluid isolates collected in Taiwan. Eight pulsotypes (C, E, H, I, J, N, P, and R) show a Dice similarity coefficient of more than 80%. Corresponding MLST (multilocus sequence typing) and capsule K serotype of each isolate were presented. *One nucleotide change; x, unidentified, non-virulent capsule K types, i.e., not for K1, K2, K5, K20, K54, K57 types.
    Xbai Noti, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai noti/product/Thermo Fisher
    Average 90 stars, based on 34 article reviews
    Price from $9.99 to $1999.99
    xbai noti - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    78
    Promega xbai endonucleases
    OesDHN genomic organization. (A) Scheme of OesDHN gene. The black rectangle indicates intron position with respect to the cDNA. Start and stop codons are typed. (C) Deduced nucleotides of OesDHN cDNA and its 5′ upstream region and features of Oes DHN protein. The ATG start and TAA stop codons are indicated in bold; the stop codon position is indicated by the asterisk. The intron sequence, including the putative TATA-box (bold) is highlighted. The putative ABRE, G-box, MYB, GATA, CAAT-box elements are also indicated. Predicted amino acids are shown in one letter code. The S-segment is shown with an interrupted line, and the two K-segments are shown in bold italics and underlined with a single line. The putative NLS (nuclear localization signal) is double underlined and the poly-proline cluster is shown with one single line. The intronic region is represented with italic lowercases. (B) Southern blot analysis. The oleaster <t>gDNA</t> was digested with EcoRI and <t>XbaI</t> and hybridized with the cDNA probe, indicated in (A) . The molecular weights of a co-migrating DNA marker are expressed in kilo base pairs (Kb). PR, promoter region; UTR, Untranslated region. Bar 200 bp (A) .
    Xbai Endonucleases, supplied by Promega, used in various techniques. Bioz Stars score: 78/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai endonucleases/product/Promega
    Average 78 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    xbai endonucleases - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    77
    Thermo Fisher xbai nhei
    OesDHN genomic organization. (A) Scheme of OesDHN gene. The black rectangle indicates intron position with respect to the cDNA. Start and stop codons are typed. (C) Deduced nucleotides of OesDHN cDNA and its 5′ upstream region and features of Oes DHN protein. The ATG start and TAA stop codons are indicated in bold; the stop codon position is indicated by the asterisk. The intron sequence, including the putative TATA-box (bold) is highlighted. The putative ABRE, G-box, MYB, GATA, CAAT-box elements are also indicated. Predicted amino acids are shown in one letter code. The S-segment is shown with an interrupted line, and the two K-segments are shown in bold italics and underlined with a single line. The putative NLS (nuclear localization signal) is double underlined and the poly-proline cluster is shown with one single line. The intronic region is represented with italic lowercases. (B) Southern blot analysis. The oleaster <t>gDNA</t> was digested with EcoRI and <t>XbaI</t> and hybridized with the cDNA probe, indicated in (A) . The molecular weights of a co-migrating DNA marker are expressed in kilo base pairs (Kb). PR, promoter region; UTR, Untranslated region. Bar 200 bp (A) .
    Xbai Nhei, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai nhei/product/Thermo Fisher
    Average 77 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    xbai nhei - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    80
    Roche xbai enzyme
    OesDHN genomic organization. (A) Scheme of OesDHN gene. The black rectangle indicates intron position with respect to the cDNA. Start and stop codons are typed. (C) Deduced nucleotides of OesDHN cDNA and its 5′ upstream region and features of Oes DHN protein. The ATG start and TAA stop codons are indicated in bold; the stop codon position is indicated by the asterisk. The intron sequence, including the putative TATA-box (bold) is highlighted. The putative ABRE, G-box, MYB, GATA, CAAT-box elements are also indicated. Predicted amino acids are shown in one letter code. The S-segment is shown with an interrupted line, and the two K-segments are shown in bold italics and underlined with a single line. The putative NLS (nuclear localization signal) is double underlined and the poly-proline cluster is shown with one single line. The intronic region is represented with italic lowercases. (B) Southern blot analysis. The oleaster <t>gDNA</t> was digested with EcoRI and <t>XbaI</t> and hybridized with the cDNA probe, indicated in (A) . The molecular weights of a co-migrating DNA marker are expressed in kilo base pairs (Kb). PR, promoter region; UTR, Untranslated region. Bar 200 bp (A) .
    Xbai Enzyme, supplied by Roche, used in various techniques. Bioz Stars score: 80/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai enzyme/product/Roche
    Average 80 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    xbai enzyme - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    88
    Thermo Fisher xbai fd
    OesDHN genomic organization. (A) Scheme of OesDHN gene. The black rectangle indicates intron position with respect to the cDNA. Start and stop codons are typed. (C) Deduced nucleotides of OesDHN cDNA and its 5′ upstream region and features of Oes DHN protein. The ATG start and TAA stop codons are indicated in bold; the stop codon position is indicated by the asterisk. The intron sequence, including the putative TATA-box (bold) is highlighted. The putative ABRE, G-box, MYB, GATA, CAAT-box elements are also indicated. Predicted amino acids are shown in one letter code. The S-segment is shown with an interrupted line, and the two K-segments are shown in bold italics and underlined with a single line. The putative NLS (nuclear localization signal) is double underlined and the poly-proline cluster is shown with one single line. The intronic region is represented with italic lowercases. (B) Southern blot analysis. The oleaster <t>gDNA</t> was digested with EcoRI and <t>XbaI</t> and hybridized with the cDNA probe, indicated in (A) . The molecular weights of a co-migrating DNA marker are expressed in kilo base pairs (Kb). PR, promoter region; UTR, Untranslated region. Bar 200 bp (A) .
    Xbai Fd, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai fd/product/Thermo Fisher
    Average 88 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    xbai fd - by Bioz Stars, 2020-02
    88/100 stars
      Buy from Supplier

    82
    TaKaRa xhoi xbai
    OesDHN genomic organization. (A) Scheme of OesDHN gene. The black rectangle indicates intron position with respect to the cDNA. Start and stop codons are typed. (C) Deduced nucleotides of OesDHN cDNA and its 5′ upstream region and features of Oes DHN protein. The ATG start and TAA stop codons are indicated in bold; the stop codon position is indicated by the asterisk. The intron sequence, including the putative TATA-box (bold) is highlighted. The putative ABRE, G-box, MYB, GATA, CAAT-box elements are also indicated. Predicted amino acids are shown in one letter code. The S-segment is shown with an interrupted line, and the two K-segments are shown in bold italics and underlined with a single line. The putative NLS (nuclear localization signal) is double underlined and the poly-proline cluster is shown with one single line. The intronic region is represented with italic lowercases. (B) Southern blot analysis. The oleaster <t>gDNA</t> was digested with EcoRI and <t>XbaI</t> and hybridized with the cDNA probe, indicated in (A) . The molecular weights of a co-migrating DNA marker are expressed in kilo base pairs (Kb). PR, promoter region; UTR, Untranslated region. Bar 200 bp (A) .
    Xhoi Xbai, supplied by TaKaRa, used in various techniques. Bioz Stars score: 82/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xhoi xbai/product/TaKaRa
    Average 82 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    xhoi xbai - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    79
    Valiant xbai enzyme
    OesDHN genomic organization. (A) Scheme of OesDHN gene. The black rectangle indicates intron position with respect to the cDNA. Start and stop codons are typed. (C) Deduced nucleotides of OesDHN cDNA and its 5′ upstream region and features of Oes DHN protein. The ATG start and TAA stop codons are indicated in bold; the stop codon position is indicated by the asterisk. The intron sequence, including the putative TATA-box (bold) is highlighted. The putative ABRE, G-box, MYB, GATA, CAAT-box elements are also indicated. Predicted amino acids are shown in one letter code. The S-segment is shown with an interrupted line, and the two K-segments are shown in bold italics and underlined with a single line. The putative NLS (nuclear localization signal) is double underlined and the poly-proline cluster is shown with one single line. The intronic region is represented with italic lowercases. (B) Southern blot analysis. The oleaster <t>gDNA</t> was digested with EcoRI and <t>XbaI</t> and hybridized with the cDNA probe, indicated in (A) . The molecular weights of a co-migrating DNA marker are expressed in kilo base pairs (Kb). PR, promoter region; UTR, Untranslated region. Bar 200 bp (A) .
    Xbai Enzyme, supplied by Valiant, used in various techniques. Bioz Stars score: 79/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai enzyme/product/Valiant
    Average 79 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    xbai enzyme - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    78
    Promega xbai site pgl3promoter
    OesDHN genomic organization. (A) Scheme of OesDHN gene. The black rectangle indicates intron position with respect to the cDNA. Start and stop codons are typed. (C) Deduced nucleotides of OesDHN cDNA and its 5′ upstream region and features of Oes DHN protein. The ATG start and TAA stop codons are indicated in bold; the stop codon position is indicated by the asterisk. The intron sequence, including the putative TATA-box (bold) is highlighted. The putative ABRE, G-box, MYB, GATA, CAAT-box elements are also indicated. Predicted amino acids are shown in one letter code. The S-segment is shown with an interrupted line, and the two K-segments are shown in bold italics and underlined with a single line. The putative NLS (nuclear localization signal) is double underlined and the poly-proline cluster is shown with one single line. The intronic region is represented with italic lowercases. (B) Southern blot analysis. The oleaster <t>gDNA</t> was digested with EcoRI and <t>XbaI</t> and hybridized with the cDNA probe, indicated in (A) . The molecular weights of a co-migrating DNA marker are expressed in kilo base pairs (Kb). PR, promoter region; UTR, Untranslated region. Bar 200 bp (A) .
    Xbai Site Pgl3promoter, supplied by Promega, used in various techniques. Bioz Stars score: 78/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai site pgl3promoter/product/Promega
    Average 78 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    xbai site pgl3promoter - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    82
    Roche restriction enzyme xbai
    <t>PFGE</t> profiles of representative S. enterica subsp. enterica strains after digestion with <t>XbaI.</t> As a molecular weight standard (M), S. enterica serovar Braenderup reference strain H9812 was used (lanes 1, 15, and 20). Lanes 2 to 14 represent the 13 different
    Restriction Enzyme Xbai, supplied by Roche, used in various techniques. Bioz Stars score: 82/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzyme xbai/product/Roche
    Average 82 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    restriction enzyme xbai - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    93
    TaKaRa restriction enzyme xbai
    Gel image of PFGE result. Genomic <t>DNA</t> was digested using <t>XbaI</t> enzyme and subjected to pulsed-field gel electrophoresis.
    Restriction Enzyme Xbai, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzyme xbai/product/TaKaRa
    Average 93 stars, based on 39 article reviews
    Price from $9.99 to $1999.99
    restriction enzyme xbai - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    89
    Jena Bioscience xba i
    16S copy number of E. corrodens determined by Southern hybridization. Genomic DNA was cut with 1) Eco RI, 2) Hind <t>III,</t> 3) Nco I, 4) Pst I, 5) Xba I, 6) Xho I. 7) positive control. Eco RI, Hind III and Pst I show the maximum number of 4 bands
    Xba I, supplied by Jena Bioscience, used in various techniques. Bioz Stars score: 89/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xba i/product/Jena Bioscience
    Average 89 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    xba i - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    Image Search Results


    Southern blot showing copy numbers of the 16D10i-2 RNAi transgene in transformed potato lines and controls. For each plant line, 15 µg DNA was digested with 50 U Xba I and separated on a 0.8% agarose gel. 82-4, PA99N82-4 advanced breeding line;

    Journal: Journal of Nematology

    Article Title: Broad Meloidogyne Resistance in Potato Based on RNA Interference of Effector Gene 16D10

    doi:

    Figure Lengend Snippet: Southern blot showing copy numbers of the 16D10i-2 RNAi transgene in transformed potato lines and controls. For each plant line, 15 µg DNA was digested with 50 U Xba I and separated on a 0.8% agarose gel. 82-4, PA99N82-4 advanced breeding line;

    Article Snippet: For each plant line, 15 µg DNA was digested with 50 U Xba I (New England Biolabs, Ipswich, MA) for 16 hr at 37 ° C, then separated on a 0.8% agarose gel at 70 V for 16 hr and transferred to a GeneScreen Plus nylon membrane (PerkinElmer, Boston, MA) in 10× saline sodium citrate (SSC) buffer (1.5 M NaCl, 0.15 M sodium citrate, pH 7).

    Techniques: Southern Blot, Transformation Assay, Agarose Gel Electrophoresis

    Dendrogram based on Xba I PFGE types identified among 31 E. coli strains. The data were sorted by the UPGMA method. AMP-ampicillin, TET-tetracycline, SUT- trimethoprim/sulfamethoxazole, CLO-chloramphenicol, CFL-cephalothin, AMC-amoxicillin/clavulanic acid, LVX- levofloxacin, CIP-ciprofloxacin, GEN-gentamicin, CRO-ceftriaxone, CTX-cefotaxime. *Isolates that show intermediate susceptibility to cephalotin.

    Journal: Brazilian Journal of Microbiology

    Article Title: Antimicrobial resistance and genetic diversity of Escherichiacoli isolated from humans and foods

    doi: 10.1590/S1517-838246420130874

    Figure Lengend Snippet: Dendrogram based on Xba I PFGE types identified among 31 E. coli strains. The data were sorted by the UPGMA method. AMP-ampicillin, TET-tetracycline, SUT- trimethoprim/sulfamethoxazole, CLO-chloramphenicol, CFL-cephalothin, AMC-amoxicillin/clavulanic acid, LVX- levofloxacin, CIP-ciprofloxacin, GEN-gentamicin, CRO-ceftriaxone, CTX-cefotaxime. *Isolates that show intermediate susceptibility to cephalotin.

    Article Snippet: Data Analysis The Xba I (Sigma-Aldrich, USA) fingerprints were analyzed using GelCompar II software (Applied Maths, Kortrijk, Belgium).

    Techniques:

    Combined numerical analysis of PFGE results obtained after Xba I and Dra I digestions using the unweighted pair group method using arithmetic averages. A to I, individual patient isolates (A1, A2, etc., represent serial isolates from a same patient). The scale shows the Dice index.

    Journal: Journal of Clinical Microbiology

    Article Title: A Molecular Epidemiological Study of Mycobacterium simiae Isolated from AIDS Patients in Guadeloupe

    doi:

    Figure Lengend Snippet: Combined numerical analysis of PFGE results obtained after Xba I and Dra I digestions using the unweighted pair group method using arithmetic averages. A to I, individual patient isolates (A1, A2, etc., represent serial isolates from a same patient). The scale shows the Dice index.

    Article Snippet: Plugs were prepared as previously described , and bacterial DNA was digested with 30 U of Dra I or 60 U of Xba I (Gibco-BRL Life Technologies) at 37°C for 2 h. After digestion, the plugs were loaded into a 1% (wt/vol) agarose gel (Gibco BRL).

    Techniques:

    RAPD (A to D) and PFGE (E to H) profiles of M. simiae isolates. Representative RAPD patterns with the primers 4 (A) and 10 (C) for one isolate per patient and the results obtained with serial isolates from selected patients with primer 4 (B and D) are shown. Panels E and F show representative PFGE patterns obtained with Xba I- and Dra I-digested DNAs for patients with polyclonal infections. All of the 22 PFGE profiles obtained are illustrated in dendrograms shown in panels G and H. Samples for RAPD experiments were run in duplicate. T, template DNA control; M, molecular weight marker; A to I, individual patient isolates (A1, A2, etc., represent serial isolates from the same patient). The scale in panels G and H shows the Dice index.

    Journal: Journal of Clinical Microbiology

    Article Title: A Molecular Epidemiological Study of Mycobacterium simiae Isolated from AIDS Patients in Guadeloupe

    doi:

    Figure Lengend Snippet: RAPD (A to D) and PFGE (E to H) profiles of M. simiae isolates. Representative RAPD patterns with the primers 4 (A) and 10 (C) for one isolate per patient and the results obtained with serial isolates from selected patients with primer 4 (B and D) are shown. Panels E and F show representative PFGE patterns obtained with Xba I- and Dra I-digested DNAs for patients with polyclonal infections. All of the 22 PFGE profiles obtained are illustrated in dendrograms shown in panels G and H. Samples for RAPD experiments were run in duplicate. T, template DNA control; M, molecular weight marker; A to I, individual patient isolates (A1, A2, etc., represent serial isolates from the same patient). The scale in panels G and H shows the Dice index.

    Article Snippet: Plugs were prepared as previously described , and bacterial DNA was digested with 30 U of Dra I or 60 U of Xba I (Gibco-BRL Life Technologies) at 37°C for 2 h. After digestion, the plugs were loaded into a 1% (wt/vol) agarose gel (Gibco BRL).

    Techniques: Molecular Weight, Marker

    Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization

    Journal: 3 Biotech

    Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)

    doi: 10.1007/s13205-018-1552-0

    Figure Lengend Snippet: Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization

    Article Snippet: Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’.

    Techniques: Southern Blot, Molecular Weight, Marker, Hybridization

    The PCR-RFPL analysis of UGT1A9 T-275A SNP in patients. The DNA from patients was subjected to PCR followed by RFPL using XbaI digest. The reactions were resolved on 2% agarose gel electrophoresis. Lanes 1-3 and 4-6 are from two different patient hetrozygote for T-275A SNP. Lane 1, 4 are PCR products and lane 2, 3 and 5, 6 are XbaI digest of corresponding samples. The reactions were compared to 100 bp DNA ladder. (PCR-RFLP :poly chain reaction-restricted fragment length polymorphism, UGT: Uridine diphosphate glucuronosyl transferase, SNP: Single nucleotide polymorphism).

    Journal: Iranian Journal of Pharmaceutical Research : IJPR

    Article Title: Impact of UGT1A9 Polymorphism on Mycophenolic Acid Pharmacokinetic Parameters in Stable Renal Transplant Patients

    doi:

    Figure Lengend Snippet: The PCR-RFPL analysis of UGT1A9 T-275A SNP in patients. The DNA from patients was subjected to PCR followed by RFPL using XbaI digest. The reactions were resolved on 2% agarose gel electrophoresis. Lanes 1-3 and 4-6 are from two different patient hetrozygote for T-275A SNP. Lane 1, 4 are PCR products and lane 2, 3 and 5, 6 are XbaI digest of corresponding samples. The reactions were compared to 100 bp DNA ladder. (PCR-RFLP :poly chain reaction-restricted fragment length polymorphism, UGT: Uridine diphosphate glucuronosyl transferase, SNP: Single nucleotide polymorphism).

    Article Snippet: The PCR products for T-275A, C-2152T and UGT1A9*3 were digested with XbaI (Fermentas), MseI (Fermentas) and StyI (Fermentas), respectively.

    Techniques: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Dendrograms generated by BioNumerics showing the results of cluster analysis on the basis of XbaI-PFGE of S. enterica serotype Typhimurium isolates. Similarity analysis was performed using the Dice coefficient, and clustering was by the unweighted pair group method with arithmetic averages. The different PFGE profiles and corresponding numbers of isolates, the types of bla genes (if present), and the phage types are indicated.

    Journal: Journal of Clinical Microbiology

    Article Title: Multidrug Resistance in Salmonella enterica Serotype Typhimurium from Humans in France (1993 to 2003)

    doi: 10.1128/JCM.44.3.700-708.2006

    Figure Lengend Snippet: Dendrograms generated by BioNumerics showing the results of cluster analysis on the basis of XbaI-PFGE of S. enterica serotype Typhimurium isolates. Similarity analysis was performed using the Dice coefficient, and clustering was by the unweighted pair group method with arithmetic averages. The different PFGE profiles and corresponding numbers of isolates, the types of bla genes (if present), and the phage types are indicated.

    Article Snippet: PFGE using XbaI (Amersham Biosciences, Freiburg, Germany) was carried out with a CHEF-DR III system (Bio-Rad) as described previously ( ).

    Techniques: Generated

    (A) Southern blot hybridization with the p1-9 probe of XbaI-digested genomic DNAs of S. enterica serovar Typhimurium DT104 control strain BN9181 carrying SGI1 (lane 2), serovar Virchow control strain SV20 carrying SGI1-J4 (lane 3), serovar Kentucky strain

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Early Strains of Multidrug-Resistant Salmonella enterica Serovar Kentucky Sequence Type 198 from Southeast Asia Harbor Salmonella Genomic Island 1-J Variants with a Novel Insertion Sequence

    doi: 10.1128/AAC.00732-12

    Figure Lengend Snippet: (A) Southern blot hybridization with the p1-9 probe of XbaI-digested genomic DNAs of S. enterica serovar Typhimurium DT104 control strain BN9181 carrying SGI1 (lane 2), serovar Virchow control strain SV20 carrying SGI1-J4 (lane 3), serovar Kentucky strain

    Article Snippet: The atypical insertion site of the complex integrons InSGI1-J (in ORF S023) was further assessed by Southern blot hybridization of whole genomic DNA cut by XbaI (Promega, Charbonnières, France) by using probe p1-9 as previously described ( , , , ).

    Techniques: Southern Blot, Hybridization

    Pulsed field gel electrophoresis of XbaI-digested DNA from the 59 ExPEC strains included in the study . Strain designation, phylogenetic group, ST assignation, clinical and geographical origin of isolation, PFGE cluster ( > 85% similarity), and PCR result for virulence genes that exhibited significant differences within the pathogenic groups are shown at right. This unweighted pair-group method with arithmetic mean dendrogram was generated in BioNumerics software (Applied Maths, St-Martens-Latem, Belgium) by using Dice coefficient with a 1.0% band position tolerance. The scale above the dendrogram indicates percent similarity. AS: abdominal sepsis; UTI: urinary tract infection; CI: cystitis; IS: intestinal sepsis; NBM: Newborn Meningitis; US: urosepsis; P?: posible pyelonephritis; C: colibacillosis; RS: respiratory sepsis; AP: acute pyelonephritis; AB: asymptomatic bacteriuria.

    Journal: BMC Microbiology

    Article Title: Extraintestinal pathogenic Escherichia coli O1:K1:H7/NM from human and avian origin: detection of clonal groups B2 ST95 and D ST59 with different host distribution

    doi: 10.1186/1471-2180-9-132

    Figure Lengend Snippet: Pulsed field gel electrophoresis of XbaI-digested DNA from the 59 ExPEC strains included in the study . Strain designation, phylogenetic group, ST assignation, clinical and geographical origin of isolation, PFGE cluster ( > 85% similarity), and PCR result for virulence genes that exhibited significant differences within the pathogenic groups are shown at right. This unweighted pair-group method with arithmetic mean dendrogram was generated in BioNumerics software (Applied Maths, St-Martens-Latem, Belgium) by using Dice coefficient with a 1.0% band position tolerance. The scale above the dendrogram indicates percent similarity. AS: abdominal sepsis; UTI: urinary tract infection; CI: cystitis; IS: intestinal sepsis; NBM: Newborn Meningitis; US: urosepsis; P?: posible pyelonephritis; C: colibacillosis; RS: respiratory sepsis; AP: acute pyelonephritis; AB: asymptomatic bacteriuria.

    Article Snippet: Pulse Field Gel Electrophoresis (PFGE) Cleavage of the agarose-embedded DNA was achieved with 0.2 U/μl XbaI (Roche) according to instructions of the manufacturer.

    Techniques: Pulsed-Field Gel, Electrophoresis, Isolation, Polymerase Chain Reaction, Generated, Software, Infection

    Genetic organization of the antibiotic resistance gene cluster of SGI1 and the new SGI1-H variant of serovar Newport strains 01-2174 and 01-5348. The direction of transcription of the genes is indicated by arrows. Black and gray arrows correspond to SGI1 antibiotic resistance genes and chromosomal genes flanking SGI1, respectively. DR-L and DR-R are the left and right direct repeats, respectively, bracketing SGI1. IRi and IRt are 25-bp imperfect inverted repeats defining the left and right ends of complex class 1 integrons. PCRs used to assess the genetic organization of the antibiotic resistance genes (i.e., PCRs floR , A, B, C, D, E, and F) and the SGI1 junctions to the chromosome (i.e., PCRs LJ and RJ for left and right junctions, respectively) are indicated. Restriction sites: X, XbaI; H, HindIII.

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Variant Salmonella Genomic Island 1 Antibiotic Resistance Gene Cluster Containing a Novel 3?-N-Aminoglycoside Acetyltransferase Gene Cassette, aac(3)-Id, in Salmonella enterica Serovar Newport

    doi: 10.1128/AAC.48.10.3806-3812.2004

    Figure Lengend Snippet: Genetic organization of the antibiotic resistance gene cluster of SGI1 and the new SGI1-H variant of serovar Newport strains 01-2174 and 01-5348. The direction of transcription of the genes is indicated by arrows. Black and gray arrows correspond to SGI1 antibiotic resistance genes and chromosomal genes flanking SGI1, respectively. DR-L and DR-R are the left and right direct repeats, respectively, bracketing SGI1. IRi and IRt are 25-bp imperfect inverted repeats defining the left and right ends of complex class 1 integrons. PCRs used to assess the genetic organization of the antibiotic resistance genes (i.e., PCRs floR , A, B, C, D, E, and F) and the SGI1 junctions to the chromosome (i.e., PCRs LJ and RJ for left and right junctions, respectively) are indicated. Restriction sites: X, XbaI; H, HindIII.

    Article Snippet: The presence of entire SGI1 was also assessed by Southern blotting of genomic DNA cut by XbaI (Qbiogene) by using probe p1-9 as previously described ( ).

    Techniques: Variant Assay

    Macrorestriction analysis by PFGE of genomic DNAs cut by XbaI of serovar Newport strains: SGI1-H-carrying strain 01-2174 (lane 1), SGI1-H-carrying strain 01-5348 (lane 2), non-SGI1 strain 01-8181 isolated in France in 2001 (lane 3), and serovar Newport control strains from the French National Reference Center for Salmonella collection (lanes 4 and 5).

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Variant Salmonella Genomic Island 1 Antibiotic Resistance Gene Cluster Containing a Novel 3?-N-Aminoglycoside Acetyltransferase Gene Cassette, aac(3)-Id, in Salmonella enterica Serovar Newport

    doi: 10.1128/AAC.48.10.3806-3812.2004

    Figure Lengend Snippet: Macrorestriction analysis by PFGE of genomic DNAs cut by XbaI of serovar Newport strains: SGI1-H-carrying strain 01-2174 (lane 1), SGI1-H-carrying strain 01-5348 (lane 2), non-SGI1 strain 01-8181 isolated in France in 2001 (lane 3), and serovar Newport control strains from the French National Reference Center for Salmonella collection (lanes 4 and 5).

    Article Snippet: The presence of entire SGI1 was also assessed by Southern blotting of genomic DNA cut by XbaI (Qbiogene) by using probe p1-9 as previously described ( ).

    Techniques: Isolation

    Fingerprinting profiles (A to S) of XbaI-digested genomic DNA using the Dice coefficient and UPGMA for Klebsiella pneumoniae cerebrospinal fluid isolates collected in Taiwan. Eight pulsotypes (C, E, H, I, J, N, P, and R) show a Dice similarity coefficient of more than 80%. Corresponding MLST (multilocus sequence typing) and capsule K serotype of each isolate were presented. *One nucleotide change; x, unidentified, non-virulent capsule K types, i.e., not for K1, K2, K5, K20, K54, K57 types.

    Journal: Scientific Reports

    Article Title: Klebsiella pneumoniae Isolates from Meningitis: Epidemiology, Virulence and Antibiotic Resistance

    doi: 10.1038/s41598-017-06878-6

    Figure Lengend Snippet: Fingerprinting profiles (A to S) of XbaI-digested genomic DNA using the Dice coefficient and UPGMA for Klebsiella pneumoniae cerebrospinal fluid isolates collected in Taiwan. Eight pulsotypes (C, E, H, I, J, N, P, and R) show a Dice similarity coefficient of more than 80%. Corresponding MLST (multilocus sequence typing) and capsule K serotype of each isolate were presented. *One nucleotide change; x, unidentified, non-virulent capsule K types, i.e., not for K1, K2, K5, K20, K54, K57 types.

    Article Snippet: Whole chromosomal DNA in agarose was digested with XbaI (Bio-Rad Laboratories, CA., USA), and the restriction fragments were separated in a CHEF Mapper XA System (Bio-Rad Laboratories, CA., USA).

    Techniques: Sequencing

    OesDHN genomic organization. (A) Scheme of OesDHN gene. The black rectangle indicates intron position with respect to the cDNA. Start and stop codons are typed. (C) Deduced nucleotides of OesDHN cDNA and its 5′ upstream region and features of Oes DHN protein. The ATG start and TAA stop codons are indicated in bold; the stop codon position is indicated by the asterisk. The intron sequence, including the putative TATA-box (bold) is highlighted. The putative ABRE, G-box, MYB, GATA, CAAT-box elements are also indicated. Predicted amino acids are shown in one letter code. The S-segment is shown with an interrupted line, and the two K-segments are shown in bold italics and underlined with a single line. The putative NLS (nuclear localization signal) is double underlined and the poly-proline cluster is shown with one single line. The intronic region is represented with italic lowercases. (B) Southern blot analysis. The oleaster gDNA was digested with EcoRI and XbaI and hybridized with the cDNA probe, indicated in (A) . The molecular weights of a co-migrating DNA marker are expressed in kilo base pairs (Kb). PR, promoter region; UTR, Untranslated region. Bar 200 bp (A) .

    Journal: Frontiers in Plant Science

    Article Title: A dehydrin gene isolated from feral olive enhances drought tolerance in Arabidopsis transgenic plants

    doi: 10.3389/fpls.2015.00392

    Figure Lengend Snippet: OesDHN genomic organization. (A) Scheme of OesDHN gene. The black rectangle indicates intron position with respect to the cDNA. Start and stop codons are typed. (C) Deduced nucleotides of OesDHN cDNA and its 5′ upstream region and features of Oes DHN protein. The ATG start and TAA stop codons are indicated in bold; the stop codon position is indicated by the asterisk. The intron sequence, including the putative TATA-box (bold) is highlighted. The putative ABRE, G-box, MYB, GATA, CAAT-box elements are also indicated. Predicted amino acids are shown in one letter code. The S-segment is shown with an interrupted line, and the two K-segments are shown in bold italics and underlined with a single line. The putative NLS (nuclear localization signal) is double underlined and the poly-proline cluster is shown with one single line. The intronic region is represented with italic lowercases. (B) Southern blot analysis. The oleaster gDNA was digested with EcoRI and XbaI and hybridized with the cDNA probe, indicated in (A) . The molecular weights of a co-migrating DNA marker are expressed in kilo base pairs (Kb). PR, promoter region; UTR, Untranslated region. Bar 200 bp (A) .

    Article Snippet: Briefly, after extraction and purification, gDNA (10 μg) was digested overnight at 37°C with EcoRV and XbaI endonucleases (Promega, Italy), which do not cut in the probe.

    Techniques: Sequencing, Southern Blot, Marker

    PFGE profiles of representative S. enterica subsp. enterica strains after digestion with XbaI. As a molecular weight standard (M), S. enterica serovar Braenderup reference strain H9812 was used (lanes 1, 15, and 20). Lanes 2 to 14 represent the 13 different

    Journal:

    Article Title: Poultry-Associated Salmonella enterica subsp. enterica Serovar 4,12:d:- Reveals High Clonality and a Distinct Pathogenicity Gene Repertoire ▿ Serovar 4,12:d:- Reveals High Clonality and a Distinct Pathogenicity Gene Repertoire ▿ †

    doi: 10.1128/AEM.02187-08

    Figure Lengend Snippet: PFGE profiles of representative S. enterica subsp. enterica strains after digestion with XbaI. As a molecular weight standard (M), S. enterica serovar Braenderup reference strain H9812 was used (lanes 1, 15, and 20). Lanes 2 to 14 represent the 13 different

    Article Snippet: PFGE using the restriction enzyme XbaI (Roche Diagnostics, Mannheim, Germany) was performed according to the standardized PulseNet Salmonella protocol ( ).

    Techniques: Molecular Weight

    a The differences in plasmid number from a selection of bacteria isolates. Several isolates contained up to eight plasmids b S1-PFGE and Southern blotting of plasmids carrying NDM-1 from clinical isolates. Pulsed-field gel of S1-treated plasmid DNA of selected Enterobacteriaceae from clinical isolates stained with ethidium bromide. The molecular weight marker is S. braenderup H9812 cut with XbaI ( A ). Autodiagram of gel A showing plasmids carrying NDM-1 ( B )

    Journal: European Journal of Clinical Microbiology & Infectious Diseases

    Article Title: Common isolation of New Delhi metallo-beta-lactamase 1-producing Enterobacteriaceae in a large surgical hospital in Vietnam

    doi: 10.1007/s10096-015-2345-6

    Figure Lengend Snippet: a The differences in plasmid number from a selection of bacteria isolates. Several isolates contained up to eight plasmids b S1-PFGE and Southern blotting of plasmids carrying NDM-1 from clinical isolates. Pulsed-field gel of S1-treated plasmid DNA of selected Enterobacteriaceae from clinical isolates stained with ethidium bromide. The molecular weight marker is S. braenderup H9812 cut with XbaI ( A ). Autodiagram of gel A showing plasmids carrying NDM-1 ( B )

    Article Snippet: NDM-1-positive bacterial isolates were genotyped by pulsed-field gel electrophoresis (PFGE), using XbaI restriction enzyme (Roche Diagnostic, Mannheim, Germany) to digest the bacterial genomes in agarose blocks.

    Techniques: Plasmid Preparation, Selection, Southern Blot, Pulsed-Field Gel, Staining, Molecular Weight, Marker

    Gel image of PFGE result. Genomic DNA was digested using XbaI enzyme and subjected to pulsed-field gel electrophoresis.

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Clinical and Molecular Characteristics of Emerging Hypervirulent Klebsiella pneumoniae Bloodstream Infections in Mainland China

    doi: 10.1128/AAC.02523-14

    Figure Lengend Snippet: Gel image of PFGE result. Genomic DNA was digested using XbaI enzyme and subjected to pulsed-field gel electrophoresis.

    Article Snippet: Whole-cell genomic DNA representing each isolate was digested with the restriction enzyme XbaI (TaKaRa Biotechnology, Dalian, China) and separated by electrophoresis through 1% pulsed-field certified agarose (Bio-Rad, Richmond, CA, USA) by using a CHEF-Mapper (Bio-Rad).

    Techniques: Pulsed-Field Gel, Electrophoresis

    Point mutation in Hras gene in DMBA/TPA treated cells. ( A ) The A > T substitution causes the appearance of XbaI consensus site ( B ) XbaI digestion of Hras in MEF (left lane) and 308 cells (right lane). Two restriction fragments of 300 and 400 bp emerge in mutated Hras resulting from cleavage of full length 700 bp replicon in the newly formed XbaI restriction site. ( C ) Sequencing of Hras codon 61 reveals A > T transversion in of 308 cell line which is derived from early DMBA/TPA induced papillomas (ii). Mouse embryonic fibroblasts (MEFs) hold the typical A allele (i) .

    Journal: PLoS ONE

    Article Title: SNP Detection in mRNA in Living Cells Using Allele Specific FRET Probes

    doi: 10.1371/journal.pone.0072389

    Figure Lengend Snippet: Point mutation in Hras gene in DMBA/TPA treated cells. ( A ) The A > T substitution causes the appearance of XbaI consensus site ( B ) XbaI digestion of Hras in MEF (left lane) and 308 cells (right lane). Two restriction fragments of 300 and 400 bp emerge in mutated Hras resulting from cleavage of full length 700 bp replicon in the newly formed XbaI restriction site. ( C ) Sequencing of Hras codon 61 reveals A > T transversion in of 308 cell line which is derived from early DMBA/TPA induced papillomas (ii). Mouse embryonic fibroblasts (MEFs) hold the typical A allele (i) .

    Article Snippet: Primers sequence was as listed below: Forward : ctatagaggtgagctctgcctacc Reverse : ctacattgaaacatcagccaagac To confirm Hras mutation, restriction digestion was carried using XbaI restriction enzyme (Takara).

    Techniques: Mutagenesis, Sequencing, Derivative Assay

    16S copy number of E. corrodens determined by Southern hybridization. Genomic DNA was cut with 1) Eco RI, 2) Hind III, 3) Nco I, 4) Pst I, 5) Xba I, 6) Xho I. 7) positive control. Eco RI, Hind III and Pst I show the maximum number of 4 bands

    Journal: BMC Oral Health

    Article Title: Development of a point-of-care-device for fast detection of periodontal pathogens

    doi: 10.1186/s12903-015-0155-y

    Figure Lengend Snippet: 16S copy number of E. corrodens determined by Southern hybridization. Genomic DNA was cut with 1) Eco RI, 2) Hind III, 3) Nco I, 4) Pst I, 5) Xba I, 6) Xho I. 7) positive control. Eco RI, Hind III and Pst I show the maximum number of 4 bands

    Article Snippet: Southern blot To determine the 16S copy number of E. corrodens via Southern Blot, approximately 10 μg DNA were digested with restriction enzymes Eco RI HF, Hind III (New England Biolabs, Ipswich, USA), Nco I, Pst I, Xba I (Jena Bioscience GmbH, Jena, Germany) and Xho I FD (Thermo Fisher Scientific, Waltham, USA) at 37 °C overnight.

    Techniques: Hybridization, Positive Control