xbai Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs xbai
    Generation of a trxA deletion mutant. A schematic representation of the WT A. baumannii Ci79 and Δ trxA mutant genome surrounding the trxA locus with predicted fragment sizes detected by probe following either HindIII (white arrowhead) or <t>XbaI</t> (black arrowhead) digestion as well as probe target region (dotted box) (A). Southern blot (B) and Western blot (C) analyses of genomic and protein extracts, respectively, from WT Ci79, ΔtrxA , and ΔtrxA c A. baumannii were subsequently performed. PCR amplification of the trxA gene locus was performed using <t>DNA</t> from WT Ci79, ΔtrxA , and ΔtrxA c A. baumannii isolates. The PCR amplicons were subsequently digested with SalI and subjected to agarose gel electrophoresis (C). Total bacterial proteins were separated by electrophoresis and visualized in a Coomassie blue-stained polyacrylamide gel (D, left panel) or probed with anti-TrxA antibody to detect TrxA expression (D, right panel). Molecular marker sizes for DNA (bp; B and C) and protein (kDa; D) are provided.
    Xbai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4990 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/New England Biolabs
    Average 99 stars, based on 4990 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher endonuclease xbai
    Stable transfection confirms that PAG sequences reduce transcription and steady-state levels of mRNAs from genes in the vicinity. ( A ) Schematic diagram of a bicistronic construct based on the two procyclin genes in the EP/PAG1 locus. Fragments derived from PAG1 were inserted into the unique <t>XbaI</t> site (X) in the forward or reverse orientation. ( B ) Northern blots were hybridized sequentially with probes corresponding to the open reading frames of <t>CAT</t> and BLE, then normalized with α-tubulin. ( C ) Nuclear run-on analysis of BLE and CAT in selected clones. Other single-stranded probes are as described in the legend to Figure 5 . The MARP signals minus background levels were set as 1 for each clone.
    Endonuclease Xbai, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 197 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/endonuclease xbai/product/Thermo Fisher
    Average 99 stars, based on 197 article reviews
    Price from $9.99 to $1999.99
    endonuclease xbai - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher fastdigest xbai
    Stable transfection confirms that PAG sequences reduce transcription and steady-state levels of mRNAs from genes in the vicinity. ( A ) Schematic diagram of a bicistronic construct based on the two procyclin genes in the EP/PAG1 locus. Fragments derived from PAG1 were inserted into the unique <t>XbaI</t> site (X) in the forward or reverse orientation. ( B ) Northern blots were hybridized sequentially with probes corresponding to the open reading frames of <t>CAT</t> and BLE, then normalized with α-tubulin. ( C ) Nuclear run-on analysis of BLE and CAT in selected clones. Other single-stranded probes are as described in the legend to Figure 5 . The MARP signals minus background levels were set as 1 for each clone.
    Fastdigest Xbai, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 87 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fastdigest xbai/product/Thermo Fisher
    Average 99 stars, based on 87 article reviews
    Price from $9.99 to $1999.99
    fastdigest xbai - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    92
    GE Healthcare xbai
    Dendrograms generated by BioNumerics showing the results of cluster analysis on the basis of <t>XbaI-PFGE</t> of S. enterica serotype Typhimurium isolates. Similarity analysis was performed using the Dice coefficient, and clustering was by the unweighted pair group method with arithmetic averages. The different PFGE profiles and corresponding numbers of isolates, the types of bla genes (if present), and the phage types are indicated.
    Xbai, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 312 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/GE Healthcare
    Average 92 stars, based on 312 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    99
    Promega xbai
    (A) Southern blot hybridization with the <t>p1-9</t> probe of <t>XbaI-digested</t> genomic DNAs of S. enterica serovar Typhimurium DT104 control strain BN9181 carrying SGI1 (lane 2), serovar Virchow control strain SV20 carrying SGI1-J4 (lane 3), serovar Kentucky strain
    Xbai, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 2300 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Promega
    Average 99 stars, based on 2300 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    xbai  (Roche)
    94
    Roche xbai
    Pulsed field gel electrophoresis of <t>XbaI-digested</t> DNA from the 59 ExPEC strains included in the study . Strain designation, phylogenetic group, ST assignation, clinical and geographical origin of isolation, <t>PFGE</t> cluster ( > 85% similarity), and PCR result for virulence genes that exhibited significant differences within the pathogenic groups are shown at right. This unweighted pair-group method with arithmetic mean dendrogram was generated in BioNumerics software (Applied Maths, St-Martens-Latem, Belgium) by using Dice coefficient with a 1.0% band position tolerance. The scale above the dendrogram indicates percent similarity. AS: abdominal sepsis; UTI: urinary tract infection; CI: cystitis; IS: intestinal sepsis; NBM: Newborn Meningitis; US: urosepsis; P?: posible pyelonephritis; C: colibacillosis; RS: respiratory sepsis; AP: acute pyelonephritis; AB: asymptomatic bacteriuria.
    Xbai, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 489 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Roche
    Average 94 stars, based on 489 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    86
    Boehringer Mannheim xbai
    Pulsed field gel electrophoresis of <t>XbaI-digested</t> DNA from the 59 ExPEC strains included in the study . Strain designation, phylogenetic group, ST assignation, clinical and geographical origin of isolation, <t>PFGE</t> cluster ( > 85% similarity), and PCR result for virulence genes that exhibited significant differences within the pathogenic groups are shown at right. This unweighted pair-group method with arithmetic mean dendrogram was generated in BioNumerics software (Applied Maths, St-Martens-Latem, Belgium) by using Dice coefficient with a 1.0% band position tolerance. The scale above the dendrogram indicates percent similarity. AS: abdominal sepsis; UTI: urinary tract infection; CI: cystitis; IS: intestinal sepsis; NBM: Newborn Meningitis; US: urosepsis; P?: posible pyelonephritis; C: colibacillosis; RS: respiratory sepsis; AP: acute pyelonephritis; AB: asymptomatic bacteriuria.
    Xbai, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 86/100, based on 58 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Boehringer Mannheim
    Average 86 stars, based on 58 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    93
    Bio-Rad xbai
    Fingerprinting profiles (A to S) of <t>XbaI-digested</t> genomic <t>DNA</t> using the Dice coefficient and UPGMA for Klebsiella pneumoniae cerebrospinal fluid isolates collected in Taiwan. Eight pulsotypes (C, E, H, I, J, N, P, and R) show a Dice similarity coefficient of more than 80%. Corresponding MLST (multilocus sequence typing) and capsule K serotype of each isolate were presented. *One nucleotide change; x, unidentified, non-virulent capsule K types, i.e., not for K1, K2, K5, K20, K54, K57 types.
    Xbai, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 207 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Bio-Rad
    Average 93 stars, based on 207 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    97
    Cell Signaling Technology Inc xbai
    Fingerprinting profiles (A to S) of <t>XbaI-digested</t> genomic <t>DNA</t> using the Dice coefficient and UPGMA for Klebsiella pneumoniae cerebrospinal fluid isolates collected in Taiwan. Eight pulsotypes (C, E, H, I, J, N, P, and R) show a Dice similarity coefficient of more than 80%. Corresponding MLST (multilocus sequence typing) and capsule K serotype of each isolate were presented. *One nucleotide change; x, unidentified, non-virulent capsule K types, i.e., not for K1, K2, K5, K20, K54, K57 types.
    Xbai, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Cell Signaling Technology Inc
    Average 97 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-04
    97/100 stars
      Buy from Supplier

    86
    Valiant xbai
    Genetic organization of the antibiotic resistance gene cluster of <t>SGI1</t> and the new SGI1-H variant of serovar Newport strains 01-2174 and 01-5348. The direction of transcription of the genes is indicated by arrows. Black and gray arrows correspond to SGI1 antibiotic resistance genes and chromosomal genes flanking SGI1, respectively. DR-L and DR-R are the left and right direct repeats, respectively, bracketing SGI1. IRi and IRt are 25-bp imperfect inverted repeats defining the left and right ends of complex class 1 integrons. PCRs used to assess the genetic organization of the antibiotic resistance genes (i.e., PCRs floR , A, B, C, D, E, and F) and the SGI1 junctions to the chromosome (i.e., PCRs LJ and RJ for left and right junctions, respectively) are indicated. Restriction sites: X, <t>XbaI;</t> H, HindIII.
    Xbai, supplied by Valiant, used in various techniques. Bioz Stars score: 86/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Valiant
    Average 86 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    xbai  (TaKaRa)
    99
    TaKaRa xbai
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Xbai, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1108 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/TaKaRa
    Average 99 stars, based on 1108 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    92
    GenScript xbai
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Xbai, supplied by GenScript, used in various techniques. Bioz Stars score: 92/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/GenScript
    Average 92 stars, based on 66 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    xbai  (Toyobo)
    86
    Toyobo xbai
    Genetic relatedness of E. coli isolates with class 1 integrons indicated by <t>XbaI</t> -digested chromosomal <t>DNA</t>
    Xbai, supplied by Toyobo, used in various techniques. Bioz Stars score: 86/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Toyobo
    Average 86 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    96
    Jena Bioscience xba i
    16S copy number of E. corrodens determined by Southern hybridization. Genomic DNA was cut with 1) Eco RI, 2) Hind <t>III,</t> 3) Nco I, 4) Pst I, 5) Xba I, 6) Xho I. 7) positive control. Eco RI, Hind III and Pst I show the maximum number of 4 bands
    Xba I, supplied by Jena Bioscience, used in various techniques. Bioz Stars score: 96/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xba i/product/Jena Bioscience
    Average 96 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    xba i - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    99
    Millipore xbai
    Linear view of consensus optical maps with <t>DNA</t> sequence-based maps. Solid black arrows represent the locations of missing cuts in the consensus optical maps. The <t>XbaI</t> and NheI consensus optical maps extend to the left of the origin of the DNA sequence-based map because both optical maps had a missing cut at that position.
    Xbai, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 579 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Millipore
    Average 99 stars, based on 579 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher bbft2 xbai
    Linear view of consensus optical maps with <t>DNA</t> sequence-based maps. Solid black arrows represent the locations of missing cuts in the consensus optical maps. The <t>XbaI</t> and NheI consensus optical maps extend to the left of the origin of the DNA sequence-based map because both optical maps had a missing cut at that position.
    Bbft2 Xbai, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bbft2 xbai/product/Thermo Fisher
    Average 99 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    bbft2 xbai - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    93
    Thermo Fisher bamhi xbai
    Linear view of consensus optical maps with <t>DNA</t> sequence-based maps. Solid black arrows represent the locations of missing cuts in the consensus optical maps. The <t>XbaI</t> and NheI consensus optical maps extend to the left of the origin of the DNA sequence-based map because both optical maps had a missing cut at that position.
    Bamhi Xbai, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 65 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi xbai/product/Thermo Fisher
    Average 93 stars, based on 65 article reviews
    Price from $9.99 to $1999.99
    bamhi xbai - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    93
    Promega enzyme xbai
    Linear view of consensus optical maps with <t>DNA</t> sequence-based maps. Solid black arrows represent the locations of missing cuts in the consensus optical maps. The <t>XbaI</t> and NheI consensus optical maps extend to the left of the origin of the DNA sequence-based map because both optical maps had a missing cut at that position.
    Enzyme Xbai, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/enzyme xbai/product/Promega
    Average 93 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    enzyme xbai - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    92
    Promega hindiii xbai
    Linear view of consensus optical maps with <t>DNA</t> sequence-based maps. Solid black arrows represent the locations of missing cuts in the consensus optical maps. The <t>XbaI</t> and NheI consensus optical maps extend to the left of the origin of the DNA sequence-based map because both optical maps had a missing cut at that position.
    Hindiii Xbai, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hindiii xbai/product/Promega
    Average 92 stars, based on 34 article reviews
    Price from $9.99 to $1999.99
    hindiii xbai - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    93
    Thermo Fisher hindiii xbai
    Linear view of consensus optical maps with <t>DNA</t> sequence-based maps. Solid black arrows represent the locations of missing cuts in the consensus optical maps. The <t>XbaI</t> and NheI consensus optical maps extend to the left of the origin of the DNA sequence-based map because both optical maps had a missing cut at that position.
    Hindiii Xbai, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hindiii xbai/product/Thermo Fisher
    Average 93 stars, based on 66 article reviews
    Price from $9.99 to $1999.99
    hindiii xbai - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    95
    Thermo Fisher xbai noti
    Linear view of consensus optical maps with <t>DNA</t> sequence-based maps. Solid black arrows represent the locations of missing cuts in the consensus optical maps. The <t>XbaI</t> and NheI consensus optical maps extend to the left of the origin of the DNA sequence-based map because both optical maps had a missing cut at that position.
    Xbai Noti, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai noti/product/Thermo Fisher
    Average 95 stars, based on 34 article reviews
    Price from $9.99 to $1999.99
    xbai noti - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    91
    Roche xbai enzyme
    Linear view of consensus optical maps with <t>DNA</t> sequence-based maps. Solid black arrows represent the locations of missing cuts in the consensus optical maps. The <t>XbaI</t> and NheI consensus optical maps extend to the left of the origin of the DNA sequence-based map because both optical maps had a missing cut at that position.
    Xbai Enzyme, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai enzyme/product/Roche
    Average 91 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    xbai enzyme - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    96
    Thermo Fisher xbai fd
    Linear view of consensus optical maps with <t>DNA</t> sequence-based maps. Solid black arrows represent the locations of missing cuts in the consensus optical maps. The <t>XbaI</t> and NheI consensus optical maps extend to the left of the origin of the DNA sequence-based map because both optical maps had a missing cut at that position.
    Xbai Fd, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai fd/product/Thermo Fisher
    Average 96 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    xbai fd - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    88
    Promega xbai endonucleases
    OesDHN genomic organization. (A) Scheme of OesDHN gene. The black rectangle indicates intron position with respect to the cDNA. Start and stop codons are typed. (C) Deduced nucleotides of OesDHN cDNA and its 5′ upstream region and features of Oes DHN protein. The ATG start and TAA stop codons are indicated in bold; the stop codon position is indicated by the asterisk. The intron sequence, including the putative TATA-box (bold) is highlighted. The putative ABRE, G-box, MYB, GATA, CAAT-box elements are also indicated. Predicted amino acids are shown in one letter code. The S-segment is shown with an interrupted line, and the two K-segments are shown in bold italics and underlined with a single line. The putative NLS (nuclear localization signal) is double underlined and the poly-proline cluster is shown with one single line. The intronic region is represented with italic lowercases. (B) Southern blot analysis. The oleaster <t>gDNA</t> was digested with EcoRI and <t>XbaI</t> and hybridized with the cDNA probe, indicated in (A) . The molecular weights of a co-migrating DNA marker are expressed in kilo base pairs (Kb). PR, promoter region; UTR, Untranslated region. Bar 200 bp (A) .
    Xbai Endonucleases, supplied by Promega, used in various techniques. Bioz Stars score: 88/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai endonucleases/product/Promega
    Average 88 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    xbai endonucleases - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    85
    Thermo Fisher xbai nhei
    OesDHN genomic organization. (A) Scheme of OesDHN gene. The black rectangle indicates intron position with respect to the cDNA. Start and stop codons are typed. (C) Deduced nucleotides of OesDHN cDNA and its 5′ upstream region and features of Oes DHN protein. The ATG start and TAA stop codons are indicated in bold; the stop codon position is indicated by the asterisk. The intron sequence, including the putative TATA-box (bold) is highlighted. The putative ABRE, G-box, MYB, GATA, CAAT-box elements are also indicated. Predicted amino acids are shown in one letter code. The S-segment is shown with an interrupted line, and the two K-segments are shown in bold italics and underlined with a single line. The putative NLS (nuclear localization signal) is double underlined and the poly-proline cluster is shown with one single line. The intronic region is represented with italic lowercases. (B) Southern blot analysis. The oleaster <t>gDNA</t> was digested with EcoRI and <t>XbaI</t> and hybridized with the cDNA probe, indicated in (A) . The molecular weights of a co-migrating DNA marker are expressed in kilo base pairs (Kb). PR, promoter region; UTR, Untranslated region. Bar 200 bp (A) .
    Xbai Nhei, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai nhei/product/Thermo Fisher
    Average 85 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    xbai nhei - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    95
    TaKaRa xhoi xbai
    OesDHN genomic organization. (A) Scheme of OesDHN gene. The black rectangle indicates intron position with respect to the cDNA. Start and stop codons are typed. (C) Deduced nucleotides of OesDHN cDNA and its 5′ upstream region and features of Oes DHN protein. The ATG start and TAA stop codons are indicated in bold; the stop codon position is indicated by the asterisk. The intron sequence, including the putative TATA-box (bold) is highlighted. The putative ABRE, G-box, MYB, GATA, CAAT-box elements are also indicated. Predicted amino acids are shown in one letter code. The S-segment is shown with an interrupted line, and the two K-segments are shown in bold italics and underlined with a single line. The putative NLS (nuclear localization signal) is double underlined and the poly-proline cluster is shown with one single line. The intronic region is represented with italic lowercases. (B) Southern blot analysis. The oleaster <t>gDNA</t> was digested with EcoRI and <t>XbaI</t> and hybridized with the cDNA probe, indicated in (A) . The molecular weights of a co-migrating DNA marker are expressed in kilo base pairs (Kb). PR, promoter region; UTR, Untranslated region. Bar 200 bp (A) .
    Xhoi Xbai, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xhoi xbai/product/TaKaRa
    Average 95 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    xhoi xbai - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    85
    Valiant xbai enzyme
    OesDHN genomic organization. (A) Scheme of OesDHN gene. The black rectangle indicates intron position with respect to the cDNA. Start and stop codons are typed. (C) Deduced nucleotides of OesDHN cDNA and its 5′ upstream region and features of Oes DHN protein. The ATG start and TAA stop codons are indicated in bold; the stop codon position is indicated by the asterisk. The intron sequence, including the putative TATA-box (bold) is highlighted. The putative ABRE, G-box, MYB, GATA, CAAT-box elements are also indicated. Predicted amino acids are shown in one letter code. The S-segment is shown with an interrupted line, and the two K-segments are shown in bold italics and underlined with a single line. The putative NLS (nuclear localization signal) is double underlined and the poly-proline cluster is shown with one single line. The intronic region is represented with italic lowercases. (B) Southern blot analysis. The oleaster <t>gDNA</t> was digested with EcoRI and <t>XbaI</t> and hybridized with the cDNA probe, indicated in (A) . The molecular weights of a co-migrating DNA marker are expressed in kilo base pairs (Kb). PR, promoter region; UTR, Untranslated region. Bar 200 bp (A) .
    Xbai Enzyme, supplied by Valiant, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai enzyme/product/Valiant
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    xbai enzyme - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    95
    TaKaRa restriction enzyme xbai
    Gel image of PFGE result. Genomic <t>DNA</t> was digested using <t>XbaI</t> enzyme and subjected to pulsed-field gel electrophoresis.
    Restriction Enzyme Xbai, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 37 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzyme xbai/product/TaKaRa
    Average 95 stars, based on 37 article reviews
    Price from $9.99 to $1999.99
    restriction enzyme xbai - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    Image Search Results


    Generation of a trxA deletion mutant. A schematic representation of the WT A. baumannii Ci79 and Δ trxA mutant genome surrounding the trxA locus with predicted fragment sizes detected by probe following either HindIII (white arrowhead) or XbaI (black arrowhead) digestion as well as probe target region (dotted box) (A). Southern blot (B) and Western blot (C) analyses of genomic and protein extracts, respectively, from WT Ci79, ΔtrxA , and ΔtrxA c A. baumannii were subsequently performed. PCR amplification of the trxA gene locus was performed using DNA from WT Ci79, ΔtrxA , and ΔtrxA c A. baumannii isolates. The PCR amplicons were subsequently digested with SalI and subjected to agarose gel electrophoresis (C). Total bacterial proteins were separated by electrophoresis and visualized in a Coomassie blue-stained polyacrylamide gel (D, left panel) or probed with anti-TrxA antibody to detect TrxA expression (D, right panel). Molecular marker sizes for DNA (bp; B and C) and protein (kDa; D) are provided.

    Journal: mBio

    Article Title: Acinetobacter baumannii Gastrointestinal Colonization Is Facilitated by Secretory IgA Which Is Reductively Dissociated by Bacterial Thioredoxin A

    doi: 10.1128/mBio.01298-18

    Figure Lengend Snippet: Generation of a trxA deletion mutant. A schematic representation of the WT A. baumannii Ci79 and Δ trxA mutant genome surrounding the trxA locus with predicted fragment sizes detected by probe following either HindIII (white arrowhead) or XbaI (black arrowhead) digestion as well as probe target region (dotted box) (A). Southern blot (B) and Western blot (C) analyses of genomic and protein extracts, respectively, from WT Ci79, ΔtrxA , and ΔtrxA c A. baumannii were subsequently performed. PCR amplification of the trxA gene locus was performed using DNA from WT Ci79, ΔtrxA , and ΔtrxA c A. baumannii isolates. The PCR amplicons were subsequently digested with SalI and subjected to agarose gel electrophoresis (C). Total bacterial proteins were separated by electrophoresis and visualized in a Coomassie blue-stained polyacrylamide gel (D, left panel) or probed with anti-TrxA antibody to detect TrxA expression (D, right panel). Molecular marker sizes for DNA (bp; B and C) and protein (kDa; D) are provided.

    Article Snippet: Genomic DNAs from Ci79, Δ trxA , and Δ trxA c strains were isolated using the GeneJET genomic DNA purification kit (Thermo Scientific, Rockford, IL), digested with XbaI or HindIII (New England BioLabs), and run on an 0.8% agarose gel at 16 V until completion.

    Techniques: Mutagenesis, Southern Blot, Western Blot, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Electrophoresis, Staining, Expressing, Marker

    Generation of AS knockout in P. berghei . ( a ) Double cross-over recombination strategy followed to generate Pb ASKO. ( b ) PCR analysis for genomic DNA isolated from Pb WT and Pb ASKO parasites. Lane 1 and 3: PCR with Pb AS-specific primers; Lane 2 and 4: PCR with Pb GAPDH-specific primers (control); Lane M: 1 kb DNA ladder. ( c ) RT-PCR analysis for RNA isolated from Pb WT and Pb ASKO parasites. Lane 1 and 3: RT-PCR with Pb AS-specific primers; Lane 2 and 4: RT-PCR with Pb GAPDH specific primers (control); Lane M: 1 kb DNA ladder. ( d ) Southern analysis for genomic DNA isolated from Pb WT and Pb ASKO parasites. Transgenic plasmid (TP) was also included as control to rule out the presence of any episomes. Genomic DNA preparations and TP were digested with BsrGI and XbaI followed by hybridization with 5′-UTR specific probe. ( e ) Northern analysis for RNA isolated from Pb WT and Pb ASKO parasites indicating the absence of AS mRNA (1.75 kb) in Pb ASKO. For control, GAPDH (1.01 kb; lower panel) was used (full blots are shown in Supplementary Fig. 6 ). ( f ) Western blot analysis indicating the absence of AS (67 kDa) in Pb ASKO parasite lysate ( Supplementary Fig. 6 ). Parasite lysates of Pb WT and Pb ASKO containing 100 μg of total protein were used. For control, hsp60 (60 kDa) was used (lower panel). ( g ) Enzyme assays for Pb WT and Pb ASKO parasites using [U- 14 C]-aspartate. 200 μg of total protein was used per assay.

    Journal: Nature Communications

    Article Title: Asparagine requirement in Plasmodium berghei as a target to prevent malaria transmission and liver infections

    doi: 10.1038/ncomms9775

    Figure Lengend Snippet: Generation of AS knockout in P. berghei . ( a ) Double cross-over recombination strategy followed to generate Pb ASKO. ( b ) PCR analysis for genomic DNA isolated from Pb WT and Pb ASKO parasites. Lane 1 and 3: PCR with Pb AS-specific primers; Lane 2 and 4: PCR with Pb GAPDH-specific primers (control); Lane M: 1 kb DNA ladder. ( c ) RT-PCR analysis for RNA isolated from Pb WT and Pb ASKO parasites. Lane 1 and 3: RT-PCR with Pb AS-specific primers; Lane 2 and 4: RT-PCR with Pb GAPDH specific primers (control); Lane M: 1 kb DNA ladder. ( d ) Southern analysis for genomic DNA isolated from Pb WT and Pb ASKO parasites. Transgenic plasmid (TP) was also included as control to rule out the presence of any episomes. Genomic DNA preparations and TP were digested with BsrGI and XbaI followed by hybridization with 5′-UTR specific probe. ( e ) Northern analysis for RNA isolated from Pb WT and Pb ASKO parasites indicating the absence of AS mRNA (1.75 kb) in Pb ASKO. For control, GAPDH (1.01 kb; lower panel) was used (full blots are shown in Supplementary Fig. 6 ). ( f ) Western blot analysis indicating the absence of AS (67 kDa) in Pb ASKO parasite lysate ( Supplementary Fig. 6 ). Parasite lysates of Pb WT and Pb ASKO containing 100 μg of total protein were used. For control, hsp60 (60 kDa) was used (lower panel). ( g ) Enzyme assays for Pb WT and Pb ASKO parasites using [U- 14 C]-aspartate. 200 μg of total protein was used per assay.

    Article Snippet: For Southern analysis, genomic DNA preparations (10 μg) from Pb WT and Pb ASKO parasites were subjected to BsrGI and XbaI digestion followed by hybridization with 5′-UTR-specific probe that was synthesized using Klenow Fragment (New England Biolabs) with 5′-UTR PCR product as a template in the presence of 5 μCi [α-32 P]-dATP.

    Techniques: Knock-Out, Polymerase Chain Reaction, Isolation, Reverse Transcription Polymerase Chain Reaction, Transgenic Assay, Plasmid Preparation, Hybridization, Northern Blot, Western Blot

    The biotin pull-down assay. ( A , B ) Schematic illustration of the biotin pull-down assay via the SDSA ( A ) and ssDI ( B ) pathways. In the case of ssDI ( B ), the biotinylated ODN is predicted to be incorporated into the target genomic locus, whereas in SDSA ( A ), it should not. The XhoI- and XbaI-digested genomic fragments covalently linked to biotin can be enriched using streptavidin beads under denaturing conditions. The primers BFP_QF and BFP_QR can specifically amplify these genomic fragments with ODN incorporation but not free ODN donors. Biotin, yellow circles; streptavidin, orange ovals; genomic DNA, black lines; ODN sequence, solid red lines; DNA synthesis, dashed red lines; chromophore sequence, TY and SH; genomic lesions, hatched orange lines; homology regions, dashed silver crosses; restriction sites, XhoI and XbaI; PCR primers, horizontal arrows. ( C ), and detected on an agarose gel.

    Journal: Genome Research

    Article Title: Mechanisms of precise genome editing using oligonucleotide donors

    doi: 10.1101/gr.214775.116

    Figure Lengend Snippet: The biotin pull-down assay. ( A , B ) Schematic illustration of the biotin pull-down assay via the SDSA ( A ) and ssDI ( B ) pathways. In the case of ssDI ( B ), the biotinylated ODN is predicted to be incorporated into the target genomic locus, whereas in SDSA ( A ), it should not. The XhoI- and XbaI-digested genomic fragments covalently linked to biotin can be enriched using streptavidin beads under denaturing conditions. The primers BFP_QF and BFP_QR can specifically amplify these genomic fragments with ODN incorporation but not free ODN donors. Biotin, yellow circles; streptavidin, orange ovals; genomic DNA, black lines; ODN sequence, solid red lines; DNA synthesis, dashed red lines; chromophore sequence, TY and SH; genomic lesions, hatched orange lines; homology regions, dashed silver crosses; restriction sites, XhoI and XbaI; PCR primers, horizontal arrows. ( C ), and detected on an agarose gel.

    Article Snippet: The genomic DNA was digested to completion with XhoI and XbaI restriction enzymes (New England Biolabs).

    Techniques: Pull Down Assay, Sequencing, DNA Synthesis, Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Expression of TwinStrep tagged YGR257Cp in Saccharomyces cerevisiae and Pichia pastoris . (Top) Growth curves for S. cerevisiae strains on lactate medium. (a, triangles) BY4741 ygr257c::KanMX | pYES2; (b, circles) BY4700 | pYES2; (c, squares) BY4741 ygr257c::KanMX

    Journal: Protein expression and purification

    Article Title: Expression and purification of recombinant Saccharomyces cerevisiae mitochondrial carrier protein YGR257Cp (Mtm1p)

    doi: 10.1016/j.pep.2013.10.014

    Figure Lengend Snippet: Expression of TwinStrep tagged YGR257Cp in Saccharomyces cerevisiae and Pichia pastoris . (Top) Growth curves for S. cerevisiae strains on lactate medium. (a, triangles) BY4741 ygr257c::KanMX | pYES2; (b, circles) BY4700 | pYES2; (c, squares) BY4741 ygr257c::KanMX

    Article Snippet: The 1400 bp product was digested ( Age I/ Xho I) and ligated together with annealed and digested ( Xho I/ Xba I) TwinStrep oligos into pYES2 ( Age I/ Xba I) to form pYEPmtm1TwinStrep for expression of TwinStrep tagged YGR257Cp under its native promoter. pYES2mtm1EGFP was digested ( Age I/ Xba I) dephosphorylated (antarctic phosphatase, New England Bio Labs) and the vector arms ligated with similarly digested Pmtm1–1/Mtm1 TwinStrep to form pYEPmtm1EGFP.

    Techniques: Expressing

    Southern blot showing copy numbers of the 16D10i-2 RNAi transgene in transformed potato lines and controls. For each plant line, 15 µg DNA was digested with 50 U Xba I and separated on a 0.8% agarose gel. 82-4, PA99N82-4 advanced breeding line;

    Journal: Journal of Nematology

    Article Title: Broad Meloidogyne Resistance in Potato Based on RNA Interference of Effector Gene 16D10

    doi:

    Figure Lengend Snippet: Southern blot showing copy numbers of the 16D10i-2 RNAi transgene in transformed potato lines and controls. For each plant line, 15 µg DNA was digested with 50 U Xba I and separated on a 0.8% agarose gel. 82-4, PA99N82-4 advanced breeding line;

    Article Snippet: For each plant line, 15 µg DNA was digested with 50 U Xba I (New England Biolabs, Ipswich, MA) for 16 hr at 37 ° C, then separated on a 0.8% agarose gel at 70 V for 16 hr and transferred to a GeneScreen Plus nylon membrane (PerkinElmer, Boston, MA) in 10× saline sodium citrate (SSC) buffer (1.5 M NaCl, 0.15 M sodium citrate, pH 7).

    Techniques: Southern Blot, Transformation Assay, Agarose Gel Electrophoresis

    Stable transfection confirms that PAG sequences reduce transcription and steady-state levels of mRNAs from genes in the vicinity. ( A ) Schematic diagram of a bicistronic construct based on the two procyclin genes in the EP/PAG1 locus. Fragments derived from PAG1 were inserted into the unique XbaI site (X) in the forward or reverse orientation. ( B ) Northern blots were hybridized sequentially with probes corresponding to the open reading frames of CAT and BLE, then normalized with α-tubulin. ( C ) Nuclear run-on analysis of BLE and CAT in selected clones. Other single-stranded probes are as described in the legend to Figure 5 . The MARP signals minus background levels were set as 1 for each clone.

    Journal: Nucleic Acids Research

    Article Title: Bidirectional silencing of RNA polymerase I transcription by a strand switch region in Trypanosoma brucei

    doi: 10.1093/nar/gkp513

    Figure Lengend Snippet: Stable transfection confirms that PAG sequences reduce transcription and steady-state levels of mRNAs from genes in the vicinity. ( A ) Schematic diagram of a bicistronic construct based on the two procyclin genes in the EP/PAG1 locus. Fragments derived from PAG1 were inserted into the unique XbaI site (X) in the forward or reverse orientation. ( B ) Northern blots were hybridized sequentially with probes corresponding to the open reading frames of CAT and BLE, then normalized with α-tubulin. ( C ) Nuclear run-on analysis of BLE and CAT in selected clones. Other single-stranded probes are as described in the legend to Figure 5 . The MARP signals minus background levels were set as 1 for each clone.

    Article Snippet: The insert was excised with XhoI (cuts within the vector backbone 5′ to the PAG1 insert) and XbaI and cloned into the XhoI and XbaI sites of pG-mcs-CAT/EP2. pG-1240rev-CAT/EP2 (1240R ): the first 1240 bp of PAG1 were amplified by PCR from pG-1240-CAT/EP2 with the primers PAG1down3 and 1240up3 and cloned into the XhoI and XbaI sites of pG-mcs-CAT/EP2. pG-1240-neo-CAT/EP2 (1240F -neo): the same strategy was used as for pG-640-neo-CAT/EP2, however the neo fragment was cloned into XbaI site of pG-1240-CAT/EP2. pG-PAG1end-CAT/EP2 (ORFF ): to obtain the fragment with the PAG1 sequence from its internal HindIII site at 1087 to position 2458, a PCR was performed with the template pBS-711-HN ( ) and the primers M13r (Invitrogen) and PAG1up2.

    Techniques: Stable Transfection, Construct, Derivative Assay, Northern Blot, Clone Assay

    NotI (A) or XbaI (B) PFGE profiles of Y. enterocolitica 1B/O8 clinical isolates from Poland (lanes 4 to 9) compared with profiles of bioserotype 1A/O7,8 (lanes 1 and 2) and 1B/O8 (lane 3) strains. The corresponding dendrograms illustrate genetic similarity of the NotI and XbaI profiles. The similarity values are shown in the dendrograms. PFGE genotypes are indicated in parentheses. Lanes in panels A and B: M, bacteriophage λ DNA ladder; 1, Y. enterocolitica 1A/O7,8 strain 323; 2, Y. enterocolitica 1A/O7,8 strain UG55; 3, reference 1B/O8 strain WA-314; 7, isolate 51/07; lanes in panel A: 4, 27/04; 5, 152/05; 6, 82/06; 8, 84/07; 9, 93-1/08; lanes in panel B: 4, 180/08; 5, 27/04; 6, 152/05. Sizes of DNA fragments are given in kilobases.

    Journal: Journal of Clinical Microbiology

    Article Title: Molecular Characterization of Human Clinical Isolates of Yersinia enterocolitica Bioserotype 1B/O8 in Poland: Emergence and Dissemination of Three Highly Related Clones ▿ Bioserotype 1B/O8 in Poland: Emergence and Dissemination of Three Highly Related Clones ▿ †

    doi: 10.1128/JCM.01321-08

    Figure Lengend Snippet: NotI (A) or XbaI (B) PFGE profiles of Y. enterocolitica 1B/O8 clinical isolates from Poland (lanes 4 to 9) compared with profiles of bioserotype 1A/O7,8 (lanes 1 and 2) and 1B/O8 (lane 3) strains. The corresponding dendrograms illustrate genetic similarity of the NotI and XbaI profiles. The similarity values are shown in the dendrograms. PFGE genotypes are indicated in parentheses. Lanes in panels A and B: M, bacteriophage λ DNA ladder; 1, Y. enterocolitica 1A/O7,8 strain 323; 2, Y. enterocolitica 1A/O7,8 strain UG55; 3, reference 1B/O8 strain WA-314; 7, isolate 51/07; lanes in panel A: 4, 27/04; 5, 152/05; 6, 82/06; 8, 84/07; 9, 93-1/08; lanes in panel B: 4, 180/08; 5, 27/04; 6, 152/05. Sizes of DNA fragments are given in kilobases.

    Article Snippet: For this reason, we performed additional PFGE analyses using the enzyme XbaI (Fermentas, Lithuania).

    Techniques:

    Interaction between the GYS1 XbaI polymorphism and physical activity (PA) in males. Kaplan Meier survival curves for males reporting normal to high physical activity (PA) level according to GYS1 XbaI genotype compared to males with low PA level.

    Journal: PLoS ONE

    Article Title: Variation in GYS1 Interacts with Exercise and Gender to Predict Cardiovascular Mortality

    doi: 10.1371/journal.pone.0000285

    Figure Lengend Snippet: Interaction between the GYS1 XbaI polymorphism and physical activity (PA) in males. Kaplan Meier survival curves for males reporting normal to high physical activity (PA) level according to GYS1 XbaI genotype compared to males with low PA level.

    Article Snippet: The XbaI polymorphism in GYS1 was genotyped using single base pair extension on AB3100 (Applied Biosystems) and the APOE polymorphisms were genotyped using allelic discrimination on AB7900 at the SWEGENE DNA genotyping Laboratory.

    Techniques: Activity Assay

    CV mortality in males and females according to the GYS1 XbaI (A) and APOE –219/ε2/ε3/ε4 (B) genotypes. Kaplan Meier survival curves illustrating a higher risk for CV mortality (HR 1.8 [1.2–2.6], p = 0.0016, p c = 0.0096) in male carriers of the GYS1 XbaI CT/TT-genotypes and in female carriers of the APOE –219TT/ε4 genotype combination (HR 2.3 [1.6–3.2], p

    Journal: PLoS ONE

    Article Title: Variation in GYS1 Interacts with Exercise and Gender to Predict Cardiovascular Mortality

    doi: 10.1371/journal.pone.0000285

    Figure Lengend Snippet: CV mortality in males and females according to the GYS1 XbaI (A) and APOE –219/ε2/ε3/ε4 (B) genotypes. Kaplan Meier survival curves illustrating a higher risk for CV mortality (HR 1.8 [1.2–2.6], p = 0.0016, p c = 0.0096) in male carriers of the GYS1 XbaI CT/TT-genotypes and in female carriers of the APOE –219TT/ε4 genotype combination (HR 2.3 [1.6–3.2], p

    Article Snippet: The XbaI polymorphism in GYS1 was genotyped using single base pair extension on AB3100 (Applied Biosystems) and the APOE polymorphisms were genotyped using allelic discrimination on AB7900 at the SWEGENE DNA genotyping Laboratory.

    Techniques:

    Dendrogram generated by BioNumerics software with 1% optimization and 1% position tolerance, showing the results of cluster analysis of band patterns after digestion of DNA from 42 isolates of Salmonella enterica serovar Typhimurium with the XbaI restriction

    Journal: Canadian Journal of Veterinary Research

    Article Title: Antimicrobial resistance, virulence-associated genes, and pulsed-field gel electrophoresis profiles of Salmonella enterica subsp. enterica serovar Typhimurium isolated from piglets with diarrhea in Korea

    doi:

    Figure Lengend Snippet: Dendrogram generated by BioNumerics software with 1% optimization and 1% position tolerance, showing the results of cluster analysis of band patterns after digestion of DNA from 42 isolates of Salmonella enterica serovar Typhimurium with the XbaI restriction

    Article Snippet: Briefly, agarose-embedded DNA was digested with 30 U of restriction enzyme XbaI (Fermentas International, Burlington, Ontario) overnight in a water bath at 37°C.

    Techniques: Generated, Software

    Colony-PCR and digestion products visualized on 1.2% agarose gels. A: Agarose gel electrophoresis of colony-PCR product. Lane 1: 1968 bp PCR product of fusion fragments, M: 100 bp-plus DNA size marker; B: BamHI and Xba XbaI digestion products of recombinant

    Journal: Reports of Biochemistry & Molecular Biology

    Article Title: Construction of a Novel DNA Vaccine Candidate Encoding an HspX-PPE44-EsxV Fusion Antigen of Mycobacterium tuberculosis

    doi:

    Figure Lengend Snippet: Colony-PCR and digestion products visualized on 1.2% agarose gels. A: Agarose gel electrophoresis of colony-PCR product. Lane 1: 1968 bp PCR product of fusion fragments, M: 100 bp-plus DNA size marker; B: BamHI and Xba XbaI digestion products of recombinant

    Article Snippet: Then the generated HspX-PPE44-EsxV, along with vector, was digested with BamHI and XbaI restriction enzymes and ligated into pcDNA3.1 (+) (Invitrogen, USA) in BamHI and XbaI restriction sites at the 5´and 3´ ends ( ).

    Techniques: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Marker, Recombinant

    Agarose gels of recombinant vector. a: digestion of pGH/HspX-PPE44-EsxV by BamHI and XbaI . lane 1: pGH (2940 bp) and HspX-PPE4-EsxV (1968 bp); lane; M: 1kb DNA size marker. B: Ligated pcDNA3.1 (+)/hspX-ppe44-esxV. The band is Recombinant pcDNA3.1 (+)

    Journal: Reports of Biochemistry & Molecular Biology

    Article Title: Construction of a Novel DNA Vaccine Candidate Encoding an HspX-PPE44-EsxV Fusion Antigen of Mycobacterium tuberculosis

    doi:

    Figure Lengend Snippet: Agarose gels of recombinant vector. a: digestion of pGH/HspX-PPE44-EsxV by BamHI and XbaI . lane 1: pGH (2940 bp) and HspX-PPE4-EsxV (1968 bp); lane; M: 1kb DNA size marker. B: Ligated pcDNA3.1 (+)/hspX-ppe44-esxV. The band is Recombinant pcDNA3.1 (+)

    Article Snippet: Then the generated HspX-PPE44-EsxV, along with vector, was digested with BamHI and XbaI restriction enzymes and ligated into pcDNA3.1 (+) (Invitrogen, USA) in BamHI and XbaI restriction sites at the 5´and 3´ ends ( ).

    Techniques: Recombinant, Plasmid Preparation, Marker

    Schematic map of the pcDNA3.1 (+)/HspX-PPE44-EsxV-His plasmid. The fusion segment consisting of hspX, linker, ppe44, linker, esxV sequences, and a 6-polyhistidine-tag was designed between the BamHI and XbaI restriction sites of pcDNA3.1 (+) downstream

    Journal: Reports of Biochemistry & Molecular Biology

    Article Title: Construction of a Novel DNA Vaccine Candidate Encoding an HspX-PPE44-EsxV Fusion Antigen of Mycobacterium tuberculosis

    doi:

    Figure Lengend Snippet: Schematic map of the pcDNA3.1 (+)/HspX-PPE44-EsxV-His plasmid. The fusion segment consisting of hspX, linker, ppe44, linker, esxV sequences, and a 6-polyhistidine-tag was designed between the BamHI and XbaI restriction sites of pcDNA3.1 (+) downstream

    Article Snippet: Then the generated HspX-PPE44-EsxV, along with vector, was digested with BamHI and XbaI restriction enzymes and ligated into pcDNA3.1 (+) (Invitrogen, USA) in BamHI and XbaI restriction sites at the 5´and 3´ ends ( ).

    Techniques: Plasmid Preparation

    RFLP of PCR-amplified 742-bp products. (A) XbaI digestion. (B) BsmI digestion. Lane M, molecular size marker (100-bp ladder; Gibco BRL, Gaithersburg, Md.); lane 1, S. constellatus ATCC 27823; lanes 2 to 5, S. constellatus clinical isolates; lane 6, S.

    Journal:

    Article Title: Rapid Differentiation between Members of the Anginosus Group and Streptococcus dysgalactiae subsp. equisimilis within Beta-Hemolytic Group C and G Streptococci by PCR

    doi: 10.1128/JCM.44.5.1836-1838.2006

    Figure Lengend Snippet: RFLP of PCR-amplified 742-bp products. (A) XbaI digestion. (B) BsmI digestion. Lane M, molecular size marker (100-bp ladder; Gibco BRL, Gaithersburg, Md.); lane 1, S. constellatus ATCC 27823; lanes 2 to 5, S. constellatus clinical isolates; lane 6, S.

    Article Snippet: In order to further differentiate the species ( S. anginosus and S. constellatus ) among the anginosus group of GCS, the 742-bp amplification product was subsequently digested with the restriction enzymes XbaI (37°C, 3 h) and BsmI (65°C, 3 h) (Gibco BRL, Gaithersburg, Md.).

    Techniques: Polymerase Chain Reaction, Amplification, Marker

    Agarose gel electrophoresis showing amplification and cloning of the NSP4 gene. A; amplification of the NSP4 gene of Bovine rotavirus by RT-PCR, Lane1, 2 and 3, PCR product for complete NSP4 gene (570 bp). Lane 4, size marker (100 bp plus DNA ladder, fermetas), B; Recombinant plasmid extraction. C; Confirmation of recombinant pcDNA NSP4 by double restriction digestion using same Apa1 and XbaI enzymes

    Journal: Iranian Journal of Basic Medical Sciences

    Article Title: Activation of calcium/calmodulin-dependent kinase II following bovine rotavirus enterotoxin NSP4 expression

    doi:

    Figure Lengend Snippet: Agarose gel electrophoresis showing amplification and cloning of the NSP4 gene. A; amplification of the NSP4 gene of Bovine rotavirus by RT-PCR, Lane1, 2 and 3, PCR product for complete NSP4 gene (570 bp). Lane 4, size marker (100 bp plus DNA ladder, fermetas), B; Recombinant plasmid extraction. C; Confirmation of recombinant pcDNA NSP4 by double restriction digestion using same Apa1 and XbaI enzymes

    Article Snippet: The amplicon was ligated into the unique Apa1 and XbaI cloning sites of the Eukaryotic expression vector pcDNA3.1(+) (Invitrogen, USA), and transformation was performed in Escherichia coli DH5α cells.

    Techniques: Agarose Gel Electrophoresis, Amplification, Clone Assay, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Marker, Recombinant, Plasmid Preparation

    The 576-bp PcCdc42 probe hybridizes to Pneumocystis genomic DNA. Freshly isolated Pc ( lanes 1–3 ) and rat ( lanes 5–7 ) genomic DNA were digested with the restriction endonucleases Bam HI ( lanes 1 and 5 ), Xho I ( lanes 2 and 6 ), and Xba I ( lanes 3 and 7 ). The digestion products were separated by electrophoresis and transferred to nitrocellulose. The 576-bp PcCdc42 amplicon was labeled and hybridized to the membrane showing specific interaction with the Pc digestions. No hybridization was noted in the rat genomic DNA lane.

    Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology

    Article Title: Characterization of the PcCdc42 small G protein from Pneumocystis carinii, which interacts with the PcSte20 life cycle regulatory kinase

    doi: 10.1152/ajplung.00191.2009

    Figure Lengend Snippet: The 576-bp PcCdc42 probe hybridizes to Pneumocystis genomic DNA. Freshly isolated Pc ( lanes 1–3 ) and rat ( lanes 5–7 ) genomic DNA were digested with the restriction endonucleases Bam HI ( lanes 1 and 5 ), Xho I ( lanes 2 and 6 ), and Xba I ( lanes 3 and 7 ). The digestion products were separated by electrophoresis and transferred to nitrocellulose. The 576-bp PcCdc42 amplicon was labeled and hybridized to the membrane showing specific interaction with the Pc digestions. No hybridization was noted in the rat genomic DNA lane.

    Article Snippet: In addition, the 576-bp amplicon was also hybridized to Pc genomic DNA digested with the restriction enzymes Bam HI, Xho I, and Xba I (Invitrogen).

    Techniques: Isolation, Electrophoresis, Amplification, Labeling, Hybridization

    Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization

    Journal: 3 Biotech

    Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)

    doi: 10.1007/s13205-018-1552-0

    Figure Lengend Snippet: Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization

    Article Snippet: Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’.

    Techniques: Southern Blot, Molecular Weight, Marker, Hybridization

    Dendrograms generated by BioNumerics showing the results of cluster analysis on the basis of XbaI-PFGE of S. enterica serotype Typhimurium isolates. Similarity analysis was performed using the Dice coefficient, and clustering was by the unweighted pair group method with arithmetic averages. The different PFGE profiles and corresponding numbers of isolates, the types of bla genes (if present), and the phage types are indicated.

    Journal: Journal of Clinical Microbiology

    Article Title: Multidrug Resistance in Salmonella enterica Serotype Typhimurium from Humans in France (1993 to 2003)

    doi: 10.1128/JCM.44.3.700-708.2006

    Figure Lengend Snippet: Dendrograms generated by BioNumerics showing the results of cluster analysis on the basis of XbaI-PFGE of S. enterica serotype Typhimurium isolates. Similarity analysis was performed using the Dice coefficient, and clustering was by the unweighted pair group method with arithmetic averages. The different PFGE profiles and corresponding numbers of isolates, the types of bla genes (if present), and the phage types are indicated.

    Article Snippet: PFGE using XbaI (Amersham Biosciences, Freiburg, Germany) was carried out with a CHEF-DR III system (Bio-Rad) as described previously ( ).

    Techniques: Generated

    (A) Southern blot hybridization with the p1-9 probe of XbaI-digested genomic DNAs of S. enterica serovar Typhimurium DT104 control strain BN9181 carrying SGI1 (lane 2), serovar Virchow control strain SV20 carrying SGI1-J4 (lane 3), serovar Kentucky strain

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Early Strains of Multidrug-Resistant Salmonella enterica Serovar Kentucky Sequence Type 198 from Southeast Asia Harbor Salmonella Genomic Island 1-J Variants with a Novel Insertion Sequence

    doi: 10.1128/AAC.00732-12

    Figure Lengend Snippet: (A) Southern blot hybridization with the p1-9 probe of XbaI-digested genomic DNAs of S. enterica serovar Typhimurium DT104 control strain BN9181 carrying SGI1 (lane 2), serovar Virchow control strain SV20 carrying SGI1-J4 (lane 3), serovar Kentucky strain

    Article Snippet: The atypical insertion site of the complex integrons InSGI1-J (in ORF S023) was further assessed by Southern blot hybridization of whole genomic DNA cut by XbaI (Promega, Charbonnières, France) by using probe p1-9 as previously described ( , , , ).

    Techniques: Southern Blot, Hybridization

    Pulsed field gel electrophoresis of XbaI-digested DNA from the 59 ExPEC strains included in the study . Strain designation, phylogenetic group, ST assignation, clinical and geographical origin of isolation, PFGE cluster ( > 85% similarity), and PCR result for virulence genes that exhibited significant differences within the pathogenic groups are shown at right. This unweighted pair-group method with arithmetic mean dendrogram was generated in BioNumerics software (Applied Maths, St-Martens-Latem, Belgium) by using Dice coefficient with a 1.0% band position tolerance. The scale above the dendrogram indicates percent similarity. AS: abdominal sepsis; UTI: urinary tract infection; CI: cystitis; IS: intestinal sepsis; NBM: Newborn Meningitis; US: urosepsis; P?: posible pyelonephritis; C: colibacillosis; RS: respiratory sepsis; AP: acute pyelonephritis; AB: asymptomatic bacteriuria.

    Journal: BMC Microbiology

    Article Title: Extraintestinal pathogenic Escherichia coli O1:K1:H7/NM from human and avian origin: detection of clonal groups B2 ST95 and D ST59 with different host distribution

    doi: 10.1186/1471-2180-9-132

    Figure Lengend Snippet: Pulsed field gel electrophoresis of XbaI-digested DNA from the 59 ExPEC strains included in the study . Strain designation, phylogenetic group, ST assignation, clinical and geographical origin of isolation, PFGE cluster ( > 85% similarity), and PCR result for virulence genes that exhibited significant differences within the pathogenic groups are shown at right. This unweighted pair-group method with arithmetic mean dendrogram was generated in BioNumerics software (Applied Maths, St-Martens-Latem, Belgium) by using Dice coefficient with a 1.0% band position tolerance. The scale above the dendrogram indicates percent similarity. AS: abdominal sepsis; UTI: urinary tract infection; CI: cystitis; IS: intestinal sepsis; NBM: Newborn Meningitis; US: urosepsis; P?: posible pyelonephritis; C: colibacillosis; RS: respiratory sepsis; AP: acute pyelonephritis; AB: asymptomatic bacteriuria.

    Article Snippet: Pulse Field Gel Electrophoresis (PFGE) Cleavage of the agarose-embedded DNA was achieved with 0.2 U/μl XbaI (Roche) according to instructions of the manufacturer.

    Techniques: Pulsed-Field Gel, Electrophoresis, Isolation, Polymerase Chain Reaction, Generated, Software, Infection

    Fingerprinting profiles (A to S) of XbaI-digested genomic DNA using the Dice coefficient and UPGMA for Klebsiella pneumoniae cerebrospinal fluid isolates collected in Taiwan. Eight pulsotypes (C, E, H, I, J, N, P, and R) show a Dice similarity coefficient of more than 80%. Corresponding MLST (multilocus sequence typing) and capsule K serotype of each isolate were presented. *One nucleotide change; x, unidentified, non-virulent capsule K types, i.e., not for K1, K2, K5, K20, K54, K57 types.

    Journal: Scientific Reports

    Article Title: Klebsiella pneumoniae Isolates from Meningitis: Epidemiology, Virulence and Antibiotic Resistance

    doi: 10.1038/s41598-017-06878-6

    Figure Lengend Snippet: Fingerprinting profiles (A to S) of XbaI-digested genomic DNA using the Dice coefficient and UPGMA for Klebsiella pneumoniae cerebrospinal fluid isolates collected in Taiwan. Eight pulsotypes (C, E, H, I, J, N, P, and R) show a Dice similarity coefficient of more than 80%. Corresponding MLST (multilocus sequence typing) and capsule K serotype of each isolate were presented. *One nucleotide change; x, unidentified, non-virulent capsule K types, i.e., not for K1, K2, K5, K20, K54, K57 types.

    Article Snippet: Whole chromosomal DNA in agarose was digested with XbaI (Bio-Rad Laboratories, CA., USA), and the restriction fragments were separated in a CHEF Mapper XA System (Bio-Rad Laboratories, CA., USA).

    Techniques: Sequencing

    Genetic organization of the antibiotic resistance gene cluster of SGI1 and the new SGI1-H variant of serovar Newport strains 01-2174 and 01-5348. The direction of transcription of the genes is indicated by arrows. Black and gray arrows correspond to SGI1 antibiotic resistance genes and chromosomal genes flanking SGI1, respectively. DR-L and DR-R are the left and right direct repeats, respectively, bracketing SGI1. IRi and IRt are 25-bp imperfect inverted repeats defining the left and right ends of complex class 1 integrons. PCRs used to assess the genetic organization of the antibiotic resistance genes (i.e., PCRs floR , A, B, C, D, E, and F) and the SGI1 junctions to the chromosome (i.e., PCRs LJ and RJ for left and right junctions, respectively) are indicated. Restriction sites: X, XbaI; H, HindIII.

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Variant Salmonella Genomic Island 1 Antibiotic Resistance Gene Cluster Containing a Novel 3?-N-Aminoglycoside Acetyltransferase Gene Cassette, aac(3)-Id, in Salmonella enterica Serovar Newport

    doi: 10.1128/AAC.48.10.3806-3812.2004

    Figure Lengend Snippet: Genetic organization of the antibiotic resistance gene cluster of SGI1 and the new SGI1-H variant of serovar Newport strains 01-2174 and 01-5348. The direction of transcription of the genes is indicated by arrows. Black and gray arrows correspond to SGI1 antibiotic resistance genes and chromosomal genes flanking SGI1, respectively. DR-L and DR-R are the left and right direct repeats, respectively, bracketing SGI1. IRi and IRt are 25-bp imperfect inverted repeats defining the left and right ends of complex class 1 integrons. PCRs used to assess the genetic organization of the antibiotic resistance genes (i.e., PCRs floR , A, B, C, D, E, and F) and the SGI1 junctions to the chromosome (i.e., PCRs LJ and RJ for left and right junctions, respectively) are indicated. Restriction sites: X, XbaI; H, HindIII.

    Article Snippet: The presence of entire SGI1 was also assessed by Southern blotting of genomic DNA cut by XbaI (Qbiogene) by using probe p1-9 as previously described ( ).

    Techniques: Variant Assay

    Macrorestriction analysis by PFGE of genomic DNAs cut by XbaI of serovar Newport strains: SGI1-H-carrying strain 01-2174 (lane 1), SGI1-H-carrying strain 01-5348 (lane 2), non-SGI1 strain 01-8181 isolated in France in 2001 (lane 3), and serovar Newport control strains from the French National Reference Center for Salmonella collection (lanes 4 and 5).

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Variant Salmonella Genomic Island 1 Antibiotic Resistance Gene Cluster Containing a Novel 3?-N-Aminoglycoside Acetyltransferase Gene Cassette, aac(3)-Id, in Salmonella enterica Serovar Newport

    doi: 10.1128/AAC.48.10.3806-3812.2004

    Figure Lengend Snippet: Macrorestriction analysis by PFGE of genomic DNAs cut by XbaI of serovar Newport strains: SGI1-H-carrying strain 01-2174 (lane 1), SGI1-H-carrying strain 01-5348 (lane 2), non-SGI1 strain 01-8181 isolated in France in 2001 (lane 3), and serovar Newport control strains from the French National Reference Center for Salmonella collection (lanes 4 and 5).

    Article Snippet: The presence of entire SGI1 was also assessed by Southern blotting of genomic DNA cut by XbaI (Qbiogene) by using probe p1-9 as previously described ( ).

    Techniques: Isolation

    Genetic relatedness of E. coli isolates with class 1 integrons indicated by XbaI -digested chromosomal DNA

    Journal: BMC Veterinary Research

    Article Title: Interrelationship between tetracycline resistance determinants, phylogenetic group affiliation and carriage of class 1 integrons in commensal Escherichia coli isolates from cattle farms

    doi: 10.1186/s12917-018-1661-3

    Figure Lengend Snippet: Genetic relatedness of E. coli isolates with class 1 integrons indicated by XbaI -digested chromosomal DNA

    Article Snippet: Briefly, following 18 to 20 h growth on TSA at 37 °C, genomic DNA was digested with 50 U XbaI (TaKaRa, Japan) for 2 h at 37 °C, then the DNA fragments were subsequently separated on a 1.0% SeaKem Gold agarose gel (Lonza, USA) in 0.5× Tris-borate-EDTA (TBE) buffer using a CHEFMapper gel apparatus (Bio-Rad Laboratories, California, USA).

    Techniques:

    16S copy number of E. corrodens determined by Southern hybridization. Genomic DNA was cut with 1) Eco RI, 2) Hind III, 3) Nco I, 4) Pst I, 5) Xba I, 6) Xho I. 7) positive control. Eco RI, Hind III and Pst I show the maximum number of 4 bands

    Journal: BMC Oral Health

    Article Title: Development of a point-of-care-device for fast detection of periodontal pathogens

    doi: 10.1186/s12903-015-0155-y

    Figure Lengend Snippet: 16S copy number of E. corrodens determined by Southern hybridization. Genomic DNA was cut with 1) Eco RI, 2) Hind III, 3) Nco I, 4) Pst I, 5) Xba I, 6) Xho I. 7) positive control. Eco RI, Hind III and Pst I show the maximum number of 4 bands

    Article Snippet: Southern blot To determine the 16S copy number of E. corrodens via Southern Blot, approximately 10 μg DNA were digested with restriction enzymes Eco RI HF, Hind III (New England Biolabs, Ipswich, USA), Nco I, Pst I, Xba I (Jena Bioscience GmbH, Jena, Germany) and Xho I FD (Thermo Fisher Scientific, Waltham, USA) at 37 °C overnight.

    Techniques: Hybridization, Positive Control

    Linear view of consensus optical maps with DNA sequence-based maps. Solid black arrows represent the locations of missing cuts in the consensus optical maps. The XbaI and NheI consensus optical maps extend to the left of the origin of the DNA sequence-based map because both optical maps had a missing cut at that position.

    Journal: Applied and Environmental Microbiology

    Article Title: Whole-Genome Shotgun Optical Mapping of Rhodospirillum rubrum

    doi: 10.1128/AEM.71.9.5511-5522.2005

    Figure Lengend Snippet: Linear view of consensus optical maps with DNA sequence-based maps. Solid black arrows represent the locations of missing cuts in the consensus optical maps. The XbaI and NheI consensus optical maps extend to the left of the origin of the DNA sequence-based map because both optical maps had a missing cut at that position.

    Article Snippet: Surface properties were assayed by digesting lambda DASH II bacteriophage DNA with 40 units of XbaI, HindIII, and NheI diluted in 200 μl of digestion buffer with 0.2% Triton X-100 (Sigma, St. Louis, MO) at 37°C to determine optimal digestion times, which ranged from 30 to 120 min.

    Techniques: Sequencing

    Whole-genome circular XbaI map of R. rubrum . The outermost circle (thick line) represents the consensus map created by Gentig from the single-molecule maps shown as arcs. The single-molecule maps were made from single DNA molecules digested with XbaI. The color ordering of the fragments is for contrast and is therefore random.

    Journal: Applied and Environmental Microbiology

    Article Title: Whole-Genome Shotgun Optical Mapping of Rhodospirillum rubrum

    doi: 10.1128/AEM.71.9.5511-5522.2005

    Figure Lengend Snippet: Whole-genome circular XbaI map of R. rubrum . The outermost circle (thick line) represents the consensus map created by Gentig from the single-molecule maps shown as arcs. The single-molecule maps were made from single DNA molecules digested with XbaI. The color ordering of the fragments is for contrast and is therefore random.

    Article Snippet: Surface properties were assayed by digesting lambda DASH II bacteriophage DNA with 40 units of XbaI, HindIII, and NheI diluted in 200 μl of digestion buffer with 0.2% Triton X-100 (Sigma, St. Louis, MO) at 37°C to determine optimal digestion times, which ranged from 30 to 120 min.

    Techniques:

    Comparisons of the XbaI, NheI, and HindIII optical maps to sequence data. (A, B, and C) Plots of optical map fragment sizes versus the DNA sequence-based map fragment sizes from the finished sequence for XbaI (A), NheI (B), and HindIII (C). The error bars represent the standard deviation of optical map fragment size about the mean. (D, E, F) Plots of the relative fragment sizing error [100 × (optical map fragment size - corresponding DNA sequence-based map fragment size)/corresponding DNA sequence-based map fragment size] versus DNA sequence-based map fragment size for XbaI ( D), NheI (E), and HindIII (F).

    Journal: Applied and Environmental Microbiology

    Article Title: Whole-Genome Shotgun Optical Mapping of Rhodospirillum rubrum

    doi: 10.1128/AEM.71.9.5511-5522.2005

    Figure Lengend Snippet: Comparisons of the XbaI, NheI, and HindIII optical maps to sequence data. (A, B, and C) Plots of optical map fragment sizes versus the DNA sequence-based map fragment sizes from the finished sequence for XbaI (A), NheI (B), and HindIII (C). The error bars represent the standard deviation of optical map fragment size about the mean. (D, E, F) Plots of the relative fragment sizing error [100 × (optical map fragment size - corresponding DNA sequence-based map fragment size)/corresponding DNA sequence-based map fragment size] versus DNA sequence-based map fragment size for XbaI ( D), NheI (E), and HindIII (F).

    Article Snippet: Surface properties were assayed by digesting lambda DASH II bacteriophage DNA with 40 units of XbaI, HindIII, and NheI diluted in 200 μl of digestion buffer with 0.2% Triton X-100 (Sigma, St. Louis, MO) at 37°C to determine optimal digestion times, which ranged from 30 to 120 min.

    Techniques: Sequencing, Standard Deviation

    OesDHN genomic organization. (A) Scheme of OesDHN gene. The black rectangle indicates intron position with respect to the cDNA. Start and stop codons are typed. (C) Deduced nucleotides of OesDHN cDNA and its 5′ upstream region and features of Oes DHN protein. The ATG start and TAA stop codons are indicated in bold; the stop codon position is indicated by the asterisk. The intron sequence, including the putative TATA-box (bold) is highlighted. The putative ABRE, G-box, MYB, GATA, CAAT-box elements are also indicated. Predicted amino acids are shown in one letter code. The S-segment is shown with an interrupted line, and the two K-segments are shown in bold italics and underlined with a single line. The putative NLS (nuclear localization signal) is double underlined and the poly-proline cluster is shown with one single line. The intronic region is represented with italic lowercases. (B) Southern blot analysis. The oleaster gDNA was digested with EcoRI and XbaI and hybridized with the cDNA probe, indicated in (A) . The molecular weights of a co-migrating DNA marker are expressed in kilo base pairs (Kb). PR, promoter region; UTR, Untranslated region. Bar 200 bp (A) .

    Journal: Frontiers in Plant Science

    Article Title: A dehydrin gene isolated from feral olive enhances drought tolerance in Arabidopsis transgenic plants

    doi: 10.3389/fpls.2015.00392

    Figure Lengend Snippet: OesDHN genomic organization. (A) Scheme of OesDHN gene. The black rectangle indicates intron position with respect to the cDNA. Start and stop codons are typed. (C) Deduced nucleotides of OesDHN cDNA and its 5′ upstream region and features of Oes DHN protein. The ATG start and TAA stop codons are indicated in bold; the stop codon position is indicated by the asterisk. The intron sequence, including the putative TATA-box (bold) is highlighted. The putative ABRE, G-box, MYB, GATA, CAAT-box elements are also indicated. Predicted amino acids are shown in one letter code. The S-segment is shown with an interrupted line, and the two K-segments are shown in bold italics and underlined with a single line. The putative NLS (nuclear localization signal) is double underlined and the poly-proline cluster is shown with one single line. The intronic region is represented with italic lowercases. (B) Southern blot analysis. The oleaster gDNA was digested with EcoRI and XbaI and hybridized with the cDNA probe, indicated in (A) . The molecular weights of a co-migrating DNA marker are expressed in kilo base pairs (Kb). PR, promoter region; UTR, Untranslated region. Bar 200 bp (A) .

    Article Snippet: Briefly, after extraction and purification, gDNA (10 μg) was digested overnight at 37°C with EcoRV and XbaI endonucleases (Promega, Italy), which do not cut in the probe.

    Techniques: Sequencing, Southern Blot, Marker

    Gel image of PFGE result. Genomic DNA was digested using XbaI enzyme and subjected to pulsed-field gel electrophoresis.

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Clinical and Molecular Characteristics of Emerging Hypervirulent Klebsiella pneumoniae Bloodstream Infections in Mainland China

    doi: 10.1128/AAC.02523-14

    Figure Lengend Snippet: Gel image of PFGE result. Genomic DNA was digested using XbaI enzyme and subjected to pulsed-field gel electrophoresis.

    Article Snippet: Whole-cell genomic DNA representing each isolate was digested with the restriction enzyme XbaI (TaKaRa Biotechnology, Dalian, China) and separated by electrophoresis through 1% pulsed-field certified agarose (Bio-Rad, Richmond, CA, USA) by using a CHEF-Mapper (Bio-Rad).

    Techniques: Pulsed-Field Gel, Electrophoresis

    Point mutation in Hras gene in DMBA/TPA treated cells. ( A ) The A > T substitution causes the appearance of XbaI consensus site ( B ) XbaI digestion of Hras in MEF (left lane) and 308 cells (right lane). Two restriction fragments of 300 and 400 bp emerge in mutated Hras resulting from cleavage of full length 700 bp replicon in the newly formed XbaI restriction site. ( C ) Sequencing of Hras codon 61 reveals A > T transversion in of 308 cell line which is derived from early DMBA/TPA induced papillomas (ii). Mouse embryonic fibroblasts (MEFs) hold the typical A allele (i) .

    Journal: PLoS ONE

    Article Title: SNP Detection in mRNA in Living Cells Using Allele Specific FRET Probes

    doi: 10.1371/journal.pone.0072389

    Figure Lengend Snippet: Point mutation in Hras gene in DMBA/TPA treated cells. ( A ) The A > T substitution causes the appearance of XbaI consensus site ( B ) XbaI digestion of Hras in MEF (left lane) and 308 cells (right lane). Two restriction fragments of 300 and 400 bp emerge in mutated Hras resulting from cleavage of full length 700 bp replicon in the newly formed XbaI restriction site. ( C ) Sequencing of Hras codon 61 reveals A > T transversion in of 308 cell line which is derived from early DMBA/TPA induced papillomas (ii). Mouse embryonic fibroblasts (MEFs) hold the typical A allele (i) .

    Article Snippet: Primers sequence was as listed below: Forward : ctatagaggtgagctctgcctacc Reverse : ctacattgaaacatcagccaagac To confirm Hras mutation, restriction digestion was carried using XbaI restriction enzyme (Takara).

    Techniques: Mutagenesis, Sequencing, Derivative Assay