uag translation Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Thermo Fisher g25b ggctgcagttagtagagtatatcgcacct g25b
    G25b Ggctgcagttagtagagtatatcgcacct G25b, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/g25b ggctgcagttagtagagtatatcgcacct g25b/product/Thermo Fisher
    Average 96 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    g25b ggctgcagttagtagagtatatcgcacct g25b - by Bioz Stars, 2020-08
    96/100 stars
      Buy from Supplier

    86
    ATUM renilla luciferase translational stop codon
    Figure 4. Regulation of Lpl and its lipase activity by miR-27a and miR-29a. ( A ) The 3′UTR of the Lpl gene was cloned in full-length into the psiCHECK-2 dual-luciferase reporter plasmid immediately downstream of the <t>Renilla</t> luciferase reporter
    Renilla Luciferase Translational Stop Codon, supplied by ATUM, used in various techniques. Bioz Stars score: 86/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/renilla luciferase translational stop codon/product/ATUM
    Average 86 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    renilla luciferase translational stop codon - by Bioz Stars, 2020-08
    86/100 stars
      Buy from Supplier

    92
    GenScript saba translational stop codon
    Figure 4. Regulation of Lpl and its lipase activity by miR-27a and miR-29a. ( A ) The 3′UTR of the Lpl gene was cloned in full-length into the psiCHECK-2 dual-luciferase reporter plasmid immediately downstream of the <t>Renilla</t> luciferase reporter
    Saba Translational Stop Codon, supplied by GenScript, used in various techniques. Bioz Stars score: 92/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/saba translational stop codon/product/GenScript
    Average 92 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    saba translational stop codon - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    MRC Ltd c 440 499del p
    Figure 4. Regulation of Lpl and its lipase activity by miR-27a and miR-29a. ( A ) The 3′UTR of the Lpl gene was cloned in full-length into the psiCHECK-2 dual-luciferase reporter plasmid immediately downstream of the <t>Renilla</t> luciferase reporter
    C 440 499del P, supplied by MRC Ltd, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c 440 499del p/product/MRC Ltd
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    c 440 499del p - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    84
    Thermo Fisher hoxa9 stop codon
    USF2 binding occupancy and transcriptional association with <t>HOXA9</t> . (A) ChIP-seq tracks from the publicly available ENCODE dataset of human ES cells identified the specific occupancy at HOXA7 and HOXA9 promoters. Other ChIP-seq tracks from SEM cells were used to define the open chromatin status of the locus. (B) Sequence conservation analysis of USF2 bound E-box motif (5’CACGTG3’) among different species.
    Hoxa9 Stop Codon, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hoxa9 stop codon/product/Thermo Fisher
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hoxa9 stop codon - by Bioz Stars, 2020-08
    84/100 stars
      Buy from Supplier

    Image Search Results


    Figure 4. Regulation of Lpl and its lipase activity by miR-27a and miR-29a. ( A ) The 3′UTR of the Lpl gene was cloned in full-length into the psiCHECK-2 dual-luciferase reporter plasmid immediately downstream of the Renilla luciferase reporter

    Journal: RNA Biology

    Article Title: Combinatorial regulation of lipoprotein lipase by microRNAs during mouse adipogenesis

    doi: 10.4161/rna.27655

    Figure Lengend Snippet: Figure 4. Regulation of Lpl and its lipase activity by miR-27a and miR-29a. ( A ) The 3′UTR of the Lpl gene was cloned in full-length into the psiCHECK-2 dual-luciferase reporter plasmid immediately downstream of the Renilla luciferase reporter

    Article Snippet: The full-length wild-type murine 3′untranslated region (3′UTR) of the Lpl gene was synthesized and cloned into the psiCHECK-2 vector (Promega) at XhoI/NotI sites downstream of Renilla luciferase translational stop codon (DNA2.0 Inc.).

    Techniques: Activity Assay, Clone Assay, Luciferase, Plasmid Preparation

    USF2 binding occupancy and transcriptional association with HOXA9 . (A) ChIP-seq tracks from the publicly available ENCODE dataset of human ES cells identified the specific occupancy at HOXA7 and HOXA9 promoters. Other ChIP-seq tracks from SEM cells were used to define the open chromatin status of the locus. (B) Sequence conservation analysis of USF2 bound E-box motif (5’CACGTG3’) among different species.

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: USF2 binding occupancy and transcriptional association with HOXA9 . (A) ChIP-seq tracks from the publicly available ENCODE dataset of human ES cells identified the specific occupancy at HOXA7 and HOXA9 promoters. Other ChIP-seq tracks from SEM cells were used to define the open chromatin status of the locus. (B) Sequence conservation analysis of USF2 bound E-box motif (5’CACGTG3’) among different species.

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques: Binding Assay, Chromatin Immunoprecipitation, Sequencing

    Time-course knocking down of USF2 and consequent HOXA9 expression analysis. Flow cytometry analysis was performed at day 0, 4, 6, 8 and 11 on the HOXA9 P2A-mCherry cells targeted with lentiviral Cas9 and four sgRNAs against USF2 . The sgLuc and sgRosa26 targeted cells were included as negative controls.

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: Time-course knocking down of USF2 and consequent HOXA9 expression analysis. Flow cytometry analysis was performed at day 0, 4, 6, 8 and 11 on the HOXA9 P2A-mCherry cells targeted with lentiviral Cas9 and four sgRNAs against USF2 . The sgLuc and sgRosa26 targeted cells were included as negative controls.

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques: Expressing, Flow Cytometry

    Transcriptional correlation between USF2 and HOXA9 in patient cohorts. Pearson’s correlation of transcriptional levels of HOXA9 and top 10 positive regulators identified from TF screen in a cohort of 1,988 B-ALL patients ( 26 ).

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: Transcriptional correlation between USF2 and HOXA9 in patient cohorts. Pearson’s correlation of transcriptional levels of HOXA9 and top 10 positive regulators identified from TF screen in a cohort of 1,988 B-ALL patients ( 26 ).

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques:

    The HOXA9 P2A-mCherry reporter allele recapitulates endogenous transcription of HOXA9 in MLLr SEM cells (A) Flow cytometry analysis of the HOXA9 P2A-mCherry cells targeted with luciferase-sgRNA and DOT1L-sgRNA. (B) Q-PCR analysis of the HOXA9 P2A-mCherry cells targeted with luciferase-sgRNA and DOT1L-sgRNA by using specific primers targeting the mRNA sequences of mCherry and HOXA9 . Three biological replicates were performed. Data shown are means ± SEM from replicate independent experiments. The P -value was calculated by performing a two-tailed t -test. (C) Flow cytometry analysis of the HOXA9 P2A-mCherry cells targeted with luciferase-sgRNA and ENL-sgRNA. (D) Q-PCR analysis of the HOXA9 P2A-mCherry cells targeted with luciferase-sgRNA and ENL-sgRNA by using specific primers targeting the mRNA sequence of mCherry and HOXA9 . Three biological replicates were performed. The P -value was calculated by performing a two-tailed t -test. (E) The correlation of transcription reduction in mCherry and HOXA9 in response to CRISPR–mediated targeting was calculated by Pearson’s correlation test. (F) Fluorescence imaging was performed on the HOXA9 P2A-mCherry cells treated with various dosages of DOT1L inhibitor SGC0946 for six days. Representative images were shown for comparison between 0.3 nM and 10 μM dosages. For each dosage treatment, four replicates were conducted (scale bar 50 μm). (G) Fluorescence curve was generated according to mCherry intensity in response to dosage dependent treatment of drug for six days. About 20,000 cells were split in each of the 384-well at the starting time point. (H) Flow cytometry analysis of the HOXA9 P2A-mCherry cells treated with DMSO and various dosages of the DOT1L inhibitor SGC0946. (I) Q-PCR analysis of the HOXA9 P2A-mCherry cells with or without the six-day treatment of the DOT1L inhibitor SGC0946 by using specific primers targeting the mRNA sequences of mCherry and HOXA9 . The correlation of transcription reduction in mCherry and HOXA9 in response to inhibitor–mediated transcription repression was calculated by performing Pearson’s correlation test.

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: The HOXA9 P2A-mCherry reporter allele recapitulates endogenous transcription of HOXA9 in MLLr SEM cells (A) Flow cytometry analysis of the HOXA9 P2A-mCherry cells targeted with luciferase-sgRNA and DOT1L-sgRNA. (B) Q-PCR analysis of the HOXA9 P2A-mCherry cells targeted with luciferase-sgRNA and DOT1L-sgRNA by using specific primers targeting the mRNA sequences of mCherry and HOXA9 . Three biological replicates were performed. Data shown are means ± SEM from replicate independent experiments. The P -value was calculated by performing a two-tailed t -test. (C) Flow cytometry analysis of the HOXA9 P2A-mCherry cells targeted with luciferase-sgRNA and ENL-sgRNA. (D) Q-PCR analysis of the HOXA9 P2A-mCherry cells targeted with luciferase-sgRNA and ENL-sgRNA by using specific primers targeting the mRNA sequence of mCherry and HOXA9 . Three biological replicates were performed. The P -value was calculated by performing a two-tailed t -test. (E) The correlation of transcription reduction in mCherry and HOXA9 in response to CRISPR–mediated targeting was calculated by Pearson’s correlation test. (F) Fluorescence imaging was performed on the HOXA9 P2A-mCherry cells treated with various dosages of DOT1L inhibitor SGC0946 for six days. Representative images were shown for comparison between 0.3 nM and 10 μM dosages. For each dosage treatment, four replicates were conducted (scale bar 50 μm). (G) Fluorescence curve was generated according to mCherry intensity in response to dosage dependent treatment of drug for six days. About 20,000 cells were split in each of the 384-well at the starting time point. (H) Flow cytometry analysis of the HOXA9 P2A-mCherry cells treated with DMSO and various dosages of the DOT1L inhibitor SGC0946. (I) Q-PCR analysis of the HOXA9 P2A-mCherry cells with or without the six-day treatment of the DOT1L inhibitor SGC0946 by using specific primers targeting the mRNA sequences of mCherry and HOXA9 . The correlation of transcription reduction in mCherry and HOXA9 in response to inhibitor–mediated transcription repression was calculated by performing Pearson’s correlation test.

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques: Flow Cytometry, Luciferase, Polymerase Chain Reaction, Two Tailed Test, Sequencing, CRISPR, Fluorescence, Imaging, Generated

    CTCF regulates HOXA9 expression in human colorectal cancer HCT116 cells. (A) ChIP-seq tracks from publicly available ENCODE dataset demonstrated the enriched transcription factor occupancy at CBS7/9 in HCT116 cells RNA-seq profiles of HOXA7 , HOXA9 and HOXA10 in CTCF depleted SEM cells. (B) Q-PCR analysis of HOXA7 and HOXA9 in HCT116 cells transfected with CTCF-siRNAs and NT-siRNAs for 48 hours. Data are means ± SEM from two independent experiments. *p

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: CTCF regulates HOXA9 expression in human colorectal cancer HCT116 cells. (A) ChIP-seq tracks from publicly available ENCODE dataset demonstrated the enriched transcription factor occupancy at CBS7/9 in HCT116 cells RNA-seq profiles of HOXA7 , HOXA9 and HOXA10 in CTCF depleted SEM cells. (B) Q-PCR analysis of HOXA7 and HOXA9 in HCT116 cells transfected with CTCF-siRNAs and NT-siRNAs for 48 hours. Data are means ± SEM from two independent experiments. *p

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques: Expressing, Chromatin Immunoprecipitation, RNA Sequencing Assay, Polymerase Chain Reaction, Transfection

    USF1 and USF2 synthetically regulate HOXA9 expression in MLLr leukemia (A) Immunoblotting analysis was conducted on the sgUSF2.2 targeted MOLM13 cells and control SEM cells to monitor the reduction of USF2 protein. (B) Q-PCR analysis was conducted on the sgUSF2.2 targeted MOLM13 cells and control SEM cells to monitor the reduction of USF2 protein. Data shown are means ± SEM from three independent experiments. **p

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: USF1 and USF2 synthetically regulate HOXA9 expression in MLLr leukemia (A) Immunoblotting analysis was conducted on the sgUSF2.2 targeted MOLM13 cells and control SEM cells to monitor the reduction of USF2 protein. (B) Q-PCR analysis was conducted on the sgUSF2.2 targeted MOLM13 cells and control SEM cells to monitor the reduction of USF2 protein. Data shown are means ± SEM from three independent experiments. **p

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques: Expressing, Polymerase Chain Reaction

    Validation of ectopic overexpression of HOXA9. A retroviral mouse Hoxa9 expression cassette was infected into SEM cells followed by quantification of Q-PCR using specific primers against mouse Hoxa9 coding sequence. Data are means ± SEM from two independent experiments.

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: Validation of ectopic overexpression of HOXA9. A retroviral mouse Hoxa9 expression cassette was infected into SEM cells followed by quantification of Q-PCR using specific primers against mouse Hoxa9 coding sequence. Data are means ± SEM from two independent experiments.

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques: Over Expression, Expressing, Infection, Polymerase Chain Reaction, Sequencing

    HOXA9 expression profiling in leukemia (A) HOXA9 expression in different leukemia lineages (GSE13159). (B) Kaplan-Meier survival curve indicated the poor outcome associated with high HOXA9 expression (GSE13159). (C) HOXA9 expression was revealed by leukemia subtypes in MILE leukemia study cohort (bloodspot). (D) HOXA9 protein level was assessed by immunoblotting in MLLr and non-MLLr leukemia cell lines. (E) HOXA9 mRNA level was assessed by Q-PCR in MLLr and non-MLLr leukemia cell lines.

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: HOXA9 expression profiling in leukemia (A) HOXA9 expression in different leukemia lineages (GSE13159). (B) Kaplan-Meier survival curve indicated the poor outcome associated with high HOXA9 expression (GSE13159). (C) HOXA9 expression was revealed by leukemia subtypes in MILE leukemia study cohort (bloodspot). (D) HOXA9 protein level was assessed by immunoblotting in MLLr and non-MLLr leukemia cell lines. (E) HOXA9 mRNA level was assessed by Q-PCR in MLLr and non-MLLr leukemia cell lines.

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques: Expressing, Polymerase Chain Reaction

    Pooled CRISPR/Cas9 screening identified a novel transcription factor USF2 regulating HOXA9 (A) Schematic diagram of a working model of loss-of-function CRISPR screening targeting 1,639 human transcription factors. (B) Gene ranking of all transcription factors from screening was illustrated with HOXA9 , USF2 , DOT1L , CTCF and YY1 highlighted. The enrichment score of seven sgRNAs against each transcription factor was combined by the MAGeCK algorithm. (C) Top: the overall distribution of all sgRNAs from the screening was shown based on the p-value and the DEseq2 score calculated by Log 2 [Fold Change (mCherry High /mCherry Low )]. Bottom: NT, HOXA9 and USF2 sgRNAs were highlighted by different color code. (D) The ratio for all sgRNAs targeting the top 2 hits, HOXA9 and USF2 , are shown between mCherry High and mCherry Low sorted population. NT sgRNAs were overlaid on a gray gradient depicting the overall distribution. NT: 100 sgRNAs. Transcription factors: 7 sgRNAs/each.

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: Pooled CRISPR/Cas9 screening identified a novel transcription factor USF2 regulating HOXA9 (A) Schematic diagram of a working model of loss-of-function CRISPR screening targeting 1,639 human transcription factors. (B) Gene ranking of all transcription factors from screening was illustrated with HOXA9 , USF2 , DOT1L , CTCF and YY1 highlighted. The enrichment score of seven sgRNAs against each transcription factor was combined by the MAGeCK algorithm. (C) Top: the overall distribution of all sgRNAs from the screening was shown based on the p-value and the DEseq2 score calculated by Log 2 [Fold Change (mCherry High /mCherry Low )]. Bottom: NT, HOXA9 and USF2 sgRNAs were highlighted by different color code. (D) The ratio for all sgRNAs targeting the top 2 hits, HOXA9 and USF2 , are shown between mCherry High and mCherry Low sorted population. NT sgRNAs were overlaid on a gray gradient depicting the overall distribution. NT: 100 sgRNAs. Transcription factors: 7 sgRNAs/each.

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques: CRISPR

    Cytogenetic characterization HOXA9 knock-in allele in MLLr SEM cells (A) The genomic HOXA9 location was highlighted in human chromosome 7. (B) Karyotype analysis of parental MLLr SEM cells indicating the mono-allelic deletion of partial segment in chromosome 7 containing the HOXA cluster (red arrow). Black arrows indicated other chromosome alterations including t4,11 translocation and trisomy 8. (C) Chromosome analysis of spectral karyotyping (SKY) was conducted by using a commercially prepared SKY probe from Applied Spectral Imaging (Carlsbad, CA) on HOXA9 reporter cells. Translocation between chr4 and chr11, trisomy 8 and micro-deletion of chr7 was confirmed. (D) FISH analysis confirming the co-localization of HOXA9 and mCherry in targeted cells at interphase (left) and metaphase (right). The P2A-mCherry DNA was labeled with a red-dUTP by nick translation, and an HOXA9 BAC clone was labeled with a green-dUTP. The cells were then stained with 4,6-diamidino-2-phenylindole (DAPI) to visualize the nuclei. A representative cell image is shown for the pattern of hybridization (pairing of red and green signals).

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: Cytogenetic characterization HOXA9 knock-in allele in MLLr SEM cells (A) The genomic HOXA9 location was highlighted in human chromosome 7. (B) Karyotype analysis of parental MLLr SEM cells indicating the mono-allelic deletion of partial segment in chromosome 7 containing the HOXA cluster (red arrow). Black arrows indicated other chromosome alterations including t4,11 translocation and trisomy 8. (C) Chromosome analysis of spectral karyotyping (SKY) was conducted by using a commercially prepared SKY probe from Applied Spectral Imaging (Carlsbad, CA) on HOXA9 reporter cells. Translocation between chr4 and chr11, trisomy 8 and micro-deletion of chr7 was confirmed. (D) FISH analysis confirming the co-localization of HOXA9 and mCherry in targeted cells at interphase (left) and metaphase (right). The P2A-mCherry DNA was labeled with a red-dUTP by nick translation, and an HOXA9 BAC clone was labeled with a green-dUTP. The cells were then stained with 4,6-diamidino-2-phenylindole (DAPI) to visualize the nuclei. A representative cell image is shown for the pattern of hybridization (pairing of red and green signals).

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques: Knock-In, Translocation Assay, Imaging, Fluorescence In Situ Hybridization, Labeling, Nick Translation, BAC Assay, Staining, Hybridization

    Non-coding regulation profiling of HOXA9 (A) The global correlation of sgRNAs enrichment in selected regions from dCas9-KRAB and Cas9 screens in the HOXA9 P2A-Cherry reporter cell line. (B) The global distribution of 2,029 sgRNAs targeting the INK4 / ARF locus region from the Cas9 screen in the HOXA9 P2A-Cherry reporter cell line. (C) Flow cytometry analysis was conducted to validate the transcriptional regulation of HOXA9 by screen identified cis -acting regulatory elements in dCas9-KRAB-expressing HOXA9 P2A-mCherry reporter SEM cells infected with individual sgRNAs. (D) Q-PCR was performed to validate the transcriptional regulation of HOXA9 by sgRNAs identified from Cas9 mediated non-coding screen. Individual sgRNAs were infected into SEM cells expressing Cas9 followed by Q-PCR assay against HOXA9 . (E) A sgRNA against coding sequence of mCherry was infected into Cas9-expressing HOXA9 P2A-mCherry reporter SEM cells followed by Q-PCR assay against HOXA9 .

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: Non-coding regulation profiling of HOXA9 (A) The global correlation of sgRNAs enrichment in selected regions from dCas9-KRAB and Cas9 screens in the HOXA9 P2A-Cherry reporter cell line. (B) The global distribution of 2,029 sgRNAs targeting the INK4 / ARF locus region from the Cas9 screen in the HOXA9 P2A-Cherry reporter cell line. (C) Flow cytometry analysis was conducted to validate the transcriptional regulation of HOXA9 by screen identified cis -acting regulatory elements in dCas9-KRAB-expressing HOXA9 P2A-mCherry reporter SEM cells infected with individual sgRNAs. (D) Q-PCR was performed to validate the transcriptional regulation of HOXA9 by sgRNAs identified from Cas9 mediated non-coding screen. Individual sgRNAs were infected into SEM cells expressing Cas9 followed by Q-PCR assay against HOXA9 . (E) A sgRNA against coding sequence of mCherry was infected into Cas9-expressing HOXA9 P2A-mCherry reporter SEM cells followed by Q-PCR assay against HOXA9 .

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques: Flow Cytometry, Expressing, Infection, Polymerase Chain Reaction, Sequencing

    CTCF is dispensable for maintaining HOXA9 expression in MLLr SEM cells (A) Immunoblotting analysis of CTCF AID , MYC and HOXA9 in three bi-allelic knock-in clones 27, 35 and 42 with or without auxin (IAA) treatment. GAPDH was used as a loading control. (B) CTCF Cut Run tracks shown at the selective viewpoint of the HOXA9 locus where significant reduction of CTCF binding at CBS7/9 occurs following 48-hour IAA treatment in clones 27, 35, and 42. ChIP-seq tracks of CTCF, AFF1 and H3K27ac were included to indicate the open chromatin status of the locus. (C) Q-PCR analysis of HOXA9 was conducted to monitor the transcriptional response to CTCF depletion for 24, 48 hours and washout from three biological replicates; clones 27, 35, and 42 (N=3). Data shown are means ± SEM from three independent experiments. *p

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: CTCF is dispensable for maintaining HOXA9 expression in MLLr SEM cells (A) Immunoblotting analysis of CTCF AID , MYC and HOXA9 in three bi-allelic knock-in clones 27, 35 and 42 with or without auxin (IAA) treatment. GAPDH was used as a loading control. (B) CTCF Cut Run tracks shown at the selective viewpoint of the HOXA9 locus where significant reduction of CTCF binding at CBS7/9 occurs following 48-hour IAA treatment in clones 27, 35, and 42. ChIP-seq tracks of CTCF, AFF1 and H3K27ac were included to indicate the open chromatin status of the locus. (C) Q-PCR analysis of HOXA9 was conducted to monitor the transcriptional response to CTCF depletion for 24, 48 hours and washout from three biological replicates; clones 27, 35, and 42 (N=3). Data shown are means ± SEM from three independent experiments. *p

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques: Expressing, Knock-In, Clone Assay, Binding Assay, Chromatin Immunoprecipitation, Polymerase Chain Reaction

    Establishment and characterization of the HOXA9 P2A-mCherry reporter human MLLr leukemia cell line (A) Schematic diagram of the knock-in design and genotyping PCR primer design for the HOXA9 P2A-mCherry reporter allele. (B) Flow cytometry analysis of HOXA9 P2A-mCherry reporter cells. Wild-type SEM cells were used as negative controls. (C) Genotyping PCR products from the 5′ and 3′ knock-in boundaries were sequenced to verify the seamless knock-in of the mCherry reporter gene to the endogenous locus. (D) Fluorescence in situ hybridization of the P2A-mCherry knock-in cassette in HOXA9 P2A-mCherry reporter cells. The P2A-mCherry DNA was labeled with a red-dUTP by nick translation, and an HOXA9 BAC clone was labeled with a green-dUTP. The cells were then stained with 4,6-diamidino-2-phenylindole (DAPI) to visualize the nuclei. A representative metaphase cell image is shown for the pattern of hybridization (pairing of red and green signals). (E) RNA-seq data of all HOXA cluster genes were illustrated as log 2 (normalized numbers of FPKM) from two replicate samples of SEM cells. HOXA7 , HOXA9 and HOXA10 were highlighted by color code. (F) Q-PCR analysis confirmed the unaffected HOXA cluster gene transcription between HOXA9 P2A-mCherry reporter (KI) and WT SEM cells. Data shown are means ± SEM from replicate independent experiments. *p

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: Establishment and characterization of the HOXA9 P2A-mCherry reporter human MLLr leukemia cell line (A) Schematic diagram of the knock-in design and genotyping PCR primer design for the HOXA9 P2A-mCherry reporter allele. (B) Flow cytometry analysis of HOXA9 P2A-mCherry reporter cells. Wild-type SEM cells were used as negative controls. (C) Genotyping PCR products from the 5′ and 3′ knock-in boundaries were sequenced to verify the seamless knock-in of the mCherry reporter gene to the endogenous locus. (D) Fluorescence in situ hybridization of the P2A-mCherry knock-in cassette in HOXA9 P2A-mCherry reporter cells. The P2A-mCherry DNA was labeled with a red-dUTP by nick translation, and an HOXA9 BAC clone was labeled with a green-dUTP. The cells were then stained with 4,6-diamidino-2-phenylindole (DAPI) to visualize the nuclei. A representative metaphase cell image is shown for the pattern of hybridization (pairing of red and green signals). (E) RNA-seq data of all HOXA cluster genes were illustrated as log 2 (normalized numbers of FPKM) from two replicate samples of SEM cells. HOXA7 , HOXA9 and HOXA10 were highlighted by color code. (F) Q-PCR analysis confirmed the unaffected HOXA cluster gene transcription between HOXA9 P2A-mCherry reporter (KI) and WT SEM cells. Data shown are means ± SEM from replicate independent experiments. *p

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques: Knock-In, Polymerase Chain Reaction, Flow Cytometry, Fluorescence, In Situ Hybridization, Labeling, Nick Translation, BAC Assay, Staining, Hybridization, RNA Sequencing Assay

    Cytogenetic characterization of the HOXA9 knock-in allele in MLLr SEM cells (A) Pearson’s correlation of normalized sgRNA counts in mCherry High and mCherry Low sorted populations. (B) Gene ranking of the top 10 positive and negative candidate regulators of HOXA9 enriched from screening analysis by MAGeCK algorithm. (C) Normalized sgRNA count distribution of each of seven sgRNAs against HOXA9 . (D) Normalized sgRNA count distribution of each of seven sgRNAs against USF2 .

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: Cytogenetic characterization of the HOXA9 knock-in allele in MLLr SEM cells (A) Pearson’s correlation of normalized sgRNA counts in mCherry High and mCherry Low sorted populations. (B) Gene ranking of the top 10 positive and negative candidate regulators of HOXA9 enriched from screening analysis by MAGeCK algorithm. (C) Normalized sgRNA count distribution of each of seven sgRNAs against HOXA9 . (D) Normalized sgRNA count distribution of each of seven sgRNAs against USF2 .

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques: Knock-In

    USF2 is required to maintain HOXA9 expression in MLLr leukemia (A) Flow cytometry analysis was performed at day 8 on the HOXA9 P2A-mCherry cells targeted with lentiviral Cas9 and four sgRNAs against USF2 . The sgENL targeted cells were used as positive controls while sgLuc targeted cells were used as negative controls. (B) Q-PCR analysis was conducted on the USF2 targeted cells to monitor the reduction of HOXA9 . The sgENL targeted cells were used as positive controls while sgLuc targeted cells were used as negative controls. Data shown are means ± SEM from three independent experiments. *p

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: USF2 is required to maintain HOXA9 expression in MLLr leukemia (A) Flow cytometry analysis was performed at day 8 on the HOXA9 P2A-mCherry cells targeted with lentiviral Cas9 and four sgRNAs against USF2 . The sgENL targeted cells were used as positive controls while sgLuc targeted cells were used as negative controls. (B) Q-PCR analysis was conducted on the USF2 targeted cells to monitor the reduction of HOXA9 . The sgENL targeted cells were used as positive controls while sgLuc targeted cells were used as negative controls. Data shown are means ± SEM from three independent experiments. *p

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques: Expressing, Flow Cytometry, Polymerase Chain Reaction

    Auxin-inducible degradation of CTCF does not affect HOXA9 expression in SEM cells. (A) Flow diagram of auxin-inducible degradation model to acutely deplete endogenous CTCF protein. Dox, doxycycline; IAA: auxin. (B) RNA-seq profiles of HOXA7 , HOXA9 and HOXA10 in CTCF depleted SEM cells. (C) Quantification of HOXA7 , HOXA9 and HOXA10 levels in three knockin clones of CTCF depleted SEM cells.

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: Auxin-inducible degradation of CTCF does not affect HOXA9 expression in SEM cells. (A) Flow diagram of auxin-inducible degradation model to acutely deplete endogenous CTCF protein. Dox, doxycycline; IAA: auxin. (B) RNA-seq profiles of HOXA7 , HOXA9 and HOXA10 in CTCF depleted SEM cells. (C) Quantification of HOXA7 , HOXA9 and HOXA10 levels in three knockin clones of CTCF depleted SEM cells.

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques: Expressing, RNA Sequencing Assay, Knock-In, Clone Assay

    Non-coding regulation of HOXA9 relies on chromatin architecture in HOXA locus (A) Schematic diagram of dCas9-KRAB and Cas9 mediated non-coding screening in combination with HOXA9 P2A-mCherry reporter allele. Total 10, 551 sgRNAs were designed and pooled in the non-coding library spanning the H3K27ac/ATAC-seq peaks identified from human leukemia cell lines (CCLE). (B) The global correlation of sgRNA distribution in dCas9-KRAB and Cas9 mediated screens. (C) Significant enrichment of sgRNAs targeting HOXA6-10 regions was observed compared with other HOXA regions from the Cas9 mediated non-coding screen. (D) The global distribution of all sgRNAs in a selected region (chr7:27,097,176-27,357,040) of the HOXA locus from two screens in the HOXA9 P2A-mCherry reporter cell line using dCas9-KRAB and Cas9. The sgRNAs with p-value cutoff of 0.01 were shown by blue in Cas9 and red in dCas9-KRAB mediated screens. Whole genome bisulfite sequencing indicated the hypomethylation status of HOXA6-10 region in SEM cells. (E) Physical chromatin interactions between HOXA9 and adjacent regions were detected by the next-generation Capture-C on parental SEM cells with or without CTCF protein. Two specific anchor probes (probe 1 and probe 2) were designed to hybridize to the HOXA9 promoter, which identified six (A-F) interaction regions. The arrows indicate the Cut Run peaks of USF2 in those HOXA9-interacted chromatin regions.

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: Non-coding regulation of HOXA9 relies on chromatin architecture in HOXA locus (A) Schematic diagram of dCas9-KRAB and Cas9 mediated non-coding screening in combination with HOXA9 P2A-mCherry reporter allele. Total 10, 551 sgRNAs were designed and pooled in the non-coding library spanning the H3K27ac/ATAC-seq peaks identified from human leukemia cell lines (CCLE). (B) The global correlation of sgRNA distribution in dCas9-KRAB and Cas9 mediated screens. (C) Significant enrichment of sgRNAs targeting HOXA6-10 regions was observed compared with other HOXA regions from the Cas9 mediated non-coding screen. (D) The global distribution of all sgRNAs in a selected region (chr7:27,097,176-27,357,040) of the HOXA locus from two screens in the HOXA9 P2A-mCherry reporter cell line using dCas9-KRAB and Cas9. The sgRNAs with p-value cutoff of 0.01 were shown by blue in Cas9 and red in dCas9-KRAB mediated screens. Whole genome bisulfite sequencing indicated the hypomethylation status of HOXA6-10 region in SEM cells. (E) Physical chromatin interactions between HOXA9 and adjacent regions were detected by the next-generation Capture-C on parental SEM cells with or without CTCF protein. Two specific anchor probes (probe 1 and probe 2) were designed to hybridize to the HOXA9 promoter, which identified six (A-F) interaction regions. The arrows indicate the Cut Run peaks of USF2 in those HOXA9-interacted chromatin regions.

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques: Methylation Sequencing, Capture-C

    USF2 is a selectively essential gene in MLLr leukemia by controlling HOXA9 expression (A) Competitive proliferation assay was conducted by infecting SEM Cas9 cells with Lentiviral-mCherry-sgRNAs against luciferase (sgLuc) and USF2 (sgUSF 2-2, 2-3 and 2-5) at about 50% efficiency. The mCherry% was quantified every three days by flow cytometry to evaluate the growth disadvantage. The survival essential gene sgRPS19 was included as a positive control. (B) Rescued competitive proliferation assay was conducted by infecting SEM cells overexpressing ectopic HOXA9 with Lentiviral-mCherry-sgRNAs against luciferase (sgLuc) and USF2 (sgUSF2-2, 2-3 and 2-5) at about 50% efficiency. The mCherry% was quantified every three days by flow cytometry to evaluate the growth disadvantage. (C) Flow diagram of dropout CRISPR screening procedure. (D) Gene ranking of all transcription factors from dropout screening was illustrated. The enrichment score of seven sgRNAs against each transcription factor was combined by the MAGeCK algorithm. (E) Pearson’s correlation of transcriptional levels of USF2 and HOXA9 in a cohort of 1,988 B-ALL patients ( 26 ). (F) Pearson’s correlation of transcriptional levels of USF2 and HOXA9 in a cohort of 136 MLLr B-ALL subtype patients.

    Journal: bioRxiv

    Article Title: Functional Interrogation of HOXA9 Regulome in MLLr Leukemia via Reporter-based CRISPR/Cas9 screen

    doi: 10.1101/2020.04.20.050583

    Figure Lengend Snippet: USF2 is a selectively essential gene in MLLr leukemia by controlling HOXA9 expression (A) Competitive proliferation assay was conducted by infecting SEM Cas9 cells with Lentiviral-mCherry-sgRNAs against luciferase (sgLuc) and USF2 (sgUSF 2-2, 2-3 and 2-5) at about 50% efficiency. The mCherry% was quantified every three days by flow cytometry to evaluate the growth disadvantage. The survival essential gene sgRPS19 was included as a positive control. (B) Rescued competitive proliferation assay was conducted by infecting SEM cells overexpressing ectopic HOXA9 with Lentiviral-mCherry-sgRNAs against luciferase (sgLuc) and USF2 (sgUSF2-2, 2-3 and 2-5) at about 50% efficiency. The mCherry% was quantified every three days by flow cytometry to evaluate the growth disadvantage. (C) Flow diagram of dropout CRISPR screening procedure. (D) Gene ranking of all transcription factors from dropout screening was illustrated. The enrichment score of seven sgRNAs against each transcription factor was combined by the MAGeCK algorithm. (E) Pearson’s correlation of transcriptional levels of USF2 and HOXA9 in a cohort of 1,988 B-ALL patients ( 26 ). (F) Pearson’s correlation of transcriptional levels of USF2 and HOXA9 in a cohort of 136 MLLr B-ALL subtype patients.

    Article Snippet: Vector construction A pair of oligomers containing a 20-bp sgRNA (5’-AAAGACGAGTGATGCCATTT-3’) sequence targeting the surrounding genomic segment of HOXA9 stop codon was synthesized (Thermo Fisher Scientific) and cloned into the all-in-one vector, pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites.

    Techniques: Expressing, Proliferation Assay, Luciferase, Flow Cytometry, Positive Control, CRISPR