trcn0000072085 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher taqman microrna assays
    Taqman Microrna Assays, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 8619 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman microrna assays/product/Thermo Fisher
    Average 99 stars, based on 8619 article reviews
    Price from $9.99 to $1999.99
    taqman microrna assays - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Millipore shrna constructs
    Amot130 and <t>AIP4</t> interdependently inhibit YAP. A , the levels of YFP-tagged Amot130 as well as endogenous AIP4, YAP, and GAPDH were detected in lysates from MDA-MB-468 cells stably expressing control or AIP4 <t>shRNA</t> in combination with YFP-tagged Amot130
    Shrna Constructs, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1860 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna constructs/product/Millipore
    Average 99 stars, based on 1860 article reviews
    Price from $9.99 to $1999.99
    shrna constructs - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    80
    Thermo Fisher ccggcggctcaagaaggaagttgaactcgagttcaacttccttcttgagccgtttttg
    Amot130 and <t>AIP4</t> interdependently inhibit YAP. A , the levels of YFP-tagged Amot130 as well as endogenous AIP4, YAP, and GAPDH were detected in lysates from MDA-MB-468 cells stably expressing control or AIP4 <t>shRNA</t> in combination with YFP-tagged Amot130
    Ccggcggctcaagaaggaagttgaactcgagttcaacttccttcttgagccgtttttg, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ccggcggctcaagaaggaagttgaactcgagttcaacttccttcttgagccgtttttg/product/Thermo Fisher
    Average 80 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    ccggcggctcaagaaggaagttgaactcgagttcaacttccttcttgagccgtttttg - by Bioz Stars, 2020-03
    80/100 stars
      Buy from Supplier

    86
    Millipore 5 ccgggccatcaactgctatgccaatctcgagattggcatagcagttgatggcttttt 3
    Amot130 and <t>AIP4</t> interdependently inhibit YAP. A , the levels of YFP-tagged Amot130 as well as endogenous AIP4, YAP, and GAPDH were detected in lysates from MDA-MB-468 cells stably expressing control or AIP4 <t>shRNA</t> in combination with YFP-tagged Amot130
    5 Ccgggccatcaactgctatgccaatctcgagattggcatagcagttgatggcttttt 3, supplied by Millipore, used in various techniques. Bioz Stars score: 86/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 ccgggccatcaactgctatgccaatctcgagattggcatagcagttgatggcttttt 3/product/Millipore
    Average 86 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    5 ccgggccatcaactgctatgccaatctcgagattggcatagcagttgatggcttttt 3 - by Bioz Stars, 2020-03
    86/100 stars
      Buy from Supplier

    82
    Millipore arl8b
    Juxtanuclear lysosome aggregation does not reverse EMT (A) DU145 Mesenchymal cells were transfected with lentiviral delivered scrambled or <t>Arl8b</t> shRNA and knockdown was determined by immunoblot. (B) DU145 Epithelial, Mesenchymal Non Target, or Mesenchymal Arl8b KD were treated with 25 μM EIPA or vehicle control and fixed and stained for LAMP-1 (red), phalloidin (green), and DAPI (blue); N=3. (C) Represents mean lysosome distribution of 25 cells. *=P
    Arl8b, supplied by Millipore, used in various techniques. Bioz Stars score: 82/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/arl8b/product/Millipore
    Average 82 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    arl8b - by Bioz Stars, 2020-03
    82/100 stars
      Buy from Supplier

    99
    Millipore fluorescent protein
    Juxtanuclear lysosome aggregation does not reverse EMT (A) DU145 Mesenchymal cells were transfected with lentiviral delivered scrambled or <t>Arl8b</t> shRNA and knockdown was determined by immunoblot. (B) DU145 Epithelial, Mesenchymal Non Target, or Mesenchymal Arl8b KD were treated with 25 μM EIPA or vehicle control and fixed and stained for LAMP-1 (red), phalloidin (green), and DAPI (blue); N=3. (C) Represents mean lysosome distribution of 25 cells. *=P
    Fluorescent Protein, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 133 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluorescent protein/product/Millipore
    Average 99 stars, based on 133 article reviews
    Price from $9.99 to $1999.99
    fluorescent protein - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Millipore plko 1
    Juxtanuclear lysosome aggregation does not reverse EMT (A) DU145 Mesenchymal cells were transfected with lentiviral delivered scrambled or <t>Arl8b</t> shRNA and knockdown was determined by immunoblot. (B) DU145 Epithelial, Mesenchymal Non Target, or Mesenchymal Arl8b KD were treated with 25 μM EIPA or vehicle control and fixed and stained for LAMP-1 (red), phalloidin (green), and DAPI (blue); N=3. (C) Represents mean lysosome distribution of 25 cells. *=P
    Plko 1, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 846 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1/product/Millipore
    Average 99 stars, based on 846 article reviews
    Price from $9.99 to $1999.99
    plko 1 - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    79
    Millipore plko 1 shkrit1 lentiviral expression vectors
    miR-21 regulates anchorage-independent growth opposite to KRIT1. (A) KRIT1 expression modulations were analyzed in MC-1 or MDAMB231 cells stably transduced with <t>lentiviral</t> vectors containing either specific <t>shKRIT1</t> (pLKO.1-sh-KRIT1 #1 to #4) or a KRIT1 cDNA lacking its 3′UTR (pCLL-KRIT1 or pLVX-KRIT1) or empty controls (pLKO.1-sh-ctrl or pCLL-ctrl or pLVX-ctrl) by Western Blot (WB) analysis and actin was used as loading control. 3 independent analyses were performed in triplicate and representative results are shown. (B–E) Anchorage-independent growth of MDAMB231 and MC-1 cells transfected with miR-21 precursors or inhibitors or their negative controls (pre- and anti-miR-21 or control) or stably transduced with lentiviral vectors containing either specific shKRIT1 (pLKO.1-sh-KRIT1-3, -4) or a KRIT1 cDNA lacking its 3′UTR (pCLL-KRIT1 or pLVX-KRIT1) or empty controls (pLKO.1-sh-control or pCLL-ctrl or pLVX-ctrl). All results are shown as mean ± SEM of the area covered by colonies (pixels). Three independent experiments were performed in triplicate and representative results are shown. (F) Cartoon showing the proposed model for the role of KRIT1 in miR-21-mediated tumorigenesis.
    Plko 1 Shkrit1 Lentiviral Expression Vectors, supplied by Millipore, used in various techniques. Bioz Stars score: 79/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 shkrit1 lentiviral expression vectors/product/Millipore
    Average 79 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    plko 1 shkrit1 lentiviral expression vectors - by Bioz Stars, 2020-03
    79/100 stars
      Buy from Supplier

    84
    Thermo Fisher distinct mekk2 shrna sequences
    <t>MEKK2</t> knockdown stabilizes focal adhesions. (A) Immunoblot of MDA-MB 231 lysates displaying expression of MEKK2 (upper panel), MEKK3 (middle panel), and total ERK2 as a loading control (lower panel) from control cells, cells treated with MEKK2 <t>shRNA</t> #'s
    Distinct Mekk2 Shrna Sequences, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 84/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/distinct mekk2 shrna sequences/product/Thermo Fisher
    Average 84 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    distinct mekk2 shrna sequences - by Bioz Stars, 2020-03
    84/100 stars
      Buy from Supplier

    89
    Millipore plko trc001
    <t>MEKK2</t> knockdown stabilizes focal adhesions. (A) Immunoblot of MDA-MB 231 lysates displaying expression of MEKK2 (upper panel), MEKK3 (middle panel), and total ERK2 as a loading control (lower panel) from control cells, cells treated with MEKK2 <t>shRNA</t> #'s
    Plko Trc001, supplied by Millipore, used in various techniques. Bioz Stars score: 89/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko trc001/product/Millipore
    Average 89 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    plko trc001 - by Bioz Stars, 2020-03
    89/100 stars
      Buy from Supplier

    81
    Thermo Fisher u6 snrna id001973
    <t>MEKK2</t> knockdown stabilizes focal adhesions. (A) Immunoblot of MDA-MB 231 lysates displaying expression of MEKK2 (upper panel), MEKK3 (middle panel), and total ERK2 as a loading control (lower panel) from control cells, cells treated with MEKK2 <t>shRNA</t> #'s
    U6 Snrna Id001973, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 81/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/u6 snrna id001973/product/Thermo Fisher
    Average 81 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    u6 snrna id001973 - by Bioz Stars, 2020-03
    81/100 stars
      Buy from Supplier

    99
    Thermo Fisher human prmt5
    Role of the <t>PRMT5</t> G tracts as splicing silencers. (A) Splicing of the PRMT5-3′SS splicing reporter minigenes, containing 3′SS of different species upstream of middle exon in the DUP175 vector. Upper panel, diagram of the minigenes. Black bar, upstream 3′SS of PRMT5 exon 3 of different species that replaced the corresponding 3′SS of DUP175 (not to scale). Splicing patterns are indicated by slanted lines linking exons (boxes). *, cryptic splicing; arrowhead, reverse primer for primer extension. Lower panel, representative denaturing PAGE gels of primer extension assays of minigenes containing the upstream 3′SS of vector (lane 2) or of PRMT5 exon 3 of different species (lanes 3 to 8). C, mock-transfected sample. The percentages (%) of exon skipping are calculated as the intensity of the 204-nt product relative to the total of the 204-nt and full-length (379-nt) products in each lane. S.D., standard deviation; nt, nucleotides; WT, wild type; Mut, mutant. (B) Upper panel, diagram of the minigene for human PRMT5 exon 3 (E3; 86 nt) and its splicing products (not to scale). Black box and long bars, human PRMT5 exon 3 and partial flanking introns, respectively. Short bar, wild-type G tracts or mutant. Arrowhead, primer. Lower panel, primer extension assay performed as described for panel A. (C) UV cross-linking assay of the binding of hnRNP H/F to the human PRMT5 G tracts. Upper panel, probes used in UV cross-linking. Lower panel, phosphorimages of PAGE gels of proteins from HeLa nuclear extract cross-linked to wild-type or mutant RNA probes (lanes 2 and 3) and immunoprecipitated hnRNP H(H1) from the reactions (IP; lanes 4 to 6). (D) Effect of hnRNP H/F knockdown on endogenous PRMT5 exon 3 skipping in HeLa cells. Upper panel, Western blot analysis of nontreated or mock-, control siRNA (scrambled)-, or hnRNP H/F siRNA-transfected HeLa cell lysates (lanes 1 to 4), showing knockdown of hnRNP H/F. Lower panel, denaturing PAGE gels of semiquantitative RT-PCR of endogenous PRMT5 variant products and GAPDH (glyceraldehyde-3-phosphate dehydrogenase). (E) Effect of hnRNP H/F immunodepletion and of His-hnRNP H add-back on U2AF65 binding to the Py of the upstream 3′SS of PRMT5 exon 3. Upper panel, Western blot analysis of normal (lane 1), hnRNP H/F-depleted (lane 2), or His-hnRNP H add-back HeLa nuclear extracts (lanes 3, 4, and 5). *, His-hnRNP H fragment. Lower panel, diagram of RNA probe (top), phophorimage of immunoprecipitated U2AF65 cross-linked to the G-tract-containing PRMT5 RNA probe in HeLa nuclear extracts (middle), and Western blot analysis of the same gel showing equal loading of U2AF65 (bottom).
    Human Prmt5, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human prmt5/product/Thermo Fisher
    Average 99 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    human prmt5 - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher hur
    <t>HuR</t> mediates the association of CRABP2 with endoplasmic reticulum. (A) M2 −/− cells were untreated (−) or treated with CGP74514A (2 µM, 2 h) (+CGP). The ER marker calnexin and HuR were visualized by immunostaining. Cells were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) to visualize nuclei. (B) Immunoblot demonstrating expression of HuR in M2 −/− cells stably expressing <t>shRNAs</t> targeting luciferase (shCtrl) or HuR (shHuR). (C) M2 −/− cells stably expressing shCtrl or shHuR were transiently transfected with a vector encoding Flag–CRABP2. Flag–CRABP2 (red) and ER marker calnexin (green) were immunostained and visualized using confocal microscopy. DAPI was used to visualize nuclei.
    Hur, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 128 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hur/product/Thermo Fisher
    Average 99 stars, based on 128 article reviews
    Price from $9.99 to $1999.99
    hur - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher creb
    <t>HuR</t> mediates the association of CRABP2 with endoplasmic reticulum. (A) M2 −/− cells were untreated (−) or treated with CGP74514A (2 µM, 2 h) (+CGP). The ER marker calnexin and HuR were visualized by immunostaining. Cells were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) to visualize nuclei. (B) Immunoblot demonstrating expression of HuR in M2 −/− cells stably expressing <t>shRNAs</t> targeting luciferase (shCtrl) or HuR (shHuR). (C) M2 −/− cells stably expressing shCtrl or shHuR were transiently transfected with a vector encoding Flag–CRABP2. Flag–CRABP2 (red) and ER marker calnexin (green) were immunostained and visualized using confocal microscopy. DAPI was used to visualize nuclei.
    Creb, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 191 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/creb/product/Thermo Fisher
    Average 99 stars, based on 191 article reviews
    Price from $9.99 to $1999.99
    creb - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    96
    Millipore mission lentivirus transduction particles
    <t>HuR</t> mediates the association of CRABP2 with endoplasmic reticulum. (A) M2 −/− cells were untreated (−) or treated with CGP74514A (2 µM, 2 h) (+CGP). The ER marker calnexin and HuR were visualized by immunostaining. Cells were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) to visualize nuclei. (B) Immunoblot demonstrating expression of HuR in M2 −/− cells stably expressing <t>shRNAs</t> targeting luciferase (shCtrl) or HuR (shHuR). (C) M2 −/− cells stably expressing shCtrl or shHuR were transiently transfected with a vector encoding Flag–CRABP2. Flag–CRABP2 (red) and ER marker calnexin (green) were immunostained and visualized using confocal microscopy. DAPI was used to visualize nuclei.
    Mission Lentivirus Transduction Particles, supplied by Millipore, used in various techniques. Bioz Stars score: 96/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mission lentivirus transduction particles/product/Millipore
    Average 96 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    mission lentivirus transduction particles - by Bioz Stars, 2020-03
    96/100 stars
      Buy from Supplier

    89
    Qiagen plasmid dna maxiprep
    <t>HuR</t> mediates the association of CRABP2 with endoplasmic reticulum. (A) M2 −/− cells were untreated (−) or treated with CGP74514A (2 µM, 2 h) (+CGP). The ER marker calnexin and HuR were visualized by immunostaining. Cells were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) to visualize nuclei. (B) Immunoblot demonstrating expression of HuR in M2 −/− cells stably expressing <t>shRNAs</t> targeting luciferase (shCtrl) or HuR (shHuR). (C) M2 −/− cells stably expressing shCtrl or shHuR were transiently transfected with a vector encoding Flag–CRABP2. Flag–CRABP2 (red) and ER marker calnexin (green) were immunostained and visualized using confocal microscopy. DAPI was used to visualize nuclei.
    Plasmid Dna Maxiprep, supplied by Qiagen, used in various techniques. Bioz Stars score: 89/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid dna maxiprep/product/Qiagen
    Average 89 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    plasmid dna maxiprep - by Bioz Stars, 2020-03
    89/100 stars
      Buy from Supplier

    86
    Millipore sigma aldrich misson library
    <t>HuR</t> mediates the association of CRABP2 with endoplasmic reticulum. (A) M2 −/− cells were untreated (−) or treated with CGP74514A (2 µM, 2 h) (+CGP). The ER marker calnexin and HuR were visualized by immunostaining. Cells were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) to visualize nuclei. (B) Immunoblot demonstrating expression of HuR in M2 −/− cells stably expressing <t>shRNAs</t> targeting luciferase (shCtrl) or HuR (shHuR). (C) M2 −/− cells stably expressing shCtrl or shHuR were transiently transfected with a vector encoding Flag–CRABP2. Flag–CRABP2 (red) and ER marker calnexin (green) were immunostained and visualized using confocal microscopy. DAPI was used to visualize nuclei.
    Sigma Aldrich Misson Library, supplied by Millipore, used in various techniques. Bioz Stars score: 86/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sigma aldrich misson library/product/Millipore
    Average 86 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    sigma aldrich misson library - by Bioz Stars, 2020-03
    86/100 stars
      Buy from Supplier

    99
    Thermo Fisher rnai consortium
    <t>HuR</t> mediates the association of CRABP2 with endoplasmic reticulum. (A) M2 −/− cells were untreated (−) or treated with CGP74514A (2 µM, 2 h) (+CGP). The ER marker calnexin and HuR were visualized by immunostaining. Cells were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) to visualize nuclei. (B) Immunoblot demonstrating expression of HuR in M2 −/− cells stably expressing <t>shRNAs</t> targeting luciferase (shCtrl) or HuR (shHuR). (C) M2 −/− cells stably expressing shCtrl or shHuR were transiently transfected with a vector encoding Flag–CRABP2. Flag–CRABP2 (red) and ER marker calnexin (green) were immunostained and visualized using confocal microscopy. DAPI was used to visualize nuclei.
    Rnai Consortium, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 215 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnai consortium/product/Thermo Fisher
    Average 99 stars, based on 215 article reviews
    Price from $9.99 to $1999.99
    rnai consortium - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Millipore non target nt shrna
    <t>Arl8b</t> knockdown prevents low pH-, EGF-, and HGF-induced lysosome trafficking to the cell membrane A. DU145 and PPC1 cells were transduced with lentiviral-delivered <t>shRNA</t> sequences targeted to Arl8b (KD) or non-targeted (NT) shRNA. Immunoblots confirm knockdown. B. DU145 and PPC1 cells were treated with low pH for 2 hours, or 33 ng/mL HGF or 100 ng/mL EGF for 18 hours then fixed, stained for LAMP-1 (Red), phalloidin (Green), and DAPI (Blue). C. Quantitated lysosome distribution from 25 cells shown as mean ± SEM; *=p
    Non Target Nt Shrna, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/non target nt shrna/product/Millipore
    Average 99 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    non target nt shrna - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    84
    Thermo Fisher trcn0000072937
    <t>Arl8b</t> knockdown prevents low pH-, EGF-, and HGF-induced lysosome trafficking to the cell membrane A. DU145 and PPC1 cells were transduced with lentiviral-delivered <t>shRNA</t> sequences targeted to Arl8b (KD) or non-targeted (NT) shRNA. Immunoblots confirm knockdown. B. DU145 and PPC1 cells were treated with low pH for 2 hours, or 33 ng/mL HGF or 100 ng/mL EGF for 18 hours then fixed, stained for LAMP-1 (Red), phalloidin (Green), and DAPI (Blue). C. Quantitated lysosome distribution from 25 cells shown as mean ± SEM; *=p
    Trcn0000072937, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 84/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trcn0000072937/product/Thermo Fisher
    Average 84 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    trcn0000072937 - by Bioz Stars, 2020-03
    84/100 stars
      Buy from Supplier

    97
    Millipore plko 1 puro lentiviral vector
    <t>Arl8b</t> knockdown prevents low pH-, EGF-, and HGF-induced lysosome trafficking to the cell membrane A. DU145 and PPC1 cells were transduced with lentiviral-delivered <t>shRNA</t> sequences targeted to Arl8b (KD) or non-targeted (NT) shRNA. Immunoblots confirm knockdown. B. DU145 and PPC1 cells were treated with low pH for 2 hours, or 33 ng/mL HGF or 100 ng/mL EGF for 18 hours then fixed, stained for LAMP-1 (Red), phalloidin (Green), and DAPI (Blue). C. Quantitated lysosome distribution from 25 cells shown as mean ± SEM; *=p
    Plko 1 Puro Lentiviral Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 97/100, based on 118 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 puro lentiviral vector/product/Millipore
    Average 97 stars, based on 118 article reviews
    Price from $9.99 to $1999.99
    plko 1 puro lentiviral vector - by Bioz Stars, 2020-03
    97/100 stars
      Buy from Supplier

    99
    Thermo Fisher nih3t3
    <t>Arl8b</t> knockdown prevents low pH-, EGF-, and HGF-induced lysosome trafficking to the cell membrane A. DU145 and PPC1 cells were transduced with lentiviral-delivered <t>shRNA</t> sequences targeted to Arl8b (KD) or non-targeted (NT) shRNA. Immunoblots confirm knockdown. B. DU145 and PPC1 cells were treated with low pH for 2 hours, or 33 ng/mL HGF or 100 ng/mL EGF for 18 hours then fixed, stained for LAMP-1 (Red), phalloidin (Green), and DAPI (Blue). C. Quantitated lysosome distribution from 25 cells shown as mean ± SEM; *=p
    Nih3t3, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 918 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nih3t3/product/Thermo Fisher
    Average 99 stars, based on 918 article reviews
    Price from $9.99 to $1999.99
    nih3t3 - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher plko
    <t>Arl8b</t> knockdown prevents low pH-, EGF-, and HGF-induced lysosome trafficking to the cell membrane A. DU145 and PPC1 cells were transduced with lentiviral-delivered <t>shRNA</t> sequences targeted to Arl8b (KD) or non-targeted (NT) shRNA. Immunoblots confirm knockdown. B. DU145 and PPC1 cells were treated with low pH for 2 hours, or 33 ng/mL HGF or 100 ng/mL EGF for 18 hours then fixed, stained for LAMP-1 (Red), phalloidin (Green), and DAPI (Blue). C. Quantitated lysosome distribution from 25 cells shown as mean ± SEM; *=p
    Plko, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2058 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko/product/Thermo Fisher
    Average 99 stars, based on 2058 article reviews
    Price from $9.99 to $1999.99
    plko - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    83
    GE Healthcare nox4 shrnas
    <t>Nox4</t> but not Nox1 is critical for TGFβ1‐mediated fibroblast activation. ( a ) Primary human prostate fibroblasts incubated with bFGF or TGFβ1 as indicated for 48 hr before qPCR analysis of Nox family members relative to the housekeeping gene TBP. The direct TGFβ1 target genes SERPINE1 and COMP served as positive controls. The nonresponsive gene HMBS served as negative control. ( b ) Lentiviral‐mediated silencing of Nox1 or Nox4 in primary human prostate fibroblasts transduced with 2 different Nox1 or Nox4‐specific <t>shRNAs</t> (1 and 2) and subsequently treated with bFGF or TGFβ1 for 48 hr before qPCR of Nox1 and Nox4 expression ( top) , or the indicated CAF marker ( bottom) relative to the housekeeping gene TBP. ( c , d ) Nox1 RNA in situ hybridization on radical prostatectomy prostate tissue specimens from PCa patients. Benign (BE) and adjacent cancer (CA) areas are shown. Single and multiple Nox4 mRNA transcripts appear as single red dots or clusters, respectively. Boxed regions ( top panel ) are enlarged ( lower panel ). Arrowheads demarcate weak epithelial Nox1 mRNA levels in benign tissue. ( d ) ImageJ quantification of Nox1 in situ hybridization images as in ( c ) using threshold settings described in Materials and Methods. ( a , b ) Data represent mean + SEM of four independent experiments using primary fibroblasts isolated from different donors. ( c ) Images are representative of 3 independent experiments using tissue from different patients. ( d ) Data represent mean + SEM from 10 fields of view each (40× magnification) from CA and BE adjacent regions of 3 different patient specimens. ( a , b , d ) Statistical significance is shown (* p
    Nox4 Shrnas, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 83/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nox4 shrnas/product/GE Healthcare
    Average 83 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    nox4 shrnas - by Bioz Stars, 2020-03
    83/100 stars
      Buy from Supplier

    77
    Millipore pi4ka
    QRT-PCR analysis of <t>PI4KA-sp</t> and PI4KB-sp siRNAs across multiple HCV replicons. Eight HCV replicons (SG-1b, Luc-1b, FL-1b, Luc-1a, SG-1a, FL-1a, SG-2a, and JFH1-2a) were transfected with 25 nM concentrations of PI4KA-sp, PI4KB-sp, and GAPDH-sp siRNAs
    Pi4ka, supplied by Millipore, used in various techniques. Bioz Stars score: 77/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pi4ka/product/Millipore
    Average 77 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    pi4ka - by Bioz Stars, 2020-03
    77/100 stars
      Buy from Supplier

    90
    Millipore plko 1 puro mission vectors
    QRT-PCR analysis of <t>PI4KA-sp</t> and PI4KB-sp siRNAs across multiple HCV replicons. Eight HCV replicons (SG-1b, Luc-1b, FL-1b, Luc-1a, SG-1a, FL-1a, SG-2a, and JFH1-2a) were transfected with 25 nM concentrations of PI4KA-sp, PI4KB-sp, and GAPDH-sp siRNAs
    Plko 1 Puro Mission Vectors, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 puro mission vectors/product/Millipore
    Average 90 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    plko 1 puro mission vectors - by Bioz Stars, 2020-03
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher lipofectamine 2000 reagent
    QRT-PCR analysis of <t>PI4KA-sp</t> and PI4KB-sp siRNAs across multiple HCV replicons. Eight HCV replicons (SG-1b, Luc-1b, FL-1b, Luc-1a, SG-1a, FL-1a, SG-2a, and JFH1-2a) were transfected with 25 nM concentrations of PI4KA-sp, PI4KB-sp, and GAPDH-sp siRNAs
    Lipofectamine 2000 Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 119770 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lipofectamine 2000 reagent/product/Thermo Fisher
    Average 99 stars, based on 119770 article reviews
    Price from $9.99 to $1999.99
    lipofectamine 2000 reagent - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    82
    Millipore p21 knockdown
    Knockdown of <t>p21</t> blocks JAZ-mediated neuroprotection. A, overexpression of p21 protects neurons from LK-induced death. CGNs transfected with GFP or p21-FLAG for 8 h were switched to either HK or LK medium for 24 h. Viability of transfected neurons was
    P21 Knockdown, supplied by Millipore, used in various techniques. Bioz Stars score: 82/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p21 knockdown/product/Millipore
    Average 82 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    p21 knockdown - by Bioz Stars, 2020-03
    82/100 stars
      Buy from Supplier

    80
    Addgene inc ccggtcctaaggttaagtcgccctcgctcgagcgagggcgacttaaccttaggtttttg
    Knockdown of <t>p21</t> blocks JAZ-mediated neuroprotection. A, overexpression of p21 protects neurons from LK-induced death. CGNs transfected with GFP or p21-FLAG for 8 h were switched to either HK or LK medium for 24 h. Viability of transfected neurons was
    Ccggtcctaaggttaagtcgccctcgctcgagcgagggcgacttaaccttaggtttttg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 80/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ccggtcctaaggttaagtcgccctcgctcgagcgagggcgacttaaccttaggtttttg/product/Addgene inc
    Average 80 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    ccggtcctaaggttaagtcgccctcgctcgagcgagggcgacttaaccttaggtttttg - by Bioz Stars, 2020-03
    80/100 stars
      Buy from Supplier

    81
    Thermo Fisher shrna rhs6848
    Knockdown of <t>p21</t> blocks JAZ-mediated neuroprotection. A, overexpression of p21 protects neurons from LK-induced death. CGNs transfected with GFP or p21-FLAG for 8 h were switched to either HK or LK medium for 24 h. Viability of transfected neurons was
    Shrna Rhs6848, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 81/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna rhs6848/product/Thermo Fisher
    Average 81 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    shrna rhs6848 - by Bioz Stars, 2020-03
    81/100 stars
      Buy from Supplier

    Image Search Results


    Amot130 and AIP4 interdependently inhibit YAP. A , the levels of YFP-tagged Amot130 as well as endogenous AIP4, YAP, and GAPDH were detected in lysates from MDA-MB-468 cells stably expressing control or AIP4 shRNA in combination with YFP-tagged Amot130

    Journal: The Journal of Biological Chemistry

    Article Title: Amot130 Adapts Atrophin-1 Interacting Protein 4 to Inhibit Yes-associated Protein Signaling and Cell Growth *

    doi: 10.1074/jbc.M112.446534

    Figure Lengend Snippet: Amot130 and AIP4 interdependently inhibit YAP. A , the levels of YFP-tagged Amot130 as well as endogenous AIP4, YAP, and GAPDH were detected in lysates from MDA-MB-468 cells stably expressing control or AIP4 shRNA in combination with YFP-tagged Amot130

    Article Snippet: AIP4 shRNA (Sigma, catalog no. TRCN0000002087) has been described previously ( ).

    Techniques: Multiple Displacement Amplification, Stable Transfection, Expressing, shRNA

    RIP1 is involved in HCoV-OC43-induced LA-N-5 cell death and limits production of infectious virus. Differentiated LA-N-5 cells were transiently transduced with control lentivirus (shRNA NT) or lentivirus containing either of two shRNA sequences against

    Journal: Journal of Virology

    Article Title: Pivotal Role of Receptor-Interacting Protein Kinase 1 and Mixed Lineage Kinase Domain-Like in Neuronal Cell Death Induced by the Human Neuroinvasive Coronavirus OC43

    doi: 10.1128/JVI.01513-16

    Figure Lengend Snippet: RIP1 is involved in HCoV-OC43-induced LA-N-5 cell death and limits production of infectious virus. Differentiated LA-N-5 cells were transiently transduced with control lentivirus (shRNA NT) or lentivirus containing either of two shRNA sequences against

    Article Snippet: The Mission pLKO.1 shRNA vector against Bax (shRNA #1, TRCN0000312626; shRNA #2, TRCN0000312627), RIP1 (shRNA #1, TRCN00000705; shRNA #2, TRCN00000709), and the control shRNA (nontarget shRNA) were purchased from Sigma-Aldrich.

    Techniques: Transduction, shRNA

    HCoV-OC43 infection increases RIP1 and RIP3 gene expression. Level of RIP1 (upper) or RIP3 (lower) mRNA in murine mixed primary cultures of CNS (A) or differentiated LA-N-5 cells (B) infected with rOC/ATCC or rOC/U s183–241 . Results are shown as

    Journal: Journal of Virology

    Article Title: Pivotal Role of Receptor-Interacting Protein Kinase 1 and Mixed Lineage Kinase Domain-Like in Neuronal Cell Death Induced by the Human Neuroinvasive Coronavirus OC43

    doi: 10.1128/JVI.01513-16

    Figure Lengend Snippet: HCoV-OC43 infection increases RIP1 and RIP3 gene expression. Level of RIP1 (upper) or RIP3 (lower) mRNA in murine mixed primary cultures of CNS (A) or differentiated LA-N-5 cells (B) infected with rOC/ATCC or rOC/U s183–241 . Results are shown as

    Article Snippet: The Mission pLKO.1 shRNA vector against Bax (shRNA #1, TRCN0000312626; shRNA #2, TRCN0000312627), RIP1 (shRNA #1, TRCN00000705; shRNA #2, TRCN00000709), and the control shRNA (nontarget shRNA) were purchased from Sigma-Aldrich.

    Techniques: Infection, Expressing

    Lentiviral-mediated knockdown of Cdk5 attenuates hydrogen peroxide-mediated neuronal cell death via regulation of tAIF level. ( a ) Schematic flow for lentiviral transduction (LV) and H 2 O 2 treatment. ( b ) Cortical neurons were infected with lentiviral particles containing shRNA against either Cdk5 (Cdk5 #1 or #2) or control (Scramble) and subsequently treated with 200 μ M H 2 O 2 for 60 min. Cell lysates were subjected to IB analysis using the indicated antibodies. ( c and d ) Quantification of the relative fold intensities of ( c ) pS20 CHIP and ( d ) tAIF level was performed and normalized against glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The relative levels were expressed as a fold intensity over H 2 O 2 -treated controls (shScramble; value=1). Bar represents the means±S.D. of three independent experiments. *** P

    Journal: Cell Death and Differentiation

    Article Title: Phosphorylation of CHIP at Ser20 by Cdk5 promotes tAIF-mediated neuronal death

    doi: 10.1038/cdd.2015.103

    Figure Lengend Snippet: Lentiviral-mediated knockdown of Cdk5 attenuates hydrogen peroxide-mediated neuronal cell death via regulation of tAIF level. ( a ) Schematic flow for lentiviral transduction (LV) and H 2 O 2 treatment. ( b ) Cortical neurons were infected with lentiviral particles containing shRNA against either Cdk5 (Cdk5 #1 or #2) or control (Scramble) and subsequently treated with 200 μ M H 2 O 2 for 60 min. Cell lysates were subjected to IB analysis using the indicated antibodies. ( c and d ) Quantification of the relative fold intensities of ( c ) pS20 CHIP and ( d ) tAIF level was performed and normalized against glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The relative levels were expressed as a fold intensity over H 2 O 2 -treated controls (shScramble; value=1). Bar represents the means±S.D. of three independent experiments. *** P

    Article Snippet: Briefly, lentiviral vectors (in pLKO.1) containing Cdk5 shRNA sequences (shCdk5 #1, TRCN0000011802; shCdk5 #2, TRCN0000278085) and non-target shRNA control vector (shScramble, SHC016) were purchased from Sigma.

    Techniques: Flow Cytometry, Transduction, Infection, shRNA, Chromatin Immunoprecipitation

    Selective suppression of Parp1 improves cortical neuron axonal regeneration. A , Representative images of regenerated cortical neurons. Neurons were transduced with shRNA lentiviral particles on culture d 3 and scraped on d 8. Scraped neurons were fixed and stained at d 11. The microphotographs illustrate βIII tubulin in axons (green), phalloidin of F-actin in growth cones (phalloidin, red), and cell nuclei (DAPI, blue). Note that no neuronal cell bodies (DAPI) migrate into the scrape zone. Selectively after Parp1 knockdown, a greater number of regenerating axons and growth cones are visible in the scrape zone. Scale bars, 200 µm. B , Quantification of axon regeneration. Data are mean ± SE. shNC, n = 109; sh Parp1 , n = 49 (each of 5 lentiviral species has 10 independent wells, with 1 cell culture lost); sh Parp2 , n = 10 (each of 5 lentiviral species has 2 independent wells); sh Parp3 , n = 10 (each of 5 lentiviral species has 2 independent wells); sh Parp9 , n = 10 (each of 5 lentiviral species has 2 independent wells); sh Parp12 , n = 10 (each of 5 lentiviral species has 2 independent wells); and sh Parp16 ; n = 16 (each of 4 lentiviral species has 4 independent wells). Each condition was compared to NC control by one-way ANOVA followed by Dunnett test. **, P

    Journal: eNeuro

    Article Title: Inhibition of Poly-ADP-Ribosylation Fails to Increase Axonal Regeneration or Improve Functional Recovery after Adult Mammalian CNS Injury

    doi: 10.1523/ENEURO.0270-16.2016

    Figure Lengend Snippet: Selective suppression of Parp1 improves cortical neuron axonal regeneration. A , Representative images of regenerated cortical neurons. Neurons were transduced with shRNA lentiviral particles on culture d 3 and scraped on d 8. Scraped neurons were fixed and stained at d 11. The microphotographs illustrate βIII tubulin in axons (green), phalloidin of F-actin in growth cones (phalloidin, red), and cell nuclei (DAPI, blue). Note that no neuronal cell bodies (DAPI) migrate into the scrape zone. Selectively after Parp1 knockdown, a greater number of regenerating axons and growth cones are visible in the scrape zone. Scale bars, 200 µm. B , Quantification of axon regeneration. Data are mean ± SE. shNC, n = 109; sh Parp1 , n = 49 (each of 5 lentiviral species has 10 independent wells, with 1 cell culture lost); sh Parp2 , n = 10 (each of 5 lentiviral species has 2 independent wells); sh Parp3 , n = 10 (each of 5 lentiviral species has 2 independent wells); sh Parp9 , n = 10 (each of 5 lentiviral species has 2 independent wells); sh Parp12 , n = 10 (each of 5 lentiviral species has 2 independent wells); and sh Parp16 ; n = 16 (each of 4 lentiviral species has 4 independent wells). Each condition was compared to NC control by one-way ANOVA followed by Dunnett test. **, P

    Article Snippet: On day in vitro 3 (DIV3), 1 × 105 TU of lentiviral particles targeting mammalian nontargeting (NC) short hairpin RNA (shRNA) control (cat. #SHC002V), Parp1 shRNA (NMID: NM_007415, clone ID: TRCN0000071208, TRCN0000071209, TRCN0000071210, TRCN0000071211, TRCN0000071212; Sigma-Aldrich), Parp2 shRNA (NMID: NM_009632, clone ID: TRCN0000071213, TRCN0000071214, TRCN0000071215, TRCN0000071216, TRCN0000071217; Sigma-Aldrich), Parp3 shRNA (NMID: NM_145619, clone ID: TRCN0000093894, TRCN0000093895, TRCN0000093896, TRCN0000093897, TRCN0000093898; Sigma-Aldrich), Parp9 shRNA (NMID: NM_030253, clone ID: TRCN0000174399, TRCN0000174697, TRCN0000173214, TRCN0000176202, TRCN0000175373; Sigma-Aldrich), Parp12 shRNA (NMID: NM_172893, clone ID: TRCN0000174741, TRCN0000174854, TRCN0000175447, TRCN0000175542, TRCN0000175901; Sigma-Aldrich), or Parp16 shRNA (NMID: NM_177460, clone ID: TRCN0000200923, TRCN0000190330, TRCN0000201597, TRCN0000190801; Sigma-Aldrich) were added to primary cortical neurons.

    Techniques: Transduction, shRNA, Staining, Cell Culture

    OIP5 regulates and stabilizes E2F1 signaling. (A) Protein expression levels of E2F1, CDK1, and MMP9 were analyzed by western blot in LN-229, U-87 MG, and A172 cells expressing shGFP, shOIP5#1, or shOIP5#2. (B) E2F1, CDK1, and MMP9 expression levels of the OIP5-rescued OIP5 knockdown cells. (C) Luciferase assay in LN-229 and A172 cells co-transfected with the reporter plasmids combined with the indicated shRNA. (D) Luciferase assay in OIP5-rescued OIP5 knockdown cells. (E) Interaction of endogenous OIP5 with endogenous E2F1. Equal amounts of LN-229 and A172 cell lysates were used for each immunoprecipitation (IP) reaction. (F) LN-229 and A172 cells expressing shGFP or shOIP5 were treated with MG132 for 6 h before harvesting. Whole cell lysates (WCL) were incubated with anti-E2F1 antibody, and the immunocomplexes were immunoblotted with antibodies against ubiquitin (UB) and E2F1. (G) LN-229 and A172 cells expressing shGFP or shOIP5 were treated with or without MG132 for 6 h before harvesting. Equal amounts of cell lysates were immunoblotted with the indicated antibodies. Data were analyzed using 2-tailed Student’s t -tests, ** P

    Journal: Neuro-Oncology

    Article Title: Cancer-testis specific gene OIP5: a downstream gene of E2F1 that promotes tumorigenesis and metastasis in glioblastoma by stabilizing E2F1 signaling

    doi: 10.1093/neuonc/noy037

    Figure Lengend Snippet: OIP5 regulates and stabilizes E2F1 signaling. (A) Protein expression levels of E2F1, CDK1, and MMP9 were analyzed by western blot in LN-229, U-87 MG, and A172 cells expressing shGFP, shOIP5#1, or shOIP5#2. (B) E2F1, CDK1, and MMP9 expression levels of the OIP5-rescued OIP5 knockdown cells. (C) Luciferase assay in LN-229 and A172 cells co-transfected with the reporter plasmids combined with the indicated shRNA. (D) Luciferase assay in OIP5-rescued OIP5 knockdown cells. (E) Interaction of endogenous OIP5 with endogenous E2F1. Equal amounts of LN-229 and A172 cell lysates were used for each immunoprecipitation (IP) reaction. (F) LN-229 and A172 cells expressing shGFP or shOIP5 were treated with MG132 for 6 h before harvesting. Whole cell lysates (WCL) were incubated with anti-E2F1 antibody, and the immunocomplexes were immunoblotted with antibodies against ubiquitin (UB) and E2F1. (G) LN-229 and A172 cells expressing shGFP or shOIP5 were treated with or without MG132 for 6 h before harvesting. Equal amounts of cell lysates were immunoblotted with the indicated antibodies. Data were analyzed using 2-tailed Student’s t -tests, ** P

    Article Snippet: Human OIP5 short hairpin (sh)RNA (#1, TRCN0000074087; #2, TRCN0000074083) and E2F1 shRNA (TRCN0000039659) were purchased from Sigma-Aldrich.

    Techniques: Expressing, Western Blot, Luciferase, Transfection, shRNA, Immunoprecipitation, Incubation

    Foxp1 induces the expression of p21. A , N2A cells were transfected with GFP or Foxp1 plasmids for 24 h. The protein lysates were subjected to Western blotting with p21 antibody. Erk1/2 was used as the loading control. B , Adenovirus for GFP or Foxp1 was used to infect cortical neurons, and 48 h later, the neurons were maintained in either normal survival condition or HCA-induced apoptotic condition for 3 h, and protein lysates were collected and subjected to Western blotting with a p21 antibody. Erk1/2 was used as a loading control. C , CGNs were infected with GFP or Foxp1 adenovirus, and 48 h later, the protein lysates were collected and subjected to Western blotting with p21 antibody. Erk1/2 was used as a loading control. UN, Untreated. D , p21 shRNA plasmids were cotransfected with GFP or Foxp1 -GFP plasmids in cortical neurons for 72 h, and the viability was accessed by immunocytochemistry and DAPI staining. Viability is normalized to cortical neurons transfected with Plk0.1 along with GFP . The data are represented as mean ± SD ( n = 3). E , N2A cells were transfected with GFP or Foxp1 plasmids along with a p21 promoter luciferase construct for 24 h. Renilla was used as a transfection control. Promoter activity is expressed as a ratio of firefly luciferase to renilla luciferase. Fold change represents the ratio of p21 promoter activity in experimental transfected cells to p21 promoter activity in GFP-transfected cells. ** p

    Journal: The Journal of Neuroscience

    Article Title: Reduced Expression of Foxp1 as a Contributing Factor in Huntington's Disease

    doi: 10.1523/JNEUROSCI.3612-16.2017

    Figure Lengend Snippet: Foxp1 induces the expression of p21. A , N2A cells were transfected with GFP or Foxp1 plasmids for 24 h. The protein lysates were subjected to Western blotting with p21 antibody. Erk1/2 was used as the loading control. B , Adenovirus for GFP or Foxp1 was used to infect cortical neurons, and 48 h later, the neurons were maintained in either normal survival condition or HCA-induced apoptotic condition for 3 h, and protein lysates were collected and subjected to Western blotting with a p21 antibody. Erk1/2 was used as a loading control. C , CGNs were infected with GFP or Foxp1 adenovirus, and 48 h later, the protein lysates were collected and subjected to Western blotting with p21 antibody. Erk1/2 was used as a loading control. UN, Untreated. D , p21 shRNA plasmids were cotransfected with GFP or Foxp1 -GFP plasmids in cortical neurons for 72 h, and the viability was accessed by immunocytochemistry and DAPI staining. Viability is normalized to cortical neurons transfected with Plk0.1 along with GFP . The data are represented as mean ± SD ( n = 3). E , N2A cells were transfected with GFP or Foxp1 plasmids along with a p21 promoter luciferase construct for 24 h. Renilla was used as a transfection control. Promoter activity is expressed as a ratio of firefly luciferase to renilla luciferase. Fold change represents the ratio of p21 promoter activity in experimental transfected cells to p21 promoter activity in GFP-transfected cells. ** p

    Article Snippet: For knocking down the expression of p21Waf1/Cip1 shRNA constructs, TRCN0000042585 (sh1) and TRCN0000042587 (sh2), from Sigma-Aldrich, were used.

    Techniques: Expressing, Transfection, Western Blot, High Content Screening, Infection, shRNA, Immunocytochemistry, Staining, Luciferase, Construct, Activity Assay

    Arl8b knockdown prevents low pH-, EGF-, and HGF-induced lysosome trafficking to the cell membrane A. DU145 and PPC1 cells were transduced with lentiviral-delivered shRNA sequences targeted to Arl8b (KD) or non-targeted (NT) shRNA. Immunoblots confirm knockdown. B. DU145 and PPC1 cells were treated with low pH for 2 hours, or 33 ng/mL HGF or 100 ng/mL EGF for 18 hours then fixed, stained for LAMP-1 (Red), phalloidin (Green), and DAPI (Blue). C. Quantitated lysosome distribution from 25 cells shown as mean ± SEM; *=p

    Journal: Oncotarget

    Article Title: The Arf-like GTPase Arl8b is essential for three-dimensional invasive growth of prostate cancer in vitro and xenograft formation and growth in vivo

    doi: 10.18632/oncotarget.8832

    Figure Lengend Snippet: Arl8b knockdown prevents low pH-, EGF-, and HGF-induced lysosome trafficking to the cell membrane A. DU145 and PPC1 cells were transduced with lentiviral-delivered shRNA sequences targeted to Arl8b (KD) or non-targeted (NT) shRNA. Immunoblots confirm knockdown. B. DU145 and PPC1 cells were treated with low pH for 2 hours, or 33 ng/mL HGF or 100 ng/mL EGF for 18 hours then fixed, stained for LAMP-1 (Red), phalloidin (Green), and DAPI (Blue). C. Quantitated lysosome distribution from 25 cells shown as mean ± SEM; *=p

    Article Snippet: Lentivirus delivery of shRNA Scrambled non-target (NT) shRNA (SHC202V) or Arl8b shRNA was delivered to DU145 and MDA MB 231 (i:TRCN0000072857; ii: TRCN0000072854) or PPC1 (i:TRCN0000072854; ii: TRCN0000072853) cells using Mission Lentivirus Transduction particles (Sigma).

    Techniques: Transduction, shRNA, Western Blot, Staining

    Conditional SUMO knockdown attenuates SUMO pathway activity. (A) U2OS cells were infected with Dox inducible SAE2 shRNAs (sh1-sh4) or control shRNA (c). Cells were treated with Dox for 5 days (+) or untreated (-). Protein lystes were immunoblotted for indicated proteins. TUBULIN serves as loading control. (B-D) U2OS cells expressing conditional SAE2 shRNAs were treated with Dox and immunoblotted with RanGAP1 (B), SUMO1 (C) and SUMO2/3 (D) antibodies.

    Journal: PLoS ONE

    Article Title: Characterization of the Loss of SUMO Pathway Function on Cancer Cells and Tumor Proliferation

    doi: 10.1371/journal.pone.0123882

    Figure Lengend Snippet: Conditional SUMO knockdown attenuates SUMO pathway activity. (A) U2OS cells were infected with Dox inducible SAE2 shRNAs (sh1-sh4) or control shRNA (c). Cells were treated with Dox for 5 days (+) or untreated (-). Protein lystes were immunoblotted for indicated proteins. TUBULIN serves as loading control. (B-D) U2OS cells expressing conditional SAE2 shRNAs were treated with Dox and immunoblotted with RanGAP1 (B), SUMO1 (C) and SUMO2/3 (D) antibodies.

    Article Snippet: All the cell lines were infected to express a non-targeting shRNA, SAE2 shRNA or UBC9 shRNA using packaged lentiviral particles (Sigma Mission shRNA library clone#: SAE2 sh1: TRCN0000007470; SAE2 sh2: TRCN0000007472; Ubc9 sh1: TRCN0000007205; Ubc9 sh2: TRCN0000007206; Ubc9 sh3: TRCN0000011077).

    Techniques: Activity Assay, Infection, shRNA, Expressing

    Conditional SAE knockdown delays tumor progression. (A) HCT116 cells infected with Dox inducible SAE2 shRNAs were injected subcutaneously in immunocompromised mice. Dox treatment starts at D14 after injection (set as D0). Error bars denote s.d. (n = 4). (B) SAE2 shRNA reduced SUMO pathway activity in tumors. Protein lysates from tumors were immunoblotted with indicated antibodies. (C) Whole-body fluorescent imaging of mice untreated or treated with Dox. Color bar denotes signal intensity.

    Journal: PLoS ONE

    Article Title: Characterization of the Loss of SUMO Pathway Function on Cancer Cells and Tumor Proliferation

    doi: 10.1371/journal.pone.0123882

    Figure Lengend Snippet: Conditional SAE knockdown delays tumor progression. (A) HCT116 cells infected with Dox inducible SAE2 shRNAs were injected subcutaneously in immunocompromised mice. Dox treatment starts at D14 after injection (set as D0). Error bars denote s.d. (n = 4). (B) SAE2 shRNA reduced SUMO pathway activity in tumors. Protein lysates from tumors were immunoblotted with indicated antibodies. (C) Whole-body fluorescent imaging of mice untreated or treated with Dox. Color bar denotes signal intensity.

    Article Snippet: All the cell lines were infected to express a non-targeting shRNA, SAE2 shRNA or UBC9 shRNA using packaged lentiviral particles (Sigma Mission shRNA library clone#: SAE2 sh1: TRCN0000007470; SAE2 sh2: TRCN0000007472; Ubc9 sh1: TRCN0000007205; Ubc9 sh2: TRCN0000007206; Ubc9 sh3: TRCN0000011077).

    Techniques: Infection, Injection, Mouse Assay, shRNA, Activity Assay, Imaging

    SAE2 shRNA is rescued by non-silencible cDNA. (A) HCT116 cells expressing tet-on inducible shSAE2 (C = ctrl shRNA, 2 = sh2, 4 = sh4) were infected with vector, non-silencible wildtype SAE2 or non-silencible C- > A enzyme dead SAE2 mutant. Cells were treated with Dox for 6 days. Protein lysates were immunoblotted with indicated antibodies. (B) non-silencible wildtype SAE2 rescues shSAE2 induced cell death. Sub G1 population was analyzed by FACS. Error bars denote s.d. (C) SA- β-Gal staining of cells expressing indicated retrovirus combination.

    Journal: PLoS ONE

    Article Title: Characterization of the Loss of SUMO Pathway Function on Cancer Cells and Tumor Proliferation

    doi: 10.1371/journal.pone.0123882

    Figure Lengend Snippet: SAE2 shRNA is rescued by non-silencible cDNA. (A) HCT116 cells expressing tet-on inducible shSAE2 (C = ctrl shRNA, 2 = sh2, 4 = sh4) were infected with vector, non-silencible wildtype SAE2 or non-silencible C- > A enzyme dead SAE2 mutant. Cells were treated with Dox for 6 days. Protein lysates were immunoblotted with indicated antibodies. (B) non-silencible wildtype SAE2 rescues shSAE2 induced cell death. Sub G1 population was analyzed by FACS. Error bars denote s.d. (C) SA- β-Gal staining of cells expressing indicated retrovirus combination.

    Article Snippet: All the cell lines were infected to express a non-targeting shRNA, SAE2 shRNA or UBC9 shRNA using packaged lentiviral particles (Sigma Mission shRNA library clone#: SAE2 sh1: TRCN0000007470; SAE2 sh2: TRCN0000007472; Ubc9 sh1: TRCN0000007205; Ubc9 sh2: TRCN0000007206; Ubc9 sh3: TRCN0000011077).

    Techniques: shRNA, Expressing, Infection, Plasmid Preparation, Mutagenesis, FACS, Staining

    Conditional SAE knockdown induces cell cycle arrest, apoptosis and senescence. (A) HCT116 cells were infected with Dox inducible SAE2 shRNAs or control shRNA (ctrl). Cells were plated in 6-well plates in Dox containing medium (0.5ug/ml) and stained for crystal violet after 12 days. (B) Knockdown of SAE induces apoptosis. Sub G1 population was analyzed by FACS with and without Dox treatment. Error bars denote s.d. (C) SAE2 knockdown induced cellular senescence. Cells were stained for SA-β-Gal activity after 9 days Dox treatment. (D) PI staining and FACS analysis of HCT116 cells following SAE2 knockdown. Sub G1 and mutil-nucleated cell population was indicated.

    Journal: PLoS ONE

    Article Title: Characterization of the Loss of SUMO Pathway Function on Cancer Cells and Tumor Proliferation

    doi: 10.1371/journal.pone.0123882

    Figure Lengend Snippet: Conditional SAE knockdown induces cell cycle arrest, apoptosis and senescence. (A) HCT116 cells were infected with Dox inducible SAE2 shRNAs or control shRNA (ctrl). Cells were plated in 6-well plates in Dox containing medium (0.5ug/ml) and stained for crystal violet after 12 days. (B) Knockdown of SAE induces apoptosis. Sub G1 population was analyzed by FACS with and without Dox treatment. Error bars denote s.d. (C) SAE2 knockdown induced cellular senescence. Cells were stained for SA-β-Gal activity after 9 days Dox treatment. (D) PI staining and FACS analysis of HCT116 cells following SAE2 knockdown. Sub G1 and mutil-nucleated cell population was indicated.

    Article Snippet: All the cell lines were infected to express a non-targeting shRNA, SAE2 shRNA or UBC9 shRNA using packaged lentiviral particles (Sigma Mission shRNA library clone#: SAE2 sh1: TRCN0000007470; SAE2 sh2: TRCN0000007472; Ubc9 sh1: TRCN0000007205; Ubc9 sh2: TRCN0000007206; Ubc9 sh3: TRCN0000011077).

    Techniques: Infection, shRNA, Staining, FACS, Activity Assay

    Conditional SAE knockdown induces DNA bridges, mitotic defect and PML NB disorder. (A-B) HCT116 cells expressing tet inducible SAE2 shRNA (sh2) or control shRNA (ctrl) were treated with Dox containing medium (0.5ug/ml) for 5 days. The cells were fixed and stained with DAPI to view nuclei morphology. (C) HCT116 cells expressing tet inducible SAE2 shRNA (sh2) or control shRNA (ctrl) were treated with Dox for 4 days then immunoblotted with TopoIIα antibody. (D-E) immunofluorescence images of HCT116 cells harboring inducible shRNA with 5 days treatment of Dox. The cells were stained with (D) PML or (E) Daxx antibodies. (F) SAE2 knockdown is associated with increased p53 levels. U2OS cells expressing conditional SAE2 shRNAs were treated with Dox and immunoblotted with p53 and p21 antibodies.

    Journal: PLoS ONE

    Article Title: Characterization of the Loss of SUMO Pathway Function on Cancer Cells and Tumor Proliferation

    doi: 10.1371/journal.pone.0123882

    Figure Lengend Snippet: Conditional SAE knockdown induces DNA bridges, mitotic defect and PML NB disorder. (A-B) HCT116 cells expressing tet inducible SAE2 shRNA (sh2) or control shRNA (ctrl) were treated with Dox containing medium (0.5ug/ml) for 5 days. The cells were fixed and stained with DAPI to view nuclei morphology. (C) HCT116 cells expressing tet inducible SAE2 shRNA (sh2) or control shRNA (ctrl) were treated with Dox for 4 days then immunoblotted with TopoIIα antibody. (D-E) immunofluorescence images of HCT116 cells harboring inducible shRNA with 5 days treatment of Dox. The cells were stained with (D) PML or (E) Daxx antibodies. (F) SAE2 knockdown is associated with increased p53 levels. U2OS cells expressing conditional SAE2 shRNAs were treated with Dox and immunoblotted with p53 and p21 antibodies.

    Article Snippet: All the cell lines were infected to express a non-targeting shRNA, SAE2 shRNA or UBC9 shRNA using packaged lentiviral particles (Sigma Mission shRNA library clone#: SAE2 sh1: TRCN0000007470; SAE2 sh2: TRCN0000007472; Ubc9 sh1: TRCN0000007205; Ubc9 sh2: TRCN0000007206; Ubc9 sh3: TRCN0000011077).

    Techniques: Expressing, shRNA, Staining, Immunofluorescence

    Validation of PI4KA and PI4KB siRNAs. (A and B) Each PI4K siRNA was analyzed by RT-PCR to determine whether the siRNAs were isoform specific. After siRNA transfection with PI4KA (A) and PI4KB (B) siRNAs, the mRNA levels were measured using both a PI4KA

    Journal: Journal of Virology

    Article Title: Class III Phosphatidylinositol 4-Kinase Alpha and Beta Are Novel Host Factor Regulators of Hepatitis C Virus Replication

    doi: 10.1128/JVI.02418-08

    Figure Lengend Snippet: Validation of PI4KA and PI4KB siRNAs. (A and B) Each PI4K siRNA was analyzed by RT-PCR to determine whether the siRNAs were isoform specific. After siRNA transfection with PI4KA (A) and PI4KB (B) siRNAs, the mRNA levels were measured using both a PI4KA

    Article Snippet: Short hairpin RNAs (shRNAs) targeting PI4KA ( , Sigma catalog no. SHGLY- ) and PI4KB ( , Sigma catalog no. SHGLY- ) were ordered as five individual shRNA clones (see Table S3 in the supplemental material). shRNAs targeting green fluorescent protein (GFP; Sigma catalog no. TRCN0000072181) were used as negative controls.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Transfection

    Juxtanuclear lysosome aggregation does not reverse EMT (A) DU145 Mesenchymal cells were transfected with lentiviral delivered scrambled or Arl8b shRNA and knockdown was determined by immunoblot. (B) DU145 Epithelial, Mesenchymal Non Target, or Mesenchymal Arl8b KD were treated with 25 μM EIPA or vehicle control and fixed and stained for LAMP-1 (red), phalloidin (green), and DAPI (blue); N=3. (C) Represents mean lysosome distribution of 25 cells. *=P

    Journal: Molecular carcinogenesis

    Article Title: Zinc finger E-box binding homeobox-1 (Zeb1) drives anterograde lysosome trafficking and tumor cell invasion via upregulation of Na+/H+ Exchanger-1 (NHE1)

    doi: 10.1002/mc.22528

    Figure Lengend Snippet: Juxtanuclear lysosome aggregation does not reverse EMT (A) DU145 Mesenchymal cells were transfected with lentiviral delivered scrambled or Arl8b shRNA and knockdown was determined by immunoblot. (B) DU145 Epithelial, Mesenchymal Non Target, or Mesenchymal Arl8b KD were treated with 25 μM EIPA or vehicle control and fixed and stained for LAMP-1 (red), phalloidin (green), and DAPI (blue); N=3. (C) Represents mean lysosome distribution of 25 cells. *=P

    Article Snippet: Mission Lentivirus Transduction Particles were used to deliver shRNA targeting Non–Target (SHC202V), Zeb1 (a:TRCN0000369266; b:TRCN0000017565; c:TRCN0000364631), NHE1 (TRCN0000044651), and Arl8b (TRCN0000072857) according to the manufactures protocol (Sigma-Aldrich).

    Techniques: Transfection, shRNA, Staining

    Juxtanuclear lysosome trafficking inhibits EMT-mediated invasion and protease secretion (A) DU145 Epithelial, Mesenchymal Arl8b KD, Mesenchymal NT, or Mesenchymal NT treated with 25 μM EIPA were allowed to migrate through transwell chambers for 48 hours. Migrated cells were fixed and stained with crystal violet. Images represent 10X fields. Graph represents analysis of three independent experiments. *=p

    Journal: Molecular carcinogenesis

    Article Title: Zinc finger E-box binding homeobox-1 (Zeb1) drives anterograde lysosome trafficking and tumor cell invasion via upregulation of Na+/H+ Exchanger-1 (NHE1)

    doi: 10.1002/mc.22528

    Figure Lengend Snippet: Juxtanuclear lysosome trafficking inhibits EMT-mediated invasion and protease secretion (A) DU145 Epithelial, Mesenchymal Arl8b KD, Mesenchymal NT, or Mesenchymal NT treated with 25 μM EIPA were allowed to migrate through transwell chambers for 48 hours. Migrated cells were fixed and stained with crystal violet. Images represent 10X fields. Graph represents analysis of three independent experiments. *=p

    Article Snippet: Mission Lentivirus Transduction Particles were used to deliver shRNA targeting Non–Target (SHC202V), Zeb1 (a:TRCN0000369266; b:TRCN0000017565; c:TRCN0000364631), NHE1 (TRCN0000044651), and Arl8b (TRCN0000072857) according to the manufactures protocol (Sigma-Aldrich).

    Techniques: Staining

    miR-21 regulates anchorage-independent growth opposite to KRIT1. (A) KRIT1 expression modulations were analyzed in MC-1 or MDAMB231 cells stably transduced with lentiviral vectors containing either specific shKRIT1 (pLKO.1-sh-KRIT1 #1 to #4) or a KRIT1 cDNA lacking its 3′UTR (pCLL-KRIT1 or pLVX-KRIT1) or empty controls (pLKO.1-sh-ctrl or pCLL-ctrl or pLVX-ctrl) by Western Blot (WB) analysis and actin was used as loading control. 3 independent analyses were performed in triplicate and representative results are shown. (B–E) Anchorage-independent growth of MDAMB231 and MC-1 cells transfected with miR-21 precursors or inhibitors or their negative controls (pre- and anti-miR-21 or control) or stably transduced with lentiviral vectors containing either specific shKRIT1 (pLKO.1-sh-KRIT1-3, -4) or a KRIT1 cDNA lacking its 3′UTR (pCLL-KRIT1 or pLVX-KRIT1) or empty controls (pLKO.1-sh-control or pCLL-ctrl or pLVX-ctrl). All results are shown as mean ± SEM of the area covered by colonies (pixels). Three independent experiments were performed in triplicate and representative results are shown. (F) Cartoon showing the proposed model for the role of KRIT1 in miR-21-mediated tumorigenesis.

    Journal: Biochemical and Biophysical Research Communications

    Article Title: miR-21 coordinates tumor growth and modulates KRIT1 levels

    doi: 10.1016/j.bbrc.2013.07.031

    Figure Lengend Snippet: miR-21 regulates anchorage-independent growth opposite to KRIT1. (A) KRIT1 expression modulations were analyzed in MC-1 or MDAMB231 cells stably transduced with lentiviral vectors containing either specific shKRIT1 (pLKO.1-sh-KRIT1 #1 to #4) or a KRIT1 cDNA lacking its 3′UTR (pCLL-KRIT1 or pLVX-KRIT1) or empty controls (pLKO.1-sh-ctrl or pCLL-ctrl or pLVX-ctrl) by Western Blot (WB) analysis and actin was used as loading control. 3 independent analyses were performed in triplicate and representative results are shown. (B–E) Anchorage-independent growth of MDAMB231 and MC-1 cells transfected with miR-21 precursors or inhibitors or their negative controls (pre- and anti-miR-21 or control) or stably transduced with lentiviral vectors containing either specific shKRIT1 (pLKO.1-sh-KRIT1-3, -4) or a KRIT1 cDNA lacking its 3′UTR (pCLL-KRIT1 or pLVX-KRIT1) or empty controls (pLKO.1-sh-control or pCLL-ctrl or pLVX-ctrl). All results are shown as mean ± SEM of the area covered by colonies (pixels). Three independent experiments were performed in triplicate and representative results are shown. (F) Cartoon showing the proposed model for the role of KRIT1 in miR-21-mediated tumorigenesis.

    Article Snippet: TaqMan® MicroRNA assays for miRNA detection: Hsa-miR-21 ID 000397, U6 snRNA ID001973 (from Applied Biosystems, Foster City, CA). pLKO.1-empty or pLKO.1-shKRIT1 lentiviral expression vectors were purchased from Sigma (St. Louis, MO, cat. No. MISSION shRNA: NM_004912/TRCN0000072879, TRCN0000072880, TRCN0000072881, TRCN0000072882) and indicated in the text pLKO.1-shKRIT1 #1–4.

    Techniques: Expressing, Stable Transfection, Transduction, Western Blot, Transfection

    MEKK2 knockdown stabilizes focal adhesions. (A) Immunoblot of MDA-MB 231 lysates displaying expression of MEKK2 (upper panel), MEKK3 (middle panel), and total ERK2 as a loading control (lower panel) from control cells, cells treated with MEKK2 shRNA #'s

    Journal: Biochimica et biophysica acta

    Article Title: MEKK2 Regulates Focal Adhesion Stability and Motility in Invasive Breast Cancer Cells

    doi: 10.1016/j.bbamcr.2014.01.029

    Figure Lengend Snippet: MEKK2 knockdown stabilizes focal adhesions. (A) Immunoblot of MDA-MB 231 lysates displaying expression of MEKK2 (upper panel), MEKK3 (middle panel), and total ERK2 as a loading control (lower panel) from control cells, cells treated with MEKK2 shRNA #'s

    Article Snippet: Briefly, stable lines were created by infecting cells with lentivirus encoding either of two distinct MEKK2 shRNA sequences (OpenBiosystems clone ID TRCN0000002043 and TRCN0000002045), followed by selection with puromycin-containing growth media (2 μg/ml) where indicated.

    Techniques: Multiple Displacement Amplification, Expressing, shRNA

    MEKK2 regulates the surface area of spreading cells. (A) MDA-MB 231 control cells, cells treated with MEKK2 shRNAs, or MEKK2 shRNA with stably expressed YFP-MEKK2 (Add-back) were plated on fibronectin-coated cell culture plates for 2 hr. (B) Quantification

    Journal: Biochimica et biophysica acta

    Article Title: MEKK2 Regulates Focal Adhesion Stability and Motility in Invasive Breast Cancer Cells

    doi: 10.1016/j.bbamcr.2014.01.029

    Figure Lengend Snippet: MEKK2 regulates the surface area of spreading cells. (A) MDA-MB 231 control cells, cells treated with MEKK2 shRNAs, or MEKK2 shRNA with stably expressed YFP-MEKK2 (Add-back) were plated on fibronectin-coated cell culture plates for 2 hr. (B) Quantification

    Article Snippet: Briefly, stable lines were created by infecting cells with lentivirus encoding either of two distinct MEKK2 shRNA sequences (OpenBiosystems clone ID TRCN0000002043 and TRCN0000002045), followed by selection with puromycin-containing growth media (2 μg/ml) where indicated.

    Techniques: Multiple Displacement Amplification, shRNA, Stable Transfection, Cell Culture

    Role of the PRMT5 G tracts as splicing silencers. (A) Splicing of the PRMT5-3′SS splicing reporter minigenes, containing 3′SS of different species upstream of middle exon in the DUP175 vector. Upper panel, diagram of the minigenes. Black bar, upstream 3′SS of PRMT5 exon 3 of different species that replaced the corresponding 3′SS of DUP175 (not to scale). Splicing patterns are indicated by slanted lines linking exons (boxes). *, cryptic splicing; arrowhead, reverse primer for primer extension. Lower panel, representative denaturing PAGE gels of primer extension assays of minigenes containing the upstream 3′SS of vector (lane 2) or of PRMT5 exon 3 of different species (lanes 3 to 8). C, mock-transfected sample. The percentages (%) of exon skipping are calculated as the intensity of the 204-nt product relative to the total of the 204-nt and full-length (379-nt) products in each lane. S.D., standard deviation; nt, nucleotides; WT, wild type; Mut, mutant. (B) Upper panel, diagram of the minigene for human PRMT5 exon 3 (E3; 86 nt) and its splicing products (not to scale). Black box and long bars, human PRMT5 exon 3 and partial flanking introns, respectively. Short bar, wild-type G tracts or mutant. Arrowhead, primer. Lower panel, primer extension assay performed as described for panel A. (C) UV cross-linking assay of the binding of hnRNP H/F to the human PRMT5 G tracts. Upper panel, probes used in UV cross-linking. Lower panel, phosphorimages of PAGE gels of proteins from HeLa nuclear extract cross-linked to wild-type or mutant RNA probes (lanes 2 and 3) and immunoprecipitated hnRNP H(H1) from the reactions (IP; lanes 4 to 6). (D) Effect of hnRNP H/F knockdown on endogenous PRMT5 exon 3 skipping in HeLa cells. Upper panel, Western blot analysis of nontreated or mock-, control siRNA (scrambled)-, or hnRNP H/F siRNA-transfected HeLa cell lysates (lanes 1 to 4), showing knockdown of hnRNP H/F. Lower panel, denaturing PAGE gels of semiquantitative RT-PCR of endogenous PRMT5 variant products and GAPDH (glyceraldehyde-3-phosphate dehydrogenase). (E) Effect of hnRNP H/F immunodepletion and of His-hnRNP H add-back on U2AF65 binding to the Py of the upstream 3′SS of PRMT5 exon 3. Upper panel, Western blot analysis of normal (lane 1), hnRNP H/F-depleted (lane 2), or His-hnRNP H add-back HeLa nuclear extracts (lanes 3, 4, and 5). *, His-hnRNP H fragment. Lower panel, diagram of RNA probe (top), phophorimage of immunoprecipitated U2AF65 cross-linked to the G-tract-containing PRMT5 RNA probe in HeLa nuclear extracts (middle), and Western blot analysis of the same gel showing equal loading of U2AF65 (bottom).

    Journal: Molecular and Cellular Biology

    Article Title: Evolutionary Emergence of a Novel Splice Variant with an Opposite Effect on the Cell Cycle

    doi: 10.1128/MCB.00190-15

    Figure Lengend Snippet: Role of the PRMT5 G tracts as splicing silencers. (A) Splicing of the PRMT5-3′SS splicing reporter minigenes, containing 3′SS of different species upstream of middle exon in the DUP175 vector. Upper panel, diagram of the minigenes. Black bar, upstream 3′SS of PRMT5 exon 3 of different species that replaced the corresponding 3′SS of DUP175 (not to scale). Splicing patterns are indicated by slanted lines linking exons (boxes). *, cryptic splicing; arrowhead, reverse primer for primer extension. Lower panel, representative denaturing PAGE gels of primer extension assays of minigenes containing the upstream 3′SS of vector (lane 2) or of PRMT5 exon 3 of different species (lanes 3 to 8). C, mock-transfected sample. The percentages (%) of exon skipping are calculated as the intensity of the 204-nt product relative to the total of the 204-nt and full-length (379-nt) products in each lane. S.D., standard deviation; nt, nucleotides; WT, wild type; Mut, mutant. (B) Upper panel, diagram of the minigene for human PRMT5 exon 3 (E3; 86 nt) and its splicing products (not to scale). Black box and long bars, human PRMT5 exon 3 and partial flanking introns, respectively. Short bar, wild-type G tracts or mutant. Arrowhead, primer. Lower panel, primer extension assay performed as described for panel A. (C) UV cross-linking assay of the binding of hnRNP H/F to the human PRMT5 G tracts. Upper panel, probes used in UV cross-linking. Lower panel, phosphorimages of PAGE gels of proteins from HeLa nuclear extract cross-linked to wild-type or mutant RNA probes (lanes 2 and 3) and immunoprecipitated hnRNP H(H1) from the reactions (IP; lanes 4 to 6). (D) Effect of hnRNP H/F knockdown on endogenous PRMT5 exon 3 skipping in HeLa cells. Upper panel, Western blot analysis of nontreated or mock-, control siRNA (scrambled)-, or hnRNP H/F siRNA-transfected HeLa cell lysates (lanes 1 to 4), showing knockdown of hnRNP H/F. Lower panel, denaturing PAGE gels of semiquantitative RT-PCR of endogenous PRMT5 variant products and GAPDH (glyceraldehyde-3-phosphate dehydrogenase). (E) Effect of hnRNP H/F immunodepletion and of His-hnRNP H add-back on U2AF65 binding to the Py of the upstream 3′SS of PRMT5 exon 3. Upper panel, Western blot analysis of normal (lane 1), hnRNP H/F-depleted (lane 2), or His-hnRNP H add-back HeLa nuclear extracts (lanes 3, 4, and 5). *, His-hnRNP H fragment. Lower panel, diagram of RNA probe (top), phophorimage of immunoprecipitated U2AF65 cross-linked to the G-tract-containing PRMT5 RNA probe in HeLa nuclear extracts (middle), and Western blot analysis of the same gel showing equal loading of U2AF65 (bottom).

    Article Snippet: Lentiviral plasmid pLKO.1 containing short hairpin RNA (shRNA) against the 3′ untranslated region (3′UTR) of human PRMT5 (shPRMT5; clone ID TRCN0000107085 [mature antisense sequence TATTCCAGGGAGTTCTTGAGG]) was purchased from Open Biosystems.

    Techniques: Plasmid Preparation, Polyacrylamide Gel Electrophoresis, Transfection, Standard Deviation, Mutagenesis, Primer Extension Assay, Binding Assay, Immunoprecipitation, Western Blot, Reverse Transcription Polymerase Chain Reaction, Variant Assay

    Domains of PRMT5S and PRMT5L proteins and rescue of H4R3 methylation by either of them. (A) Diagram of the domains of human PRMT5S (upper panel) and PRMT5L (lower panel) and the region of G tract-regulated exon 3 as well as exon 4 (middle panel). Red nucleotides, G tracts; aa, amino acids; AdoMet-MTase, S -adenosylmethionine-dependent methyltransferases; red amino acids and red bar, the peptide deleted in PRMT5S because of exon 3 and partial exon 4 skipping. The arrowhead in exon 4 indicates an alternative 3′ splice junction used for PRMT5S. (B) Western blot showing knockdown with lentiviral short hairpin PRMT5 (shPRMT5) and rescue with MycPRMT5L (L) or MycPRMT5S (S) in HeLa cells. (C) Western blot showing the histone H4R3 methylation in HeLa cells after PRMT5 knockdown/rescue. # and *, bands of unknown identity, likely symmetrically dimethylated arginine epitopes of unknown proteins that are also recognized by the antibody.

    Journal: Molecular and Cellular Biology

    Article Title: Evolutionary Emergence of a Novel Splice Variant with an Opposite Effect on the Cell Cycle

    doi: 10.1128/MCB.00190-15

    Figure Lengend Snippet: Domains of PRMT5S and PRMT5L proteins and rescue of H4R3 methylation by either of them. (A) Diagram of the domains of human PRMT5S (upper panel) and PRMT5L (lower panel) and the region of G tract-regulated exon 3 as well as exon 4 (middle panel). Red nucleotides, G tracts; aa, amino acids; AdoMet-MTase, S -adenosylmethionine-dependent methyltransferases; red amino acids and red bar, the peptide deleted in PRMT5S because of exon 3 and partial exon 4 skipping. The arrowhead in exon 4 indicates an alternative 3′ splice junction used for PRMT5S. (B) Western blot showing knockdown with lentiviral short hairpin PRMT5 (shPRMT5) and rescue with MycPRMT5L (L) or MycPRMT5S (S) in HeLa cells. (C) Western blot showing the histone H4R3 methylation in HeLa cells after PRMT5 knockdown/rescue. # and *, bands of unknown identity, likely symmetrically dimethylated arginine epitopes of unknown proteins that are also recognized by the antibody.

    Article Snippet: Lentiviral plasmid pLKO.1 containing short hairpin RNA (shRNA) against the 3′ untranslated region (3′UTR) of human PRMT5 (shPRMT5; clone ID TRCN0000107085 [mature antisense sequence TATTCCAGGGAGTTCTTGAGG]) was purchased from Open Biosystems.

    Techniques: Methylation, Western Blot

    Identification of a group of cell cycle-arresting genes preferentially regulated by PRMT5S in RNAi and rescue assays. (A) Functional clusters with most significant enrichment of PRMT5S-preferred genes identified by RNA-Seq analysis. (B) Genes preferentially regulated by PRMT5L or PRMT5S in PRMT5 knockdown and rescue assays. Left panel, representative agarose gels of the RT-PCR products of genes that have been confirmed to be preferentially regulated by PRMT5L or PRMTS in RNAi/rescue assays in HeLa cells, in alphabetical order for the PRMTL targets and in order of their description in the text for the PRMT5S targets. Four genes not reported to affect cell cycle but also regulated by PRMT5S are shown below the cell cycle-regulating ones. GAPDH, RNA loading control. Right panel, bar graphs (averages ± standard deviations [SD], n = 3) of the changes of the corresponding genes presented in the same order as in the left panel. Numbers above the dotted lines on top of bars represent the fold change values beyond the vertical axis scale. *, P

    Journal: Molecular and Cellular Biology

    Article Title: Evolutionary Emergence of a Novel Splice Variant with an Opposite Effect on the Cell Cycle

    doi: 10.1128/MCB.00190-15

    Figure Lengend Snippet: Identification of a group of cell cycle-arresting genes preferentially regulated by PRMT5S in RNAi and rescue assays. (A) Functional clusters with most significant enrichment of PRMT5S-preferred genes identified by RNA-Seq analysis. (B) Genes preferentially regulated by PRMT5L or PRMT5S in PRMT5 knockdown and rescue assays. Left panel, representative agarose gels of the RT-PCR products of genes that have been confirmed to be preferentially regulated by PRMT5L or PRMTS in RNAi/rescue assays in HeLa cells, in alphabetical order for the PRMTL targets and in order of their description in the text for the PRMT5S targets. Four genes not reported to affect cell cycle but also regulated by PRMT5S are shown below the cell cycle-regulating ones. GAPDH, RNA loading control. Right panel, bar graphs (averages ± standard deviations [SD], n = 3) of the changes of the corresponding genes presented in the same order as in the left panel. Numbers above the dotted lines on top of bars represent the fold change values beyond the vertical axis scale. *, P

    Article Snippet: Lentiviral plasmid pLKO.1 containing short hairpin RNA (shRNA) against the 3′ untranslated region (3′UTR) of human PRMT5 (shPRMT5; clone ID TRCN0000107085 [mature antisense sequence TATTCCAGGGAGTTCTTGAGG]) was purchased from Open Biosystems.

    Techniques: Functional Assay, RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction

    Alternative splicing of PRMT5 exon 3 and evolutionary emergence of REPA G tracts between the Py and 3′AG. (A) Diagram of pre-mRNA around human PRMT5 exon 3 (not to scale). Alternative splicing of exon 3 with concomitant usage of an alternative 3′SS within exon 4 creates longer or shorter PRMT5 splice variants, PRMT5L or PRMT5S. Red bar, location of the G tracts; arrowheads, positions of PCR primers. (B) Alignment of the upstream 3′SS sequences of PRMT5 exon 3 of 29 species. The G tracts between Py and 3′ AG are indicated above the aligned sequences. Dotted lines and blue nucleotides, corresponding position of the G tracts in birds and other lower chordates. At the bottom is the consensus sequence of constitutive 3′SS for comparison. (C) Usage of PRMT5 exon 3 in human cell lines and zebrafish tissues. A representative denaturing PAGE gel of semiquantitative RT-PCR products with exon 3 included (PRMT5L) or excluded (PRMT5S), as confirmed by sequencing, is shown. The asterisk indicates a product from a potential cryptic splice site.

    Journal: Molecular and Cellular Biology

    Article Title: Evolutionary Emergence of a Novel Splice Variant with an Opposite Effect on the Cell Cycle

    doi: 10.1128/MCB.00190-15

    Figure Lengend Snippet: Alternative splicing of PRMT5 exon 3 and evolutionary emergence of REPA G tracts between the Py and 3′AG. (A) Diagram of pre-mRNA around human PRMT5 exon 3 (not to scale). Alternative splicing of exon 3 with concomitant usage of an alternative 3′SS within exon 4 creates longer or shorter PRMT5 splice variants, PRMT5L or PRMT5S. Red bar, location of the G tracts; arrowheads, positions of PCR primers. (B) Alignment of the upstream 3′SS sequences of PRMT5 exon 3 of 29 species. The G tracts between Py and 3′ AG are indicated above the aligned sequences. Dotted lines and blue nucleotides, corresponding position of the G tracts in birds and other lower chordates. At the bottom is the consensus sequence of constitutive 3′SS for comparison. (C) Usage of PRMT5 exon 3 in human cell lines and zebrafish tissues. A representative denaturing PAGE gel of semiquantitative RT-PCR products with exon 3 included (PRMT5L) or excluded (PRMT5S), as confirmed by sequencing, is shown. The asterisk indicates a product from a potential cryptic splice site.

    Article Snippet: Lentiviral plasmid pLKO.1 containing short hairpin RNA (shRNA) against the 3′ untranslated region (3′UTR) of human PRMT5 (shPRMT5; clone ID TRCN0000107085 [mature antisense sequence TATTCCAGGGAGTTCTTGAGG]) was purchased from Open Biosystems.

    Techniques: Polymerase Chain Reaction, Sequencing, Polyacrylamide Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction

    Identification and functional clustering of human genes containing REPA G 5–8 between Py and 3′ AG of 3′SS. (A) Diagram showing the position of evolved REPA G 5–8 (red) between Py and 3′AG, in comparison with the corresponding location of the constitutive 3′SS. Possible locations of the potential trans -acting factors U2AF65/35 (green ovals) and hnRNP H/F (red oval) binding to the 3′SS are indicated. (B) Functional clustering of genes that contain alternative exons with REPA G 5–8 . In red within the clustered functions are 7 of the 12 genes with their REPA G tracts found in mammalians only and not in lower vertebrates, from 14 genes that can be verified by sequence alignment. PRMT5 is highlighted in bold.

    Journal: Molecular and Cellular Biology

    Article Title: Evolutionary Emergence of a Novel Splice Variant with an Opposite Effect on the Cell Cycle

    doi: 10.1128/MCB.00190-15

    Figure Lengend Snippet: Identification and functional clustering of human genes containing REPA G 5–8 between Py and 3′ AG of 3′SS. (A) Diagram showing the position of evolved REPA G 5–8 (red) between Py and 3′AG, in comparison with the corresponding location of the constitutive 3′SS. Possible locations of the potential trans -acting factors U2AF65/35 (green ovals) and hnRNP H/F (red oval) binding to the 3′SS are indicated. (B) Functional clustering of genes that contain alternative exons with REPA G 5–8 . In red within the clustered functions are 7 of the 12 genes with their REPA G tracts found in mammalians only and not in lower vertebrates, from 14 genes that can be verified by sequence alignment. PRMT5 is highlighted in bold.

    Article Snippet: Lentiviral plasmid pLKO.1 containing short hairpin RNA (shRNA) against the 3′ untranslated region (3′UTR) of human PRMT5 (shPRMT5; clone ID TRCN0000107085 [mature antisense sequence TATTCCAGGGAGTTCTTGAGG]) was purchased from Open Biosystems.

    Techniques: Functional Assay, Binding Assay, Sequencing

    HuR mediates the association of CRABP2 with endoplasmic reticulum. (A) M2 −/− cells were untreated (−) or treated with CGP74514A (2 µM, 2 h) (+CGP). The ER marker calnexin and HuR were visualized by immunostaining. Cells were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) to visualize nuclei. (B) Immunoblot demonstrating expression of HuR in M2 −/− cells stably expressing shRNAs targeting luciferase (shCtrl) or HuR (shHuR). (C) M2 −/− cells stably expressing shCtrl or shHuR were transiently transfected with a vector encoding Flag–CRABP2. Flag–CRABP2 (red) and ER marker calnexin (green) were immunostained and visualized using confocal microscopy. DAPI was used to visualize nuclei.

    Journal: Journal of Cell Science

    Article Title: RNA-binding protein HuR regulates nuclear import of protein

    doi: 10.1242/jcs.192096

    Figure Lengend Snippet: HuR mediates the association of CRABP2 with endoplasmic reticulum. (A) M2 −/− cells were untreated (−) or treated with CGP74514A (2 µM, 2 h) (+CGP). The ER marker calnexin and HuR were visualized by immunostaining. Cells were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) to visualize nuclei. (B) Immunoblot demonstrating expression of HuR in M2 −/− cells stably expressing shRNAs targeting luciferase (shCtrl) or HuR (shHuR). (C) M2 −/− cells stably expressing shCtrl or shHuR were transiently transfected with a vector encoding Flag–CRABP2. Flag–CRABP2 (red) and ER marker calnexin (green) were immunostained and visualized using confocal microscopy. DAPI was used to visualize nuclei.

    Article Snippet: pLKO.1 vectors harboring shRNAs for HuR ( Elavl1 , TRCN0000112085; Elavl1 TRCN0000112087; Elavl1 TRCN0000112088; Mouse) ( ELAVL1 TRCN0000017275; Human) were from Open Biosystems; pLKO.1 vector harboring luciferase shRNA (SHC007) or non-targeting shRNA (SHC002) was from Sigma-Aldrich.

    Techniques: Marker, Immunostaining, Expressing, Stable Transfection, Luciferase, Transfection, Plasmid Preparation, Confocal Microscopy

    Arl8b knockdown prevents low pH-, EGF-, and HGF-induced lysosome trafficking to the cell membrane A. DU145 and PPC1 cells were transduced with lentiviral-delivered shRNA sequences targeted to Arl8b (KD) or non-targeted (NT) shRNA. Immunoblots confirm knockdown. B. DU145 and PPC1 cells were treated with low pH for 2 hours, or 33 ng/mL HGF or 100 ng/mL EGF for 18 hours then fixed, stained for LAMP-1 (Red), phalloidin (Green), and DAPI (Blue). C. Quantitated lysosome distribution from 25 cells shown as mean ± SEM; *=p

    Journal: Oncotarget

    Article Title: The Arf-like GTPase Arl8b is essential for three-dimensional invasive growth of prostate cancer in vitro and xenograft formation and growth in vivo

    doi: 10.18632/oncotarget.8832

    Figure Lengend Snippet: Arl8b knockdown prevents low pH-, EGF-, and HGF-induced lysosome trafficking to the cell membrane A. DU145 and PPC1 cells were transduced with lentiviral-delivered shRNA sequences targeted to Arl8b (KD) or non-targeted (NT) shRNA. Immunoblots confirm knockdown. B. DU145 and PPC1 cells were treated with low pH for 2 hours, or 33 ng/mL HGF or 100 ng/mL EGF for 18 hours then fixed, stained for LAMP-1 (Red), phalloidin (Green), and DAPI (Blue). C. Quantitated lysosome distribution from 25 cells shown as mean ± SEM; *=p

    Article Snippet: Lentivirus delivery of shRNA Scrambled non-target (NT) shRNA (SHC202V) or Arl8b shRNA was delivered to DU145 and MDA MB 231 (i:TRCN0000072857; ii: TRCN0000072854) or PPC1 (i:TRCN0000072854; ii: TRCN0000072853) cells using Mission Lentivirus Transduction particles (Sigma).

    Techniques: Transduction, shRNA, Western Blot, Staining

    Nox4 but not Nox1 is critical for TGFβ1‐mediated fibroblast activation. ( a ) Primary human prostate fibroblasts incubated with bFGF or TGFβ1 as indicated for 48 hr before qPCR analysis of Nox family members relative to the housekeeping gene TBP. The direct TGFβ1 target genes SERPINE1 and COMP served as positive controls. The nonresponsive gene HMBS served as negative control. ( b ) Lentiviral‐mediated silencing of Nox1 or Nox4 in primary human prostate fibroblasts transduced with 2 different Nox1 or Nox4‐specific shRNAs (1 and 2) and subsequently treated with bFGF or TGFβ1 for 48 hr before qPCR of Nox1 and Nox4 expression ( top) , or the indicated CAF marker ( bottom) relative to the housekeeping gene TBP. ( c , d ) Nox1 RNA in situ hybridization on radical prostatectomy prostate tissue specimens from PCa patients. Benign (BE) and adjacent cancer (CA) areas are shown. Single and multiple Nox4 mRNA transcripts appear as single red dots or clusters, respectively. Boxed regions ( top panel ) are enlarged ( lower panel ). Arrowheads demarcate weak epithelial Nox1 mRNA levels in benign tissue. ( d ) ImageJ quantification of Nox1 in situ hybridization images as in ( c ) using threshold settings described in Materials and Methods. ( a , b ) Data represent mean + SEM of four independent experiments using primary fibroblasts isolated from different donors. ( c ) Images are representative of 3 independent experiments using tissue from different patients. ( d ) Data represent mean + SEM from 10 fields of view each (40× magnification) from CA and BE adjacent regions of 3 different patient specimens. ( a , b , d ) Statistical significance is shown (* p

    Journal: International Journal of Cancer

    Article Title: Inhibition of Nox4‐dependent ROS signaling attenuates prostate fibroblast activation and abrogates stromal‐mediated protumorigenic interactions

    doi: 10.1002/ijc.31316

    Figure Lengend Snippet: Nox4 but not Nox1 is critical for TGFβ1‐mediated fibroblast activation. ( a ) Primary human prostate fibroblasts incubated with bFGF or TGFβ1 as indicated for 48 hr before qPCR analysis of Nox family members relative to the housekeeping gene TBP. The direct TGFβ1 target genes SERPINE1 and COMP served as positive controls. The nonresponsive gene HMBS served as negative control. ( b ) Lentiviral‐mediated silencing of Nox1 or Nox4 in primary human prostate fibroblasts transduced with 2 different Nox1 or Nox4‐specific shRNAs (1 and 2) and subsequently treated with bFGF or TGFβ1 for 48 hr before qPCR of Nox1 and Nox4 expression ( top) , or the indicated CAF marker ( bottom) relative to the housekeeping gene TBP. ( c , d ) Nox1 RNA in situ hybridization on radical prostatectomy prostate tissue specimens from PCa patients. Benign (BE) and adjacent cancer (CA) areas are shown. Single and multiple Nox4 mRNA transcripts appear as single red dots or clusters, respectively. Boxed regions ( top panel ) are enlarged ( lower panel ). Arrowheads demarcate weak epithelial Nox1 mRNA levels in benign tissue. ( d ) ImageJ quantification of Nox1 in situ hybridization images as in ( c ) using threshold settings described in Materials and Methods. ( a , b ) Data represent mean + SEM of four independent experiments using primary fibroblasts isolated from different donors. ( c ) Images are representative of 3 independent experiments using tissue from different patients. ( d ) Data represent mean + SEM from 10 fields of view each (40× magnification) from CA and BE adjacent regions of 3 different patient specimens. ( a , b , d ) Statistical significance is shown (* p

    Article Snippet: Nox1 and Nox4 shRNAs (GE Healthcare Dharmacon Vienna, Austria) employed were TRCN0000046085 and TRCN0000046086 (Nox1) and TRCN0000046090 and TRCN0000046089 (Nox4).

    Techniques: Activation Assay, Incubation, Real-time Polymerase Chain Reaction, Negative Control, Transduction, Expressing, Marker, RNA In Situ Hybridization, In Situ Hybridization, Isolation

    QRT-PCR analysis of PI4KA-sp and PI4KB-sp siRNAs across multiple HCV replicons. Eight HCV replicons (SG-1b, Luc-1b, FL-1b, Luc-1a, SG-1a, FL-1a, SG-2a, and JFH1-2a) were transfected with 25 nM concentrations of PI4KA-sp, PI4KB-sp, and GAPDH-sp siRNAs

    Journal: Journal of Virology

    Article Title: Class III Phosphatidylinositol 4-Kinase Alpha and Beta Are Novel Host Factor Regulators of Hepatitis C Virus Replication

    doi: 10.1128/JVI.02418-08

    Figure Lengend Snippet: QRT-PCR analysis of PI4KA-sp and PI4KB-sp siRNAs across multiple HCV replicons. Eight HCV replicons (SG-1b, Luc-1b, FL-1b, Luc-1a, SG-1a, FL-1a, SG-2a, and JFH1-2a) were transfected with 25 nM concentrations of PI4KA-sp, PI4KB-sp, and GAPDH-sp siRNAs

    Article Snippet: Short hairpin RNAs (shRNAs) targeting PI4KA ( , Sigma catalog no. SHGLY- ) and PI4KB ( , Sigma catalog no. SHGLY- ) were ordered as five individual shRNA clones (see Table S3 in the supplemental material). shRNAs targeting green fluorescent protein (GFP; Sigma catalog no. TRCN0000072181) were used as negative controls.

    Techniques: Quantitative RT-PCR, Transfection

    Validation of PI4KA and PI4KB siRNAs. (A and B) Each PI4K siRNA was analyzed by RT-PCR to determine whether the siRNAs were isoform specific. After siRNA transfection with PI4KA (A) and PI4KB (B) siRNAs, the mRNA levels were measured using both a PI4KA

    Journal: Journal of Virology

    Article Title: Class III Phosphatidylinositol 4-Kinase Alpha and Beta Are Novel Host Factor Regulators of Hepatitis C Virus Replication

    doi: 10.1128/JVI.02418-08

    Figure Lengend Snippet: Validation of PI4KA and PI4KB siRNAs. (A and B) Each PI4K siRNA was analyzed by RT-PCR to determine whether the siRNAs were isoform specific. After siRNA transfection with PI4KA (A) and PI4KB (B) siRNAs, the mRNA levels were measured using both a PI4KA

    Article Snippet: Short hairpin RNAs (shRNAs) targeting PI4KA ( , Sigma catalog no. SHGLY- ) and PI4KB ( , Sigma catalog no. SHGLY- ) were ordered as five individual shRNA clones (see Table S3 in the supplemental material). shRNAs targeting green fluorescent protein (GFP; Sigma catalog no. TRCN0000072181) were used as negative controls.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Transfection

    Stable silencing of PI4KA and PI4KB in Luc-1b replicon cells. (A and B) Three shRNAs targeting PI4KA or PI4KB were stably transduced into Luc-1b cells (on puromycin for 2 weeks), and the mRNA levels were quantified by using RT-PCR for PI4KA (A) and PI4KB

    Journal: Journal of Virology

    Article Title: Class III Phosphatidylinositol 4-Kinase Alpha and Beta Are Novel Host Factor Regulators of Hepatitis C Virus Replication

    doi: 10.1128/JVI.02418-08

    Figure Lengend Snippet: Stable silencing of PI4KA and PI4KB in Luc-1b replicon cells. (A and B) Three shRNAs targeting PI4KA or PI4KB were stably transduced into Luc-1b cells (on puromycin for 2 weeks), and the mRNA levels were quantified by using RT-PCR for PI4KA (A) and PI4KB

    Article Snippet: Short hairpin RNAs (shRNAs) targeting PI4KA ( , Sigma catalog no. SHGLY- ) and PI4KB ( , Sigma catalog no. SHGLY- ) were ordered as five individual shRNA clones (see Table S3 in the supplemental material). shRNAs targeting green fluorescent protein (GFP; Sigma catalog no. TRCN0000072181) were used as negative controls.

    Techniques: Stable Transfection, Reverse Transcription Polymerase Chain Reaction

    PI4KA and PI4KB siRNAs inhibit JFH-1 infectious virus. (A) A set of SMARTpool siRNAs known to affect HCV entry were transfected into JFH1-2a-infected cells at 25 nM, and the Renilla expression was quantified at 72 h. (B) siRNAs were transfected over a

    Journal: Journal of Virology

    Article Title: Class III Phosphatidylinositol 4-Kinase Alpha and Beta Are Novel Host Factor Regulators of Hepatitis C Virus Replication

    doi: 10.1128/JVI.02418-08

    Figure Lengend Snippet: PI4KA and PI4KB siRNAs inhibit JFH-1 infectious virus. (A) A set of SMARTpool siRNAs known to affect HCV entry were transfected into JFH1-2a-infected cells at 25 nM, and the Renilla expression was quantified at 72 h. (B) siRNAs were transfected over a

    Article Snippet: Short hairpin RNAs (shRNAs) targeting PI4KA ( , Sigma catalog no. SHGLY- ) and PI4KB ( , Sigma catalog no. SHGLY- ) were ordered as five individual shRNA clones (see Table S3 in the supplemental material). shRNAs targeting green fluorescent protein (GFP; Sigma catalog no. TRCN0000072181) were used as negative controls.

    Techniques: Transfection, Infection, Expressing

    Knockdown of p21 blocks JAZ-mediated neuroprotection. A, overexpression of p21 protects neurons from LK-induced death. CGNs transfected with GFP or p21-FLAG for 8 h were switched to either HK or LK medium for 24 h. Viability of transfected neurons was

    Journal: The Journal of Biological Chemistry

    Article Title: JAZ (Znf346), a SIRT1-interacting Protein, Protects Neurons by Stimulating p21 (WAF/CIP1) Protein Expression *

    doi: 10.1074/jbc.M114.597575

    Figure Lengend Snippet: Knockdown of p21 blocks JAZ-mediated neuroprotection. A, overexpression of p21 protects neurons from LK-induced death. CGNs transfected with GFP or p21-FLAG for 8 h were switched to either HK or LK medium for 24 h. Viability of transfected neurons was

    Article Snippet: Five different shRNAs were obtained for p21 knockdown from Sigma (TRCN0000042583, TRCN0000042585, TRCN0000042587, TRCN0000054901, and TRCN0000054902) denoted as ShA, ShB, ShC, ShD, and ShE.

    Techniques: Over Expression, Transfection

    JAZ binds to the p21 promoter and stimulates its activity. A, HEK293T cells were transfected with GFP or JAZ-FLAG for 36 h. Cells were processed for ChIP analysis as described in “Experimental Procedures.” Immunoprecipitation was performed

    Journal: The Journal of Biological Chemistry

    Article Title: JAZ (Znf346), a SIRT1-interacting Protein, Protects Neurons by Stimulating p21 (WAF/CIP1) Protein Expression *

    doi: 10.1074/jbc.M114.597575

    Figure Lengend Snippet: JAZ binds to the p21 promoter and stimulates its activity. A, HEK293T cells were transfected with GFP or JAZ-FLAG for 36 h. Cells were processed for ChIP analysis as described in “Experimental Procedures.” Immunoprecipitation was performed

    Article Snippet: Five different shRNAs were obtained for p21 knockdown from Sigma (TRCN0000042583, TRCN0000042585, TRCN0000042587, TRCN0000054901, and TRCN0000054902) denoted as ShA, ShB, ShC, ShD, and ShE.

    Techniques: Activity Assay, Transfection, Chromatin Immunoprecipitation, Immunoprecipitation

    Binding of JAZ to the p21 promoter correlates with p21 expression during apoptosis. A, lysates from CGNs treated with HK or LK medium for 3, 6, and 9 h were used in Western blot analysis. The blots were probed sequentially with p21 and ERK antibodies.

    Journal: The Journal of Biological Chemistry

    Article Title: JAZ (Znf346), a SIRT1-interacting Protein, Protects Neurons by Stimulating p21 (WAF/CIP1) Protein Expression *

    doi: 10.1074/jbc.M114.597575

    Figure Lengend Snippet: Binding of JAZ to the p21 promoter correlates with p21 expression during apoptosis. A, lysates from CGNs treated with HK or LK medium for 3, 6, and 9 h were used in Western blot analysis. The blots were probed sequentially with p21 and ERK antibodies.

    Article Snippet: Five different shRNAs were obtained for p21 knockdown from Sigma (TRCN0000042583, TRCN0000042585, TRCN0000042587, TRCN0000054901, and TRCN0000054902) denoted as ShA, ShB, ShC, ShD, and ShE.

    Techniques: Binding Assay, Expressing, Western Blot

    JAZ stimulates p21 expression. A, CGNs were infected with Ad-GFP or Ad-JAZ-FLAG for 36 h after which RNA was prepared and RT-PCR analysis was performed using primers for p21, GFP, and JAZ. Actin serves as a normalization control. B, cell lysates were

    Journal: The Journal of Biological Chemistry

    Article Title: JAZ (Znf346), a SIRT1-interacting Protein, Protects Neurons by Stimulating p21 (WAF/CIP1) Protein Expression *

    doi: 10.1074/jbc.M114.597575

    Figure Lengend Snippet: JAZ stimulates p21 expression. A, CGNs were infected with Ad-GFP or Ad-JAZ-FLAG for 36 h after which RNA was prepared and RT-PCR analysis was performed using primers for p21, GFP, and JAZ. Actin serves as a normalization control. B, cell lysates were

    Article Snippet: Five different shRNAs were obtained for p21 knockdown from Sigma (TRCN0000042583, TRCN0000042585, TRCN0000042587, TRCN0000054901, and TRCN0000054902) denoted as ShA, ShB, ShC, ShD, and ShE.

    Techniques: Expressing, Infection, Reverse Transcription Polymerase Chain Reaction