tigar Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Thermo Fisher gene exp tigar hs00608644 m1
    Effect of <t>TIGAR</t> on markers of catabolism and NADPH in carcinoma cells. T47D cells and MDA-MB-231 cells overexpressing TIGAR and control cells were cultured and lysed and subjected to immunoblot analysis for TIGAR and MCT2 ( A ), MCT2 mRNA expression as -fold change relative to control ( B ), LDHB protein expression ( C ), GLS1 protein expression ( D ), and GLUL (glutamate ammonia ligase) protein expression in T47D cells ( E ), NADP + /NADPH ratio in T47D and MDA-MB-231 cells ( F and G ) .
    Gene Exp Tigar Hs00608644 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp tigar hs00608644 m1/product/Thermo Fisher
    Average 85 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    gene exp tigar hs00608644 m1 - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    94
    Millipore anti tigar
    <t>Tigar</t> Deficiency Promotes Activation of a Pro-migratory <t>Erk</t> Signaling (A) Western blot analysis of CTR and TIGAR KO KFC PDAC cells. pERK, ERK, TIGAR, and the loading control VINCULIN were detected on one blot, DUSP6 and the loading control VINCULIN (bottom) were detected on a separate parallel blot. (B and C) Phospho-ERK (pERK) staining (B) and quantification (C) of CTR and TIGAR KO KFC tumors. ∗ p
    Anti Tigar, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti tigar/product/Millipore
    Average 94 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    anti tigar - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    94
    Abcam anti tigar
    Activation of human CD3 + T cells increases <t>PFKFB3</t> expression and intracellular F2,6BP. CD3 + T cells were isolated by negative selection and then plated at a final concentration of 1 x 10 6 cells/ml in the absence or presence of anti-CD3/anti-CD28-conjugated microbeads for 5, 10 and 24 hours. ( A ), PFKFB1-4 and <t>TIGAR</t> mRNA expression was determined using real-time RT-PCR analyses. ( B ), PFKFB2-4, TIGAR, CD69 and β-actin protein expression was determined by Western blot analyses. ( C ), Intracellular F2,6BP concentration was determined using a coupled enzyme assay. ( D ), Densitometric analysis of PFKFB2-4, TIGAR, CD69 and β-actin protein expression. Data are representative of three independent experiments. * p
    Anti Tigar, supplied by Abcam, used in various techniques. Bioz Stars score: 94/100, based on 71 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti tigar/product/Abcam
    Average 94 stars, based on 71 article reviews
    Price from $9.99 to $1999.99
    anti tigar - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    tigar  (Abcam)
    93
    Abcam tigar
    <t>TGF-β</t> 1 activates mTOR and <t>TIGAR.</t> A) In human lung fibroblasts, TGF-β 1 inhibits LC3-II formation, even in the presence of IFN-γ which induces autophagy. B) TGF-β 1 is unable to inhibit LC3-II formation in presence of mTOR inhibitor rapamycin. C) TGF-β 1 is able to activate mTORC1 which results in increased phospho-S6 but this activation does not occur in the presence of rapamycin. D) TGF-β 1 appears to activate mTORC1 by activating upstream PI3K/AKT and treatment with PI3K inhibitor LY294002 prevents TGF-β 1 induced mTOR activation. E) Western blot of phospho-mTOR (Ser2448) showing increased phospho-mTOR with TGF-β 1 in fibroblasts and inhibition by rapamycin. F) Western blot of phospho-S6 from mouse lung tissue treated with bleomycin and rapamycin. G) Densitometry of blot from 4E. (*p = 0.03 for controls vs. bleomycin, **p = 0.003 for bleomycin vs rapamycin + bleomycin). H) phospho-S6 protein levels in human lung tissue is higher in IPF patients compared with COPD patients and healthy controls. I) TIGAR is induced by TGF-β 1 in fibroblasts in a dose-responsive manner. J) Western blot demonstrating TIGAR protein levels in lung homogenate from human tissue is higher in IPF patients compared with COPD patients and healthy controls.
    Tigar, supplied by Abcam, used in various techniques. Bioz Stars score: 93/100, based on 59 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tigar/product/Abcam
    Average 93 stars, based on 59 article reviews
    Price from $9.99 to $1999.99
    tigar - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    89
    Santa Cruz Biotechnology tigar
    CS knockdown induced EMT switch is reverted by p53 reactivation. (A) Western blotting of HIF-1 <t>α</t> expression in CS knockdown cells. Total proteins isolated from cells as indicated were blotted with antibodies for HIF-1α and β-actin. Proteins prepared from cells cultured in 1% O 2 for 24 h serves as positive control for hypoxic condition. (B) Western blotting of HDM2, p53, <t>TIGAR,</t> and SCO2 expression in CS knockdown cells. Total proteins isolated from indicated cells were blotted with antibodies as labeled. (C) Fluorescence imaging of stress fibers of CS knockdown cells treated with MG132. Cells were treated with 10 mM MG132 for 12 h and then stained with Alexa Fluor 488-conjugated phalloidin and DAPI. (D) Western blotting of HDM2, p53, TIGAR, and SCO2 proteins in CS knockdown cells treated with MG132. Cells as indicated were treated with 10 mM MG132 for 0, 6, and 12 h. Total protein extracts isolated from these cells were blotted with antibodies as indicated. (E) Morphological imaging of CS, HDM2, and CS/HDM2 knockdown cells. Cells with single CS, HDM2, or double CS/HDM2 knockdown as indicated were selected and imaged. (F) Western blotting of proteins involved in bioenergetic metabolism in single CS, HDM2, and double CS/HDM2 knockdown cells. Total protein extracts isolated from the indicated cells were blotted with antibodies as labeled. The level of β-actin serves as a loading control.
    Tigar, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 89/100, based on 55 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tigar/product/Santa Cruz Biotechnology
    Average 89 stars, based on 55 article reviews
    Price from $9.99 to $1999.99
    tigar - by Bioz Stars, 2020-09
    89/100 stars
      Buy from Supplier

    93
    Shanghai Genechem egfp lv shrna tigar
    Knockdown of <t>TIGAR</t> enhanced the anticancer effect of aescin in vivo. a The infection efficiency analysis of HCT-116 cells by fluorescence microscopy. Cells were infected with vector or <t>EGFP-LV-shRNA-TIGAR</t> (MOI = 10). b The levels of TIGAR and β-actin in NC and three clones by WB. Three clones (1#, 2#, and 3#) were selected in medium with 4 μg/mL puromycin for 2 weeks. c The mice ( n  = 6) with different sizes of tumors in right iliac fossa and the tumors that were dissected from various groups of mice. d The body weight of mice in various groups. e The comparison of tumor volumes in various groups. f Quantitative analysis of the tumor weight in various groups. g The levels of PRAP, TIGAR, and β-actin in tumor tissues of various groups by WB. h Immunohistochemistry analysis of the levels of γ-H2AX, TIGAR, and Ki-67 in various groups of tumor tissues. β-actin was used as a loading control. * P  
    Egfp Lv Shrna Tigar, supplied by Shanghai Genechem, used in various techniques. Bioz Stars score: 93/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/egfp lv shrna tigar/product/Shanghai Genechem
    Average 93 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    egfp lv shrna tigar - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    94
    GenePharma Company sirna tigar
    Knockdown of <t>TIGAR</t> enhanced the anticancer effect of aescin in vivo. a The infection efficiency analysis of HCT-116 cells by fluorescence microscopy. Cells were infected with vector or <t>EGFP-LV-shRNA-TIGAR</t> (MOI = 10). b The levels of TIGAR and β-actin in NC and three clones by WB. Three clones (1#, 2#, and 3#) were selected in medium with 4 μg/mL puromycin for 2 weeks. c The mice ( n  = 6) with different sizes of tumors in right iliac fossa and the tumors that were dissected from various groups of mice. d The body weight of mice in various groups. e The comparison of tumor volumes in various groups. f Quantitative analysis of the tumor weight in various groups. g The levels of PRAP, TIGAR, and β-actin in tumor tissues of various groups by WB. h Immunohistochemistry analysis of the levels of γ-H2AX, TIGAR, and Ki-67 in various groups of tumor tissues. β-actin was used as a loading control. * P  
    Sirna Tigar, supplied by GenePharma Company, used in various techniques. Bioz Stars score: 94/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirna tigar/product/GenePharma Company
    Average 94 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    sirna tigar - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    88
    Santa Cruz Biotechnology tigar m 209
    Knockdown of <t>TIGAR</t> enhanced the anticancer effect of aescin in vivo. a The infection efficiency analysis of HCT-116 cells by fluorescence microscopy. Cells were infected with vector or <t>EGFP-LV-shRNA-TIGAR</t> (MOI = 10). b The levels of TIGAR and β-actin in NC and three clones by WB. Three clones (1#, 2#, and 3#) were selected in medium with 4 μg/mL puromycin for 2 weeks. c The mice ( n  = 6) with different sizes of tumors in right iliac fossa and the tumors that were dissected from various groups of mice. d The body weight of mice in various groups. e The comparison of tumor volumes in various groups. f Quantitative analysis of the tumor weight in various groups. g The levels of PRAP, TIGAR, and β-actin in tumor tissues of various groups by WB. h Immunohistochemistry analysis of the levels of γ-H2AX, TIGAR, and Ki-67 in various groups of tumor tissues. β-actin was used as a loading control. * P  
    Tigar M 209, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 88/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tigar m 209/product/Santa Cruz Biotechnology
    Average 88 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    tigar m 209 - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    90
    Millipore antibody against tigar
    Knockdown of <t>TIGAR</t> enhanced the anticancer effect of aescin in vivo. a The infection efficiency analysis of HCT-116 cells by fluorescence microscopy. Cells were infected with vector or <t>EGFP-LV-shRNA-TIGAR</t> (MOI = 10). b The levels of TIGAR and β-actin in NC and three clones by WB. Three clones (1#, 2#, and 3#) were selected in medium with 4 μg/mL puromycin for 2 weeks. c The mice ( n  = 6) with different sizes of tumors in right iliac fossa and the tumors that were dissected from various groups of mice. d The body weight of mice in various groups. e The comparison of tumor volumes in various groups. f Quantitative analysis of the tumor weight in various groups. g The levels of PRAP, TIGAR, and β-actin in tumor tissues of various groups by WB. h Immunohistochemistry analysis of the levels of γ-H2AX, TIGAR, and Ki-67 in various groups of tumor tissues. β-actin was used as a loading control. * P  
    Antibody Against Tigar, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antibody against tigar/product/Millipore
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    antibody against tigar - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    85
    PRO Scientific anti human tigar antibody
    Knockdown of <t>TIGAR</t> enhanced the anticancer effect of aescin in vivo. a The infection efficiency analysis of HCT-116 cells by fluorescence microscopy. Cells were infected with vector or <t>EGFP-LV-shRNA-TIGAR</t> (MOI = 10). b The levels of TIGAR and β-actin in NC and three clones by WB. Three clones (1#, 2#, and 3#) were selected in medium with 4 μg/mL puromycin for 2 weeks. c The mice ( n  = 6) with different sizes of tumors in right iliac fossa and the tumors that were dissected from various groups of mice. d The body weight of mice in various groups. e The comparison of tumor volumes in various groups. f Quantitative analysis of the tumor weight in various groups. g The levels of PRAP, TIGAR, and β-actin in tumor tissues of various groups by WB. h Immunohistochemistry analysis of the levels of γ-H2AX, TIGAR, and Ki-67 in various groups of tumor tissues. β-actin was used as a loading control. * P  
    Anti Human Tigar Antibody, supplied by PRO Scientific, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti human tigar antibody/product/PRO Scientific
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti human tigar antibody - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    90
    Santa Cruz Biotechnology antibodies mouse monoclonal anti tigar
    Rat HCC-derived cells (RH), unlike rat non tumorigenic hepatocytes (RNT) display high aerobic glycolytic activity, PPP activation and OXPHOS inhibition A. Measurements of extracellular acidification rate (ECAR, left) or of oxygen consumption rate (OCR, right) on monolayers of RNT and RH cells. Addition of D-Glucose, oligomycin, 2-Deoxy-D-glucose (right) and of oligomycin, FCCP, rotenone, and antimycin A (left) was carried out at the indicated times. B. Enhanced uptake of [ 3 H] glucose and lactate release in RH cells. C. Western immunoblots showing MCT4, GLUT1, HK II, G6PD, TRAP1 and <t>TIGAR</t> expression. PARP and <t>SDHA:</t> loading controls. D. Radioactive assays using [ 14 C]-glucose labeled in position C1 or in position C6 revealed an upregulation of CO 2 produced from PPP; * P
    Antibodies Mouse Monoclonal Anti Tigar, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antibodies mouse monoclonal anti tigar/product/Santa Cruz Biotechnology
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    antibodies mouse monoclonal anti tigar - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    91
    Merck KGaA anti tigar
    Rat HCC-derived cells (RH), unlike rat non tumorigenic hepatocytes (RNT) display high aerobic glycolytic activity, PPP activation and OXPHOS inhibition A. Measurements of extracellular acidification rate (ECAR, left) or of oxygen consumption rate (OCR, right) on monolayers of RNT and RH cells. Addition of D-Glucose, oligomycin, 2-Deoxy-D-glucose (right) and of oligomycin, FCCP, rotenone, and antimycin A (left) was carried out at the indicated times. B. Enhanced uptake of [ 3 H] glucose and lactate release in RH cells. C. Western immunoblots showing MCT4, GLUT1, HK II, G6PD, TRAP1 and <t>TIGAR</t> expression. PARP and <t>SDHA:</t> loading controls. D. Radioactive assays using [ 14 C]-glucose labeled in position C1 or in position C6 revealed an upregulation of CO 2 produced from PPP; * P
    Anti Tigar, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti tigar/product/Merck KGaA
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti tigar - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    92
    Santa Cruz Biotechnology monoclonal anti tigar g2 primary antibody
    Rat HCC-derived cells (RH), unlike rat non tumorigenic hepatocytes (RNT) display high aerobic glycolytic activity, PPP activation and OXPHOS inhibition A. Measurements of extracellular acidification rate (ECAR, left) or of oxygen consumption rate (OCR, right) on monolayers of RNT and RH cells. Addition of D-Glucose, oligomycin, 2-Deoxy-D-glucose (right) and of oligomycin, FCCP, rotenone, and antimycin A (left) was carried out at the indicated times. B. Enhanced uptake of [ 3 H] glucose and lactate release in RH cells. C. Western immunoblots showing MCT4, GLUT1, HK II, G6PD, TRAP1 and <t>TIGAR</t> expression. PARP and <t>SDHA:</t> loading controls. D. Radioactive assays using [ 14 C]-glucose labeled in position C1 or in position C6 revealed an upregulation of CO 2 produced from PPP; * P
    Monoclonal Anti Tigar G2 Primary Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/monoclonal anti tigar g2 primary antibody/product/Santa Cruz Biotechnology
    Average 92 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    monoclonal anti tigar g2 primary antibody - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    94
    PeproTech recombinant tigar
    <t>Tigar</t> -Deficiency-Induced Pro-migratory Phenotype Can Be Reduced by Antioxidant <t>NAC</t> In Vitro (A and B) Representative images (A) and quantification (B) of in vitro wound-scratch assay of CTR (C1–3) and TIGAR KO (K1–3) KFC PDAC cells with NAC (1 mM) or without (CTR, no treatment). ∗ p
    Recombinant Tigar, supplied by PeproTech, used in various techniques. Bioz Stars score: 94/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant tigar/product/PeproTech
    Average 94 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    recombinant tigar - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    85
    OriGene stable cell lines expressing tigar protein
    c-Met inhibitors, AM7 and SU11274, reduce <t>TIGAR</t> expression and cellular NADPH level, leading to apoptosis (A) Apoptosis of NPC cells is associated with p53 and TIGAR downregulation. for antibody sources). Similar results were obtained in 3 independent experiments. (B). AM7 induces dose-dependent reduction of intracellular NADPH in NPC cells. ) and normalized to total protein as μM/min/mg total protein. Percentage reduction of NADPH was calculated with reference to DMSO. Graph show percentage reduction of NADPH level of AM7-treated cells vs DMSO-treated cells (mean ± SEM, n=3). Similar results were obtained in 3 independent experiments. (C) A model c-Met TKI, SU11274 downregulates TIGAR and NADPH levels in NPC cells. HK1-LMP1 and CNE-2 cells were treated with SU11274 or DMSO in complete medium for 48h. Cellular NADPH production was determined as above. The expression levels of TIGAR and p53 were also shown. (D) Overexpression of TIGAR rescues NPC cells from both AM7- and SU11274-mediated growth inhibition. ). Upon confirmation of TIGAR overexpression (by Western blotting for TIGAR; Upper Panel) in these stable cell lines, puromycin selection was removed periodically. <t>Retrovirus-infected</t> stable cell lines from CNE-2 and HONE-1 origin were treated with AM7 (2μM) or SU11274 (5μM) or DMSO in 3% FBS for 72h. Effects of TIGAR overexpression on AM7- or SU11274-induced growth inhibition (as % growth inhibition vs DMSO control) was assayed by MTT assay and presented in the middle and lower panels, respectively. Similar results were obtained in 3 independent experiments.
    Stable Cell Lines Expressing Tigar Protein, supplied by OriGene, used in various techniques. Bioz Stars score: 85/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/stable cell lines expressing tigar protein/product/OriGene
    Average 85 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    stable cell lines expressing tigar protein - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    91
    BioVision escherichia coli
    c-Met inhibitors, AM7 and SU11274, reduce <t>TIGAR</t> expression and cellular NADPH level, leading to apoptosis (A) Apoptosis of NPC cells is associated with p53 and TIGAR downregulation. for antibody sources). Similar results were obtained in 3 independent experiments. (B). AM7 induces dose-dependent reduction of intracellular NADPH in NPC cells. ) and normalized to total protein as μM/min/mg total protein. Percentage reduction of NADPH was calculated with reference to DMSO. Graph show percentage reduction of NADPH level of AM7-treated cells vs DMSO-treated cells (mean ± SEM, n=3). Similar results were obtained in 3 independent experiments. (C) A model c-Met TKI, SU11274 downregulates TIGAR and NADPH levels in NPC cells. HK1-LMP1 and CNE-2 cells were treated with SU11274 or DMSO in complete medium for 48h. Cellular NADPH production was determined as above. The expression levels of TIGAR and p53 were also shown. (D) Overexpression of TIGAR rescues NPC cells from both AM7- and SU11274-mediated growth inhibition. ). Upon confirmation of TIGAR overexpression (by Western blotting for TIGAR; Upper Panel) in these stable cell lines, puromycin selection was removed periodically. <t>Retrovirus-infected</t> stable cell lines from CNE-2 and HONE-1 origin were treated with AM7 (2μM) or SU11274 (5μM) or DMSO in 3% FBS for 72h. Effects of TIGAR overexpression on AM7- or SU11274-induced growth inhibition (as % growth inhibition vs DMSO control) was assayed by MTT assay and presented in the middle and lower panels, respectively. Similar results were obtained in 3 independent experiments.
    Escherichia Coli, supplied by BioVision, used in various techniques. Bioz Stars score: 91/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli/product/BioVision
    Average 91 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    escherichia coli - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    Image Search Results


    Effect of TIGAR on markers of catabolism and NADPH in carcinoma cells. T47D cells and MDA-MB-231 cells overexpressing TIGAR and control cells were cultured and lysed and subjected to immunoblot analysis for TIGAR and MCT2 ( A ), MCT2 mRNA expression as -fold change relative to control ( B ), LDHB protein expression ( C ), GLS1 protein expression ( D ), and GLUL (glutamate ammonia ligase) protein expression in T47D cells ( E ), NADP + /NADPH ratio in T47D and MDA-MB-231 cells ( F and G ) .

    Journal: The Journal of Biological Chemistry

    Article Title: TP53-inducible Glycolysis and Apoptosis Regulator (TIGAR) Metabolically Reprograms Carcinoma and Stromal Cells in Breast Cancer *

    doi: 10.1074/jbc.M116.740209

    Figure Lengend Snippet: Effect of TIGAR on markers of catabolism and NADPH in carcinoma cells. T47D cells and MDA-MB-231 cells overexpressing TIGAR and control cells were cultured and lysed and subjected to immunoblot analysis for TIGAR and MCT2 ( A ), MCT2 mRNA expression as -fold change relative to control ( B ), LDHB protein expression ( C ), GLS1 protein expression ( D ), and GLUL (glutamate ammonia ligase) protein expression in T47D cells ( E ), NADP + /NADPH ratio in T47D and MDA-MB-231 cells ( F and G ) .

    Article Snippet: Materials were obtained as follows: NADP/NADPH quantification colorimetric kit (BioVision K347-100), Click-iT® EdU Flow Cytometry Assay kit (Life Technologies ), lactate assay kit (EnzyChrom™ ECLC-100), quinacrine dihydrochloride (Sigma, Q3251), 3PO (EMD 525330), doxycycline (Sigma, D9891), metformin (Sigma D150959), ABT-199 (Selleck Chemicals, S8048), TIGAR and PFKFB3 primers (Hs00608644 and Hs00190079, Applied Biosystems), and MCT2 primers (forward sequence, GGTGATAGCAGGAGGCTTATT, and reverse sequence, GTTGCAGGTTGAAGGCTAAAC) (GeneCopoeia).

    Techniques: Multiple Displacement Amplification, Cell Culture, Expressing

    Effect of TIGAR on glycolysis and MCT1 in carcinoma cells. A , glucose uptake in TIGAR overexpressing carcinoma cells in coculture. RFP-tagged fibroblasts were cocultured with T47D cells either overexpressing TIGAR or control T47D cells. NBDG uptake in T47D cells was measured by flow cytometry. B , lactate production in TIGAR overexpressing carcinoma cells. Lactate production in T47D cells was measured and normalized to cell number. C , lactate production in HA-TOMM20-overexpressing carcinoma cells. Lactate production in MCF7 cells was measured and normalized to cell number. D , MCF7-overexpressing TIGAR and control T47D cells were cultured and lysed and subjected to immunoblot analysis for MCT1. MCF7 with TIGAR down-regulation and control cells using CRISPR-Cas9 were cultured and lysed and subjected to immunoblot for TIGAR ( E ) and MCT1 ( F ).

    Journal: The Journal of Biological Chemistry

    Article Title: TP53-inducible Glycolysis and Apoptosis Regulator (TIGAR) Metabolically Reprograms Carcinoma and Stromal Cells in Breast Cancer *

    doi: 10.1074/jbc.M116.740209

    Figure Lengend Snippet: Effect of TIGAR on glycolysis and MCT1 in carcinoma cells. A , glucose uptake in TIGAR overexpressing carcinoma cells in coculture. RFP-tagged fibroblasts were cocultured with T47D cells either overexpressing TIGAR or control T47D cells. NBDG uptake in T47D cells was measured by flow cytometry. B , lactate production in TIGAR overexpressing carcinoma cells. Lactate production in T47D cells was measured and normalized to cell number. C , lactate production in HA-TOMM20-overexpressing carcinoma cells. Lactate production in MCF7 cells was measured and normalized to cell number. D , MCF7-overexpressing TIGAR and control T47D cells were cultured and lysed and subjected to immunoblot analysis for MCT1. MCF7 with TIGAR down-regulation and control cells using CRISPR-Cas9 were cultured and lysed and subjected to immunoblot for TIGAR ( E ) and MCT1 ( F ).

    Article Snippet: Materials were obtained as follows: NADP/NADPH quantification colorimetric kit (BioVision K347-100), Click-iT® EdU Flow Cytometry Assay kit (Life Technologies ), lactate assay kit (EnzyChrom™ ECLC-100), quinacrine dihydrochloride (Sigma, Q3251), 3PO (EMD 525330), doxycycline (Sigma, D9891), metformin (Sigma D150959), ABT-199 (Selleck Chemicals, S8048), TIGAR and PFKFB3 primers (Hs00608644 and Hs00190079, Applied Biosystems), and MCT2 primers (forward sequence, GGTGATAGCAGGAGGCTTATT, and reverse sequence, GTTGCAGGTTGAAGGCTAAAC) (GeneCopoeia).

    Techniques: Flow Cytometry, Cytometry, Cell Culture, CRISPR

    Effect of carcinoma TIGAR expression on fibroblast glycolysis. A , glucose uptake in fibroblasts cocultured with TIGAR-overexpressing carcinoma cells. RFP-tagged fibroblasts were cocultured with T47D cells either overexpressing TIGAR or control T47D cells. NBDG uptake was measured by flow cytometry. B and C , fibroblasts with a GFP tag were cocultured with T47D cells either overexpressing TIGAR or control vectors. Fibroblasts were then lysed and subjected to immunoblot analysis for PFKFB3 ( B ) and LDHA and LDHB ( C ). HIF1A luciferase reporter in fibroblasts in coculture with carcinoma cells overexpressing TIGAR or control vector. Coculture was performed in normoxia (21% O 2 ) or hypoxia (0.5% O 2 ) ( D ). E , glucose uptake in fibroblasts overexpressing TIGAR. Fluorescent 2-deoxyglucose uptake was measured by flow cytometry using 2-NBDG.

    Journal: The Journal of Biological Chemistry

    Article Title: TP53-inducible Glycolysis and Apoptosis Regulator (TIGAR) Metabolically Reprograms Carcinoma and Stromal Cells in Breast Cancer *

    doi: 10.1074/jbc.M116.740209

    Figure Lengend Snippet: Effect of carcinoma TIGAR expression on fibroblast glycolysis. A , glucose uptake in fibroblasts cocultured with TIGAR-overexpressing carcinoma cells. RFP-tagged fibroblasts were cocultured with T47D cells either overexpressing TIGAR or control T47D cells. NBDG uptake was measured by flow cytometry. B and C , fibroblasts with a GFP tag were cocultured with T47D cells either overexpressing TIGAR or control vectors. Fibroblasts were then lysed and subjected to immunoblot analysis for PFKFB3 ( B ) and LDHA and LDHB ( C ). HIF1A luciferase reporter in fibroblasts in coculture with carcinoma cells overexpressing TIGAR or control vector. Coculture was performed in normoxia (21% O 2 ) or hypoxia (0.5% O 2 ) ( D ). E , glucose uptake in fibroblasts overexpressing TIGAR. Fluorescent 2-deoxyglucose uptake was measured by flow cytometry using 2-NBDG.

    Article Snippet: Materials were obtained as follows: NADP/NADPH quantification colorimetric kit (BioVision K347-100), Click-iT® EdU Flow Cytometry Assay kit (Life Technologies ), lactate assay kit (EnzyChrom™ ECLC-100), quinacrine dihydrochloride (Sigma, Q3251), 3PO (EMD 525330), doxycycline (Sigma, D9891), metformin (Sigma D150959), ABT-199 (Selleck Chemicals, S8048), TIGAR and PFKFB3 primers (Hs00608644 and Hs00190079, Applied Biosystems), and MCT2 primers (forward sequence, GGTGATAGCAGGAGGCTTATT, and reverse sequence, GTTGCAGGTTGAAGGCTAAAC) (GeneCopoeia).

    Techniques: Expressing, Flow Cytometry, Cytometry, Luciferase, Plasmid Preparation

    Effect of TIGAR in carcinoma cells on orthotopic tumor growth and proliferation. A , Fru-2,6-P 2 levels. MDA-MB-231 cells overexpressing TIGAR or empty vector control were cultured, and Fru-2,6-P 2 levels were measured. B , tumor growth. MDA-MB-231 cells overexpressing TIGAR (MDA-MB-231-TIGAR) or empty vector control were injected into the mammary fat pad of nude mice. Tumor volume and weight were measured after resection at 4 weeks post-injection. C , TOMM20 expression. T47D tumors overexpressing TIGAR or empty vector control tumor sections were stained by immunohistochemistry for TOMM20. Original magnification is 40×. D , Fru-2,6-P 2 levels in T47D-TIGAR or control cells. E , tumor growth. T47D-TIGAR or control cells were injected into the mammary fat pad of nude mice. Tumor volume and weight were measured after resection at 4 weeks post-injection. F , proliferation rates. Mitotic figures in T47D tumors were quantified per high power field. G , Fru-2,6-P 2 levels. MCF7 cells overexpressing TIGAR or empty vector control were cultured, and Fru-2,6-P 2 levels were measured. H , tumor growth. MCF7-TIGAR or control cells were injected into the mammary fat pad of nude mice. Tumor volume and weight were measured after resection at 4 weeks post-injection. I , proliferation rates. Mitotic figures in MCF7 tumors were quantified per high power field.

    Journal: The Journal of Biological Chemistry

    Article Title: TP53-inducible Glycolysis and Apoptosis Regulator (TIGAR) Metabolically Reprograms Carcinoma and Stromal Cells in Breast Cancer *

    doi: 10.1074/jbc.M116.740209

    Figure Lengend Snippet: Effect of TIGAR in carcinoma cells on orthotopic tumor growth and proliferation. A , Fru-2,6-P 2 levels. MDA-MB-231 cells overexpressing TIGAR or empty vector control were cultured, and Fru-2,6-P 2 levels were measured. B , tumor growth. MDA-MB-231 cells overexpressing TIGAR (MDA-MB-231-TIGAR) or empty vector control were injected into the mammary fat pad of nude mice. Tumor volume and weight were measured after resection at 4 weeks post-injection. C , TOMM20 expression. T47D tumors overexpressing TIGAR or empty vector control tumor sections were stained by immunohistochemistry for TOMM20. Original magnification is 40×. D , Fru-2,6-P 2 levels in T47D-TIGAR or control cells. E , tumor growth. T47D-TIGAR or control cells were injected into the mammary fat pad of nude mice. Tumor volume and weight were measured after resection at 4 weeks post-injection. F , proliferation rates. Mitotic figures in T47D tumors were quantified per high power field. G , Fru-2,6-P 2 levels. MCF7 cells overexpressing TIGAR or empty vector control were cultured, and Fru-2,6-P 2 levels were measured. H , tumor growth. MCF7-TIGAR or control cells were injected into the mammary fat pad of nude mice. Tumor volume and weight were measured after resection at 4 weeks post-injection. I , proliferation rates. Mitotic figures in MCF7 tumors were quantified per high power field.

    Article Snippet: Materials were obtained as follows: NADP/NADPH quantification colorimetric kit (BioVision K347-100), Click-iT® EdU Flow Cytometry Assay kit (Life Technologies ), lactate assay kit (EnzyChrom™ ECLC-100), quinacrine dihydrochloride (Sigma, Q3251), 3PO (EMD 525330), doxycycline (Sigma, D9891), metformin (Sigma D150959), ABT-199 (Selleck Chemicals, S8048), TIGAR and PFKFB3 primers (Hs00608644 and Hs00190079, Applied Biosystems), and MCT2 primers (forward sequence, GGTGATAGCAGGAGGCTTATT, and reverse sequence, GTTGCAGGTTGAAGGCTAAAC) (GeneCopoeia).

    Techniques: Multiple Displacement Amplification, Plasmid Preparation, Cell Culture, Injection, Mouse Assay, Expressing, Staining, Immunohistochemistry

    TIGAR and BCL2, tumor growth with catalytically inactive TIGAR, and models of TIGAR effects on carcinoma and fibroblast cells. A , BCL2 expression. Tumor sections were stained by immunohistochemistry for BCL2. Original magnification is 40×. The percentage of cells with the strongest BCL2 protein expression was quantified by Aperio digital pathology (3+ intensity percentage). B , Fru-2,6-P 2 levels and tumor growth. MDA-MB-231 cells overexpressing triple mutant TIGAR with H11A/E102A/H198A mutations (MDA-MB-231-TIGAR-3M) or empty vector control were cultured, and Fru-2,6-P 2 levels were measured. MDA-MB-231 cells overexpressing triple mutant TIGAR (MDA-MB-231-TIGAR-3M) or empty vector control were injected into the mammary fat pad of nude mice. Tumor volume and weight were measured after resection at 4 weeks post-injection. No statistically significant change in volume or weight was noted between triple mutant TIGAR and control cells. C , a model is shown of how TIGAR expression in carcinoma cells reduces glycolysis, increases the pentose phosphate pathway activity, and increases mitochondrial oxidative phosphorylation. D , high TIGAR expression in carcinoma cells alters their metabolic state and induces cancer aggressiveness. Conversely, fibroblasts in proximity to carcinoma cells have reciprocal metabolic changes.

    Journal: The Journal of Biological Chemistry

    Article Title: TP53-inducible Glycolysis and Apoptosis Regulator (TIGAR) Metabolically Reprograms Carcinoma and Stromal Cells in Breast Cancer *

    doi: 10.1074/jbc.M116.740209

    Figure Lengend Snippet: TIGAR and BCL2, tumor growth with catalytically inactive TIGAR, and models of TIGAR effects on carcinoma and fibroblast cells. A , BCL2 expression. Tumor sections were stained by immunohistochemistry for BCL2. Original magnification is 40×. The percentage of cells with the strongest BCL2 protein expression was quantified by Aperio digital pathology (3+ intensity percentage). B , Fru-2,6-P 2 levels and tumor growth. MDA-MB-231 cells overexpressing triple mutant TIGAR with H11A/E102A/H198A mutations (MDA-MB-231-TIGAR-3M) or empty vector control were cultured, and Fru-2,6-P 2 levels were measured. MDA-MB-231 cells overexpressing triple mutant TIGAR (MDA-MB-231-TIGAR-3M) or empty vector control were injected into the mammary fat pad of nude mice. Tumor volume and weight were measured after resection at 4 weeks post-injection. No statistically significant change in volume or weight was noted between triple mutant TIGAR and control cells. C , a model is shown of how TIGAR expression in carcinoma cells reduces glycolysis, increases the pentose phosphate pathway activity, and increases mitochondrial oxidative phosphorylation. D , high TIGAR expression in carcinoma cells alters their metabolic state and induces cancer aggressiveness. Conversely, fibroblasts in proximity to carcinoma cells have reciprocal metabolic changes.

    Article Snippet: Materials were obtained as follows: NADP/NADPH quantification colorimetric kit (BioVision K347-100), Click-iT® EdU Flow Cytometry Assay kit (Life Technologies ), lactate assay kit (EnzyChrom™ ECLC-100), quinacrine dihydrochloride (Sigma, Q3251), 3PO (EMD 525330), doxycycline (Sigma, D9891), metformin (Sigma D150959), ABT-199 (Selleck Chemicals, S8048), TIGAR and PFKFB3 primers (Hs00608644 and Hs00190079, Applied Biosystems), and MCT2 primers (forward sequence, GGTGATAGCAGGAGGCTTATT, and reverse sequence, GTTGCAGGTTGAAGGCTAAAC) (GeneCopoeia).

    Techniques: Expressing, Staining, Immunohistochemistry, Multiple Displacement Amplification, Mutagenesis, Plasmid Preparation, Cell Culture, Injection, Mouse Assay, Activity Assay

    Effect of coculture with fibroblasts on proliferation and apoptosis of carcinoma cells. TIGAR and PFKFB3 mRNA in T47D ( A ) and MCF7 ( B ) cells in homotypic culture or coculture with fibroblasts. n.s. , not significant. C , MCF7 cells were cultured with fibroblasts using an insert and lysed and subjected to immunoblot analysis for TIGAR. D , DNA synthesis in carcinoma cells in homotypic culture or coculture with fibroblasts. T47D cells were cultured alone or in coculture with fibroblasts for 4 days. DNA synthesis was measured with EdU incorporation and the cell cycle was assessed in carcinoma cells in homotypic culture or coculture with fibroblasts. DNA synthesis was measured with EdU incorporation and ploidy assessment with propidium iodide. E , apoptosis in carcinoma cells in homotypic culture or coculture with fibroblasts. T47D cells were cultured alone or in coculture with fibroblasts for 4 days. Apoptosis was measured with annexin-V ( AnnV ) and propidium iodide (PI) staining. The percentage of apoptotic or dead T47D cells (annexin-V-positive and/or PI-positive) is shown.

    Journal: The Journal of Biological Chemistry

    Article Title: TP53-inducible Glycolysis and Apoptosis Regulator (TIGAR) Metabolically Reprograms Carcinoma and Stromal Cells in Breast Cancer *

    doi: 10.1074/jbc.M116.740209

    Figure Lengend Snippet: Effect of coculture with fibroblasts on proliferation and apoptosis of carcinoma cells. TIGAR and PFKFB3 mRNA in T47D ( A ) and MCF7 ( B ) cells in homotypic culture or coculture with fibroblasts. n.s. , not significant. C , MCF7 cells were cultured with fibroblasts using an insert and lysed and subjected to immunoblot analysis for TIGAR. D , DNA synthesis in carcinoma cells in homotypic culture or coculture with fibroblasts. T47D cells were cultured alone or in coculture with fibroblasts for 4 days. DNA synthesis was measured with EdU incorporation and the cell cycle was assessed in carcinoma cells in homotypic culture or coculture with fibroblasts. DNA synthesis was measured with EdU incorporation and ploidy assessment with propidium iodide. E , apoptosis in carcinoma cells in homotypic culture or coculture with fibroblasts. T47D cells were cultured alone or in coculture with fibroblasts for 4 days. Apoptosis was measured with annexin-V ( AnnV ) and propidium iodide (PI) staining. The percentage of apoptotic or dead T47D cells (annexin-V-positive and/or PI-positive) is shown.

    Article Snippet: Materials were obtained as follows: NADP/NADPH quantification colorimetric kit (BioVision K347-100), Click-iT® EdU Flow Cytometry Assay kit (Life Technologies ), lactate assay kit (EnzyChrom™ ECLC-100), quinacrine dihydrochloride (Sigma, Q3251), 3PO (EMD 525330), doxycycline (Sigma, D9891), metformin (Sigma D150959), ABT-199 (Selleck Chemicals, S8048), TIGAR and PFKFB3 primers (Hs00608644 and Hs00190079, Applied Biosystems), and MCT2 primers (forward sequence, GGTGATAGCAGGAGGCTTATT, and reverse sequence, GTTGCAGGTTGAAGGCTAAAC) (GeneCopoeia).

    Techniques: Cell Culture, DNA Synthesis, Staining

    Tigar Deficiency Promotes Activation of a Pro-migratory Erk Signaling (A) Western blot analysis of CTR and TIGAR KO KFC PDAC cells. pERK, ERK, TIGAR, and the loading control VINCULIN were detected on one blot, DUSP6 and the loading control VINCULIN (bottom) were detected on a separate parallel blot. (B and C) Phospho-ERK (pERK) staining (B) and quantification (C) of CTR and TIGAR KO KFC tumors. ∗ p

    Journal: Cancer Cell

    Article Title: Dynamic ROS Control by TIGAR Regulates the Initiation and Progression of Pancreatic Cancer

    doi: 10.1016/j.ccell.2019.12.012

    Figure Lengend Snippet: Tigar Deficiency Promotes Activation of a Pro-migratory Erk Signaling (A) Western blot analysis of CTR and TIGAR KO KFC PDAC cells. pERK, ERK, TIGAR, and the loading control VINCULIN were detected on one blot, DUSP6 and the loading control VINCULIN (bottom) were detected on a separate parallel blot. (B and C) Phospho-ERK (pERK) staining (B) and quantification (C) of CTR and TIGAR KO KFC tumors. ∗ p

    Article Snippet: For immunohistochemistry, primary antibodies used were anti-Ki67 (1:1000 Thermo Scientific SP6), anti-MDA (1:300, Abcam Ab6463), anti-TIGAR (1:500 Millipore AB10545), anti-phospho-ERK (Cell Signalling), anti-DUSP6 (1:300 Abcam Ab76310), anti-Snail (1:300 Cell Signalling #3879), anti-Slug (1:300 Cell Signalling #9585), anti-E-Cadherin (1:300 Cell Signalling), anti-Vimentin (1:300, Cell Signaling #5741), anti-Cytokeratin 19 (CK-19) (1:500, Abcam Ab52625).

    Techniques: Activation Assay, Western Blot, Staining

    Tigar -Deficiency-Induced Metastasis Can Be Decreased by Antioxidant NAC In Vivo Lung tissues from animals 2 weeks after tail vein injection of CTR and TIGAR KO PDAC KFC cell lines with and without NAC treatment (1 g/L drinking water; CTR, drinking water without NAC). (A and B) (A) H E staining of lung tissues and (B) quantification of tumor area in lung tissues. (C and D) DUSP6 staining (C) and quantification (D). (E and F) pERK staining (E) and quantification (F). (G and H) Ki67 staining (G) and percentage of Ki67-positive cells (H). (B,D,F,H) ∗ p

    Journal: Cancer Cell

    Article Title: Dynamic ROS Control by TIGAR Regulates the Initiation and Progression of Pancreatic Cancer

    doi: 10.1016/j.ccell.2019.12.012

    Figure Lengend Snippet: Tigar -Deficiency-Induced Metastasis Can Be Decreased by Antioxidant NAC In Vivo Lung tissues from animals 2 weeks after tail vein injection of CTR and TIGAR KO PDAC KFC cell lines with and without NAC treatment (1 g/L drinking water; CTR, drinking water without NAC). (A and B) (A) H E staining of lung tissues and (B) quantification of tumor area in lung tissues. (C and D) DUSP6 staining (C) and quantification (D). (E and F) pERK staining (E) and quantification (F). (G and H) Ki67 staining (G) and percentage of Ki67-positive cells (H). (B,D,F,H) ∗ p

    Article Snippet: For immunohistochemistry, primary antibodies used were anti-Ki67 (1:1000 Thermo Scientific SP6), anti-MDA (1:300, Abcam Ab6463), anti-TIGAR (1:500 Millipore AB10545), anti-phospho-ERK (Cell Signalling), anti-DUSP6 (1:300 Abcam Ab76310), anti-Snail (1:300 Cell Signalling #3879), anti-Slug (1:300 Cell Signalling #9585), anti-E-Cadherin (1:300 Cell Signalling), anti-Vimentin (1:300, Cell Signaling #5741), anti-Cytokeratin 19 (CK-19) (1:500, Abcam Ab52625).

    Techniques: In Vivo, Injection, Staining

    Activation of human CD3 + T cells increases PFKFB3 expression and intracellular F2,6BP. CD3 + T cells were isolated by negative selection and then plated at a final concentration of 1 x 10 6 cells/ml in the absence or presence of anti-CD3/anti-CD28-conjugated microbeads for 5, 10 and 24 hours. ( A ), PFKFB1-4 and TIGAR mRNA expression was determined using real-time RT-PCR analyses. ( B ), PFKFB2-4, TIGAR, CD69 and β-actin protein expression was determined by Western blot analyses. ( C ), Intracellular F2,6BP concentration was determined using a coupled enzyme assay. ( D ), Densitometric analysis of PFKFB2-4, TIGAR, CD69 and β-actin protein expression. Data are representative of three independent experiments. * p

    Journal: Journal of Translational Medicine

    Article Title: Small molecule inhibition of 6-phosphofructo-2-kinase suppresses t cell activation

    doi: 10.1186/1479-5876-10-95

    Figure Lengend Snippet: Activation of human CD3 + T cells increases PFKFB3 expression and intracellular F2,6BP. CD3 + T cells were isolated by negative selection and then plated at a final concentration of 1 x 10 6 cells/ml in the absence or presence of anti-CD3/anti-CD28-conjugated microbeads for 5, 10 and 24 hours. ( A ), PFKFB1-4 and TIGAR mRNA expression was determined using real-time RT-PCR analyses. ( B ), PFKFB2-4, TIGAR, CD69 and β-actin protein expression was determined by Western blot analyses. ( C ), Intracellular F2,6BP concentration was determined using a coupled enzyme assay. ( D ), Densitometric analysis of PFKFB2-4, TIGAR, CD69 and β-actin protein expression. Data are representative of three independent experiments. * p

    Article Snippet: After blocking in TBS-Tween 20 (0.1%) containing 5% milk, membranes were probed with anti-PFKFB3 and anti-PFKFB2 (both from Proteintech, Chicago, IL), anti-PFKFB4 (Epitomics, Burlingame, CA), anti-TIGAR (Abcam, Cambridge, MA), anti-CD69 (Novus Biologicals, Littleton, CO) or anti-β-actin (Sigma, St. Louis, MO) in TBS-Tween 20 (containing 2.5% milk).

    Techniques: Activation Assay, Expressing, Isolation, Selection, Concentration Assay, Quantitative RT-PCR, Western Blot, Enzymatic Assay

    TIGAR promotes tumorigenesis in nude mice. (A,B) A xenograft nude mouse model to evaluate the effects of TIGAR in vivo . TIGAR knockdown tumors were smaller in size than the control tumors. (C) Comparison of tumor weight. TIGAR knockdown tumors had less weight compared to controls. (D) Comparison of mouse weight. There is no significant difference between the two groups. (E) Western blot to detect the expression of Bcl2, cyclin D1, and TIGAR. TIGAR knockdown significantly decreased the expression levels of cyclinD1 and bcl-2 in vivo . (F) NADPH /NADP + assay to detect alterations of NADPH/NADP + in xenograft tumors. TIGAR knockdown significantly reduced the NADPH/NADP + ratios in vivo . * p

    Journal: Frontiers in Oncology

    Article Title: TIGAR Promotes Tumorigenesis and Protects Tumor Cells From Oxidative and Metabolic Stresses in Gastric Cancer

    doi: 10.3389/fonc.2019.01258

    Figure Lengend Snippet: TIGAR promotes tumorigenesis in nude mice. (A,B) A xenograft nude mouse model to evaluate the effects of TIGAR in vivo . TIGAR knockdown tumors were smaller in size than the control tumors. (C) Comparison of tumor weight. TIGAR knockdown tumors had less weight compared to controls. (D) Comparison of mouse weight. There is no significant difference between the two groups. (E) Western blot to detect the expression of Bcl2, cyclin D1, and TIGAR. TIGAR knockdown significantly decreased the expression levels of cyclinD1 and bcl-2 in vivo . (F) NADPH /NADP + assay to detect alterations of NADPH/NADP + in xenograft tumors. TIGAR knockdown significantly reduced the NADPH/NADP + ratios in vivo . * p

    Article Snippet: Samples were blocked with 4% (w/v) fat-free milk in PBS with 0.1% of Tween 20 (PBS/T), washed with PBS/T, and then incubated with primary antibodies for overnight at 4°C: TIGAR (1:2,000, Abcam, ab37910), Cyclin D1(1:1,000, SANTA CRUZ, F2513), BCL-2(1:1,000, CST, 2876.

    Techniques: Mouse Assay, In Vivo, Western Blot, Expressing

    TIGAR expression in the developing neocortex. a , b QPCR and western blot analysis of TIGAR in the mouse cerebral cortex during embryonic development. β-Actin was used as a control ( n = 6–8 per group; error bars represent the SEM; * p

    Journal: Cell Death & Disease

    Article Title: TIGAR promotes neural stem cell differentiation through acetyl-CoA-mediated histone acetylation

    doi: 10.1038/s41419-019-1434-3

    Figure Lengend Snippet: TIGAR expression in the developing neocortex. a , b QPCR and western blot analysis of TIGAR in the mouse cerebral cortex during embryonic development. β-Actin was used as a control ( n = 6–8 per group; error bars represent the SEM; * p

    Article Snippet: Primary antibodies were used at the following dilutions: rabbit anti-TIGAR (1:1000, ab37910; Abcam), rabbit anti-β-actin (1:2000, #4970; CST), mouse anti-Tuj1 (1:1000, #4466; CST), mouse anti-GFAP (1:1000, BA0056; Boster), mouse anti-GLUT1 (1:500, sc-377228; Santa), mouse anti-MCT1 (1:500, sc-365501; Santa), mouse anti-LDHA (1:500, sc-137243; Santa), mouse anti-LDHB (1:500, sc-100775; Santa), rabbit anti-H3K9ac (1:1000, #9649; CST), rabbit anti-H3K18ac (1:1000, #9675; CST), rabbit anti-H3K14ac (1:1000, #7627; CST), rabbit anti-H3K27ac (1:1000, #4353; CST), and rabbit anti-H3 (1:1000, #4499; CST).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Western Blot

    Inhibitory effect of melatonin on autophagy during low‐glucose stress. (A) TP53‐induced glycolysis and apoptosis regulator (TIGAR) mutation abolishes its inhibitory effect on low‐glucose stress‐induced autophagy. Endothelial cells transfected with mRFP‐GFP‐LC3 were subjected to low glucose for 24 h, and nuclei were stained with DAPI. (B) Quantification of data from (A) was analyzed by mean GFP‐LC3 and mRFP‐LC3 dots per cell from 3 independent experiments in which at least 120 cells were analyzed. The data are expressed as the mean ± SEM. ** P

    Journal: Journal of Pineal Research

    Article Title: Melatonin ameliorates hypoglycemic stress‐induced brain endothelial tight junction injury by inhibiting protein nitration of TP53‐induced glycolysis and apoptosis regulator, et al. Melatonin ameliorates hypoglycemic stress‐induced brain endothelial tight junction injury by inhibiting protein nitration of TP53‐induced glycolysis and apoptosis regulator

    doi: 10.1111/jpi.12440

    Figure Lengend Snippet: Inhibitory effect of melatonin on autophagy during low‐glucose stress. (A) TP53‐induced glycolysis and apoptosis regulator (TIGAR) mutation abolishes its inhibitory effect on low‐glucose stress‐induced autophagy. Endothelial cells transfected with mRFP‐GFP‐LC3 were subjected to low glucose for 24 h, and nuclei were stained with DAPI. (B) Quantification of data from (A) was analyzed by mean GFP‐LC3 and mRFP‐LC3 dots per cell from 3 independent experiments in which at least 120 cells were analyzed. The data are expressed as the mean ± SEM. ** P

    Article Snippet: The proteins were shifted to the PVDF membrane (IPVH00010; Millipore, Darmstadt, Germany) for 1 hour at 50 V. Membranes were blocked in 20 mmol/L Tris‐HCl (PH 7.4), 0.1% Tween 20 (TBS‐T) and 150 mmol/L NaCl containing 5% fat‐free milk for 1 hour and immunodetected with specific antibodies against TIGAR (1:2000, ab37910; Abcam, Cambridge, UK), LC3 (1:1000, 2775; Cell Signaling, Danvers, MA, USA), occludin (1:1000, 71‐1500; Invitrogen), nitrotyrosine (1:1000, 05‐233; Millipore) and β‐actin (1:5000, A5316; Sigma‐Aldrich).

    Techniques: Mutagenesis, Transfection, Staining

    Inhibitory effect of TP53‐induced glycolysis and apoptosis regulator (TIGAR) on autophagy during low‐glucose stress. (A) TIGAR overexpression inhibited the autophagy activation in cells following low‐glucose stress. LC3‐II levels were markedly reduced, whereas immunoblotting with ACTB showed equal amounts of loaded protein. Data are expressed as the mean ± SEM from 3 independent experiments. ** P

    Journal: Journal of Pineal Research

    Article Title: Melatonin ameliorates hypoglycemic stress‐induced brain endothelial tight junction injury by inhibiting protein nitration of TP53‐induced glycolysis and apoptosis regulator, et al. Melatonin ameliorates hypoglycemic stress‐induced brain endothelial tight junction injury by inhibiting protein nitration of TP53‐induced glycolysis and apoptosis regulator

    doi: 10.1111/jpi.12440

    Figure Lengend Snippet: Inhibitory effect of TP53‐induced glycolysis and apoptosis regulator (TIGAR) on autophagy during low‐glucose stress. (A) TIGAR overexpression inhibited the autophagy activation in cells following low‐glucose stress. LC3‐II levels were markedly reduced, whereas immunoblotting with ACTB showed equal amounts of loaded protein. Data are expressed as the mean ± SEM from 3 independent experiments. ** P

    Article Snippet: The proteins were shifted to the PVDF membrane (IPVH00010; Millipore, Darmstadt, Germany) for 1 hour at 50 V. Membranes were blocked in 20 mmol/L Tris‐HCl (PH 7.4), 0.1% Tween 20 (TBS‐T) and 150 mmol/L NaCl containing 5% fat‐free milk for 1 hour and immunodetected with specific antibodies against TIGAR (1:2000, ab37910; Abcam, Cambridge, UK), LC3 (1:1000, 2775; Cell Signaling, Danvers, MA, USA), occludin (1:1000, 71‐1500; Invitrogen), nitrotyrosine (1:1000, 05‐233; Millipore) and β‐actin (1:5000, A5316; Sigma‐Aldrich).

    Techniques: Over Expression, Activation Assay

    Hyperpolarized 13 C MR spectroscopy confirms that changes in lactate flux upon FX11 therapy are restricted to TP53 mutant xenografts

    Journal: Cancer research

    Article Title: Therapeutic targeting of the Warburg effect in pancreatic cancer relies on an absence of p53 function

    doi: 10.1158/0008-5472.CAN-15-0108

    Figure Lengend Snippet: Hyperpolarized 13 C MR spectroscopy confirms that changes in lactate flux upon FX11 therapy are restricted to TP53 mutant xenografts

    Article Snippet: Anti-TIGAR and anti-p53 antibodies (rabbit polyclonal to TIGAR, abcam, ab37910 and rabbit polyclonal to p53, abcam, ab4060) were used for TIGAR and p53 IHC, respectively.

    Techniques: Spectroscopy, Mutagenesis

    FX11 treatment induces apoptosis and inhibits tumor cell proliferation selectively in tumors with mutant TP53 status

    Journal: Cancer research

    Article Title: Therapeutic targeting of the Warburg effect in pancreatic cancer relies on an absence of p53 function

    doi: 10.1158/0008-5472.CAN-15-0108

    Figure Lengend Snippet: FX11 treatment induces apoptosis and inhibits tumor cell proliferation selectively in tumors with mutant TP53 status

    Article Snippet: Anti-TIGAR and anti-p53 antibodies (rabbit polyclonal to TIGAR, abcam, ab37910 and rabbit polyclonal to p53, abcam, ab4060) were used for TIGAR and p53 IHC, respectively.

    Techniques: Mutagenesis

    TIGAR expression is elevated in human pancreatic PDX with wild type TP53 compared to tumors with mutant TP53 status

    Journal: Cancer research

    Article Title: Therapeutic targeting of the Warburg effect in pancreatic cancer relies on an absence of p53 function

    doi: 10.1158/0008-5472.CAN-15-0108

    Figure Lengend Snippet: TIGAR expression is elevated in human pancreatic PDX with wild type TP53 compared to tumors with mutant TP53 status

    Article Snippet: Anti-TIGAR and anti-p53 antibodies (rabbit polyclonal to TIGAR, abcam, ab37910 and rabbit polyclonal to p53, abcam, ab4060) were used for TIGAR and p53 IHC, respectively.

    Techniques: Expressing, Mutagenesis

    FX11 treatment significantly reduces 18 F-FDG uptake in tumor with mutant TP53 status

    Journal: Cancer research

    Article Title: Therapeutic targeting of the Warburg effect in pancreatic cancer relies on an absence of p53 function

    doi: 10.1158/0008-5472.CAN-15-0108

    Figure Lengend Snippet: FX11 treatment significantly reduces 18 F-FDG uptake in tumor with mutant TP53 status

    Article Snippet: Anti-TIGAR and anti-p53 antibodies (rabbit polyclonal to TIGAR, abcam, ab37910 and rabbit polyclonal to p53, abcam, ab4060) were used for TIGAR and p53 IHC, respectively.

    Techniques: Mutagenesis

    TGF-β 1 activates mTOR and TIGAR. A) In human lung fibroblasts, TGF-β 1 inhibits LC3-II formation, even in the presence of IFN-γ which induces autophagy. B) TGF-β 1 is unable to inhibit LC3-II formation in presence of mTOR inhibitor rapamycin. C) TGF-β 1 is able to activate mTORC1 which results in increased phospho-S6 but this activation does not occur in the presence of rapamycin. D) TGF-β 1 appears to activate mTORC1 by activating upstream PI3K/AKT and treatment with PI3K inhibitor LY294002 prevents TGF-β 1 induced mTOR activation. E) Western blot of phospho-mTOR (Ser2448) showing increased phospho-mTOR with TGF-β 1 in fibroblasts and inhibition by rapamycin. F) Western blot of phospho-S6 from mouse lung tissue treated with bleomycin and rapamycin. G) Densitometry of blot from 4E. (*p = 0.03 for controls vs. bleomycin, **p = 0.003 for bleomycin vs rapamycin + bleomycin). H) phospho-S6 protein levels in human lung tissue is higher in IPF patients compared with COPD patients and healthy controls. I) TIGAR is induced by TGF-β 1 in fibroblasts in a dose-responsive manner. J) Western blot demonstrating TIGAR protein levels in lung homogenate from human tissue is higher in IPF patients compared with COPD patients and healthy controls.

    Journal: PLoS ONE

    Article Title: Autophagy in Idiopathic Pulmonary Fibrosis

    doi: 10.1371/journal.pone.0041394

    Figure Lengend Snippet: TGF-β 1 activates mTOR and TIGAR. A) In human lung fibroblasts, TGF-β 1 inhibits LC3-II formation, even in the presence of IFN-γ which induces autophagy. B) TGF-β 1 is unable to inhibit LC3-II formation in presence of mTOR inhibitor rapamycin. C) TGF-β 1 is able to activate mTORC1 which results in increased phospho-S6 but this activation does not occur in the presence of rapamycin. D) TGF-β 1 appears to activate mTORC1 by activating upstream PI3K/AKT and treatment with PI3K inhibitor LY294002 prevents TGF-β 1 induced mTOR activation. E) Western blot of phospho-mTOR (Ser2448) showing increased phospho-mTOR with TGF-β 1 in fibroblasts and inhibition by rapamycin. F) Western blot of phospho-S6 from mouse lung tissue treated with bleomycin and rapamycin. G) Densitometry of blot from 4E. (*p = 0.03 for controls vs. bleomycin, **p = 0.003 for bleomycin vs rapamycin + bleomycin). H) phospho-S6 protein levels in human lung tissue is higher in IPF patients compared with COPD patients and healthy controls. I) TIGAR is induced by TGF-β 1 in fibroblasts in a dose-responsive manner. J) Western blot demonstrating TIGAR protein levels in lung homogenate from human tissue is higher in IPF patients compared with COPD patients and healthy controls.

    Article Snippet: Primary antibodies used were phosphoS6, phospho-AKT (Ser473), mTOR, phospho-mTOR (Ser2448), Smad3, phospho-Smad3 (Cell Signaling Technology, Beverly, MA), LC3B, β-Actin, p62 (Sigma), α-SMA (SantaCruz Biotechnology), TIGAR (Abcam, Cambridge, MA).

    Techniques: Activation Assay, Western Blot, Inhibition

    CS knockdown induced EMT switch is reverted by p53 reactivation. (A) Western blotting of HIF-1 α expression in CS knockdown cells. Total proteins isolated from cells as indicated were blotted with antibodies for HIF-1α and β-actin. Proteins prepared from cells cultured in 1% O 2 for 24 h serves as positive control for hypoxic condition. (B) Western blotting of HDM2, p53, TIGAR, and SCO2 expression in CS knockdown cells. Total proteins isolated from indicated cells were blotted with antibodies as labeled. (C) Fluorescence imaging of stress fibers of CS knockdown cells treated with MG132. Cells were treated with 10 mM MG132 for 12 h and then stained with Alexa Fluor 488-conjugated phalloidin and DAPI. (D) Western blotting of HDM2, p53, TIGAR, and SCO2 proteins in CS knockdown cells treated with MG132. Cells as indicated were treated with 10 mM MG132 for 0, 6, and 12 h. Total protein extracts isolated from these cells were blotted with antibodies as indicated. (E) Morphological imaging of CS, HDM2, and CS/HDM2 knockdown cells. Cells with single CS, HDM2, or double CS/HDM2 knockdown as indicated were selected and imaged. (F) Western blotting of proteins involved in bioenergetic metabolism in single CS, HDM2, and double CS/HDM2 knockdown cells. Total protein extracts isolated from the indicated cells were blotted with antibodies as labeled. The level of β-actin serves as a loading control.

    Journal: Scientific Reports

    Article Title: Loss of the respiratory enzyme citrate synthase directly links the Warburg effect to tumor malignancy

    doi: 10.1038/srep00785

    Figure Lengend Snippet: CS knockdown induced EMT switch is reverted by p53 reactivation. (A) Western blotting of HIF-1 α expression in CS knockdown cells. Total proteins isolated from cells as indicated were blotted with antibodies for HIF-1α and β-actin. Proteins prepared from cells cultured in 1% O 2 for 24 h serves as positive control for hypoxic condition. (B) Western blotting of HDM2, p53, TIGAR, and SCO2 expression in CS knockdown cells. Total proteins isolated from indicated cells were blotted with antibodies as labeled. (C) Fluorescence imaging of stress fibers of CS knockdown cells treated with MG132. Cells were treated with 10 mM MG132 for 12 h and then stained with Alexa Fluor 488-conjugated phalloidin and DAPI. (D) Western blotting of HDM2, p53, TIGAR, and SCO2 proteins in CS knockdown cells treated with MG132. Cells as indicated were treated with 10 mM MG132 for 0, 6, and 12 h. Total protein extracts isolated from these cells were blotted with antibodies as indicated. (E) Morphological imaging of CS, HDM2, and CS/HDM2 knockdown cells. Cells with single CS, HDM2, or double CS/HDM2 knockdown as indicated were selected and imaged. (F) Western blotting of proteins involved in bioenergetic metabolism in single CS, HDM2, and double CS/HDM2 knockdown cells. Total protein extracts isolated from the indicated cells were blotted with antibodies as labeled. The level of β-actin serves as a loading control.

    Article Snippet: The blotted membranes were probed with mouse monoclonal antibodies specific for CS (D3G4, Chemicon International, Temecula, CA, USA), HDM2 (human MDM2, SMP14; Santa Cruz Biotechnology, Santa Cruz, CA, USA), p53 (DO-1, Santa Cruz Biotechnology), HK1 (G-1, Santa Cruz Biotechnology), β-actin (Sigma-Aldrich Chemical, Saint Louis, MO, USA), E-cadherin (BD Biosciences, San Jose, CA, USA), Vimentin (V9, Sigma-Aldrich Chemical), α-SMA (1A4, Sigma-Aldrich Chemical), Glut-3 (G-5, Santa Cruz Biotechnology), and MitoProfileA® Total OXPHOS Human WB Antibody Cocktail (ab110411, Abcan Inc, Cambridge, MA, USA); rabbit monoclonal antibody specific for AMPKα1 (Y365, Abcam), ERK1 (Y71, Epitomics, Burlingame, CA, USA) and p-ERK1 (pY187) (EP197Y, Epitomics); rabbit polyclonal antibodies specific for IDH3A (Aviva Systems Biology, San Diego, CA, USA), p-AMPKα1 (phospho Thr 172, Abcam), Snail (H-130, Santa Cruz Biotechnology), Twist (H-81, Santa Cruz Biotechnology), and Glut-1 (H-43; Santa Cruz Biotechnology); goat polyclonal antibodies specific for OGDH (α-KGD, C-20; Santa Cruz Biotechnology), HK2 (C-14, Santa Cruz Biotechnology), TIGAR (Y-20, Santa Cruz Biotechnology) and SCO2 (G-14, Santa Cruz Biotechnology); and sheep polyclonal antibody specific for LDH5 (LDH V, Abcam).

    Techniques: Western Blot, Expressing, Isolation, Cell Culture, Positive Control, Labeling, Fluorescence, Imaging, Staining

    Knockdown of TIGAR enhanced the anticancer effect of aescin in vivo. a The infection efficiency analysis of HCT-116 cells by fluorescence microscopy. Cells were infected with vector or EGFP-LV-shRNA-TIGAR (MOI = 10). b The levels of TIGAR and β-actin in NC and three clones by WB. Three clones (1#, 2#, and 3#) were selected in medium with 4 μg/mL puromycin for 2 weeks. c The mice ( n  = 6) with different sizes of tumors in right iliac fossa and the tumors that were dissected from various groups of mice. d The body weight of mice in various groups. e The comparison of tumor volumes in various groups. f Quantitative analysis of the tumor weight in various groups. g The levels of PRAP, TIGAR, and β-actin in tumor tissues of various groups by WB. h Immunohistochemistry analysis of the levels of γ-H2AX, TIGAR, and Ki-67 in various groups of tumor tissues. β-actin was used as a loading control. * P  

    Journal: Acta Pharmacologica Sinica

    Article Title: TIGAR knockdown enhanced the anticancer effect of aescin via regulating autophagy and apoptosis in colorectal cancer cells

    doi: 10.1038/s41401-018-0001-2

    Figure Lengend Snippet: Knockdown of TIGAR enhanced the anticancer effect of aescin in vivo. a The infection efficiency analysis of HCT-116 cells by fluorescence microscopy. Cells were infected with vector or EGFP-LV-shRNA-TIGAR (MOI = 10). b The levels of TIGAR and β-actin in NC and three clones by WB. Three clones (1#, 2#, and 3#) were selected in medium with 4 μg/mL puromycin for 2 weeks. c The mice ( n  = 6) with different sizes of tumors in right iliac fossa and the tumors that were dissected from various groups of mice. d The body weight of mice in various groups. e The comparison of tumor volumes in various groups. f Quantitative analysis of the tumor weight in various groups. g The levels of PRAP, TIGAR, and β-actin in tumor tissues of various groups by WB. h Immunohistochemistry analysis of the levels of γ-H2AX, TIGAR, and Ki-67 in various groups of tumor tissues. β-actin was used as a loading control. * P  

    Article Snippet: HCT-116 cells were infected with lentivirus of EGFP-LV-shRNA-TIGAR (TIGAR: 5′-GATTAGCAGCCAGTGTCTTAG-3′; Shanghai Genechem Co., Ltd., Shanghai, China) to inhibit the expression of TIGAR.

    Techniques: In Vivo, Infection, Fluorescence, Microscopy, Plasmid Preparation, shRNA, Clone Assay, Western Blot, Mouse Assay, Immunohistochemistry

    Aescin-activated autophagy and inhibition of autophagy and TIGAR exaggerated aescin-induced apoptosis. a , b The levels of LC3-I, LC3-II, and β-actin in HCT-116 cells by WB. Cells were treated with 0, 5, 10, 20, 40, and 80 μg/mL aescin for 12 h or treated with 40 μg/mL aescin for 0, 3, 6, 9, 12, and 24 h. c The levels of LC3-I, LC3-II, p62, and β-actin in HCT-116 cells by WB. Cells were treated with/without 100 nM Bafilomycin A1 (Baf. A1) and/or 40 μg/mL aescin for 12 h. d The levels of LC3-I, LC3-II, TIGAR, and β-actin in HCT-116 cells by WB. Cells were treated with or without 40 μg/mL aescin for 12 h after cells were transfected with TIGAR siRNA1 or TIGAR siRNA2 for 36 h. e FCM analysis of ROS in HCT-116 cells. Cells were treated with or without 40 μg/mL aescin for 12 h after cells were transfected with TIGAR siRNA1 for 36 h. f The levels of ATG5-ATG12 and β-actin in HCT-116 cells by WB. Cells were transfected with Scramble siRNA, ATG5 siRNA1, or ATG5 siRNA2 for 48 h. g , h The levels of PRAP, activated caspase-9, γ-H2AX, TIGAR, LC3-I, LC3-II, ATG5-ATG12, and β-actin in HCT-116 cells by WB. Cells were treated with 40 μg/mL aescin for 12 h after cells were transfected with TIGAR siRNA1 and/or ATG5 siRNA2 for 36 h ( g ). Cells were transfected with TIGAR siRNA1 for 36 h, then pretreated with 3-MA for 12 h before cells were treated with 40 μg/mL aescin for 12 h ( h ). β-actin was used as a loading control. The values are means ± SD from three independent experiments. ** P  

    Journal: Acta Pharmacologica Sinica

    Article Title: TIGAR knockdown enhanced the anticancer effect of aescin via regulating autophagy and apoptosis in colorectal cancer cells

    doi: 10.1038/s41401-018-0001-2

    Figure Lengend Snippet: Aescin-activated autophagy and inhibition of autophagy and TIGAR exaggerated aescin-induced apoptosis. a , b The levels of LC3-I, LC3-II, and β-actin in HCT-116 cells by WB. Cells were treated with 0, 5, 10, 20, 40, and 80 μg/mL aescin for 12 h or treated with 40 μg/mL aescin for 0, 3, 6, 9, 12, and 24 h. c The levels of LC3-I, LC3-II, p62, and β-actin in HCT-116 cells by WB. Cells were treated with/without 100 nM Bafilomycin A1 (Baf. A1) and/or 40 μg/mL aescin for 12 h. d The levels of LC3-I, LC3-II, TIGAR, and β-actin in HCT-116 cells by WB. Cells were treated with or without 40 μg/mL aescin for 12 h after cells were transfected with TIGAR siRNA1 or TIGAR siRNA2 for 36 h. e FCM analysis of ROS in HCT-116 cells. Cells were treated with or without 40 μg/mL aescin for 12 h after cells were transfected with TIGAR siRNA1 for 36 h. f The levels of ATG5-ATG12 and β-actin in HCT-116 cells by WB. Cells were transfected with Scramble siRNA, ATG5 siRNA1, or ATG5 siRNA2 for 48 h. g , h The levels of PRAP, activated caspase-9, γ-H2AX, TIGAR, LC3-I, LC3-II, ATG5-ATG12, and β-actin in HCT-116 cells by WB. Cells were treated with 40 μg/mL aescin for 12 h after cells were transfected with TIGAR siRNA1 and/or ATG5 siRNA2 for 36 h ( g ). Cells were transfected with TIGAR siRNA1 for 36 h, then pretreated with 3-MA for 12 h before cells were treated with 40 μg/mL aescin for 12 h ( h ). β-actin was used as a loading control. The values are means ± SD from three independent experiments. ** P  

    Article Snippet: HCT-116 cells were infected with lentivirus of EGFP-LV-shRNA-TIGAR (TIGAR: 5′-GATTAGCAGCCAGTGTCTTAG-3′; Shanghai Genechem Co., Ltd., Shanghai, China) to inhibit the expression of TIGAR.

    Techniques: Inhibition, Western Blot, Transfection

    Rat HCC-derived cells (RH), unlike rat non tumorigenic hepatocytes (RNT) display high aerobic glycolytic activity, PPP activation and OXPHOS inhibition A. Measurements of extracellular acidification rate (ECAR, left) or of oxygen consumption rate (OCR, right) on monolayers of RNT and RH cells. Addition of D-Glucose, oligomycin, 2-Deoxy-D-glucose (right) and of oligomycin, FCCP, rotenone, and antimycin A (left) was carried out at the indicated times. B. Enhanced uptake of [ 3 H] glucose and lactate release in RH cells. C. Western immunoblots showing MCT4, GLUT1, HK II, G6PD, TRAP1 and TIGAR expression. PARP and SDHA: loading controls. D. Radioactive assays using [ 14 C]-glucose labeled in position C1 or in position C6 revealed an upregulation of CO 2 produced from PPP; * P

    Journal: Oncotarget

    Article Title: Metabolic reprogramming identifies the most aggressive lesions at early phases of hepatic carcinogenesis

    doi: 10.18632/oncotarget.8632

    Figure Lengend Snippet: Rat HCC-derived cells (RH), unlike rat non tumorigenic hepatocytes (RNT) display high aerobic glycolytic activity, PPP activation and OXPHOS inhibition A. Measurements of extracellular acidification rate (ECAR, left) or of oxygen consumption rate (OCR, right) on monolayers of RNT and RH cells. Addition of D-Glucose, oligomycin, 2-Deoxy-D-glucose (right) and of oligomycin, FCCP, rotenone, and antimycin A (left) was carried out at the indicated times. B. Enhanced uptake of [ 3 H] glucose and lactate release in RH cells. C. Western immunoblots showing MCT4, GLUT1, HK II, G6PD, TRAP1 and TIGAR expression. PARP and SDHA: loading controls. D. Radioactive assays using [ 14 C]-glucose labeled in position C1 or in position C6 revealed an upregulation of CO 2 produced from PPP; * P

    Article Snippet: Antibodies Mouse monoclonal anti TIGAR and SDHA, goat polyclonal anti calnexin, actin and HK II, and rabbit polyclonal anti PARP, MCT4, G6PD and TOM20 antibodies were from Santa Cruz Biotechnology; rabbit polyclonal anti AIF and HIF1α antibodies were from Exalpha Biologicals and Novus Biologicals, respectively; rabbit polyclonal anti Citrate synthase and GLUT1 antibodies were from Abcam; mouse monoclonal anti GAPDH and TRAP1 antibodies were from Millipore and Becton Dickinson, respectively.

    Techniques: Derivative Assay, Activity Assay, Activation Assay, Inhibition, Western Blot, Expressing, Labeling, Produced

    Tigar -Deficiency-Induced Pro-migratory Phenotype Can Be Reduced by Antioxidant NAC In Vitro (A and B) Representative images (A) and quantification (B) of in vitro wound-scratch assay of CTR (C1–3) and TIGAR KO (K1–3) KFC PDAC cells with NAC (1 mM) or without (CTR, no treatment). ∗ p

    Journal: Cancer Cell

    Article Title: Dynamic ROS Control by TIGAR Regulates the Initiation and Progression of Pancreatic Cancer

    doi: 10.1016/j.ccell.2019.12.012

    Figure Lengend Snippet: Tigar -Deficiency-Induced Pro-migratory Phenotype Can Be Reduced by Antioxidant NAC In Vitro (A and B) Representative images (A) and quantification (B) of in vitro wound-scratch assay of CTR (C1–3) and TIGAR KO (K1–3) KFC PDAC cells with NAC (1 mM) or without (CTR, no treatment). ∗ p

    Article Snippet: Cell Death, ROS Measurement, and Western Blot Analysis Cell death was quantified using LIVE/DEAD Viability Kit (Molecular Probes) 18 hours after adriamycin (1μg/ml, Sigma) alone or with either NAC (1mM) or recombinant TIGAR (rTIGAR, 5μg/ml, Peprotech).

    Techniques: In Vitro, Wound Healing Assay

    Tigar -Deficiency-Induced Metastasis Can Be Decreased by Antioxidant NAC In Vivo Lung tissues from animals 2 weeks after tail vein injection of CTR and TIGAR KO PDAC KFC cell lines with and without NAC treatment (1 g/L drinking water; CTR, drinking water without NAC). (A and B) (A) H E staining of lung tissues and (B) quantification of tumor area in lung tissues. (C and D) DUSP6 staining (C) and quantification (D). (E and F) pERK staining (E) and quantification (F). (G and H) Ki67 staining (G) and percentage of Ki67-positive cells (H). (B,D,F,H) ∗ p

    Journal: Cancer Cell

    Article Title: Dynamic ROS Control by TIGAR Regulates the Initiation and Progression of Pancreatic Cancer

    doi: 10.1016/j.ccell.2019.12.012

    Figure Lengend Snippet: Tigar -Deficiency-Induced Metastasis Can Be Decreased by Antioxidant NAC In Vivo Lung tissues from animals 2 weeks after tail vein injection of CTR and TIGAR KO PDAC KFC cell lines with and without NAC treatment (1 g/L drinking water; CTR, drinking water without NAC). (A and B) (A) H E staining of lung tissues and (B) quantification of tumor area in lung tissues. (C and D) DUSP6 staining (C) and quantification (D). (E and F) pERK staining (E) and quantification (F). (G and H) Ki67 staining (G) and percentage of Ki67-positive cells (H). (B,D,F,H) ∗ p

    Article Snippet: Cell Death, ROS Measurement, and Western Blot Analysis Cell death was quantified using LIVE/DEAD Viability Kit (Molecular Probes) 18 hours after adriamycin (1μg/ml, Sigma) alone or with either NAC (1mM) or recombinant TIGAR (rTIGAR, 5μg/ml, Peprotech).

    Techniques: In Vivo, Injection, Staining

    c-Met inhibitors, AM7 and SU11274, reduce TIGAR expression and cellular NADPH level, leading to apoptosis (A) Apoptosis of NPC cells is associated with p53 and TIGAR downregulation. for antibody sources). Similar results were obtained in 3 independent experiments. (B). AM7 induces dose-dependent reduction of intracellular NADPH in NPC cells. ) and normalized to total protein as μM/min/mg total protein. Percentage reduction of NADPH was calculated with reference to DMSO. Graph show percentage reduction of NADPH level of AM7-treated cells vs DMSO-treated cells (mean ± SEM, n=3). Similar results were obtained in 3 independent experiments. (C) A model c-Met TKI, SU11274 downregulates TIGAR and NADPH levels in NPC cells. HK1-LMP1 and CNE-2 cells were treated with SU11274 or DMSO in complete medium for 48h. Cellular NADPH production was determined as above. The expression levels of TIGAR and p53 were also shown. (D) Overexpression of TIGAR rescues NPC cells from both AM7- and SU11274-mediated growth inhibition. ). Upon confirmation of TIGAR overexpression (by Western blotting for TIGAR; Upper Panel) in these stable cell lines, puromycin selection was removed periodically. Retrovirus-infected stable cell lines from CNE-2 and HONE-1 origin were treated with AM7 (2μM) or SU11274 (5μM) or DMSO in 3% FBS for 72h. Effects of TIGAR overexpression on AM7- or SU11274-induced growth inhibition (as % growth inhibition vs DMSO control) was assayed by MTT assay and presented in the middle and lower panels, respectively. Similar results were obtained in 3 independent experiments.

    Journal: Oncogene

    Article Title: Inhibition of c-Met Downregulates TIGAR Expression and Reduces NADPH Production Leading to Cell Death

    doi: 10.1038/onc.2010.490

    Figure Lengend Snippet: c-Met inhibitors, AM7 and SU11274, reduce TIGAR expression and cellular NADPH level, leading to apoptosis (A) Apoptosis of NPC cells is associated with p53 and TIGAR downregulation. for antibody sources). Similar results were obtained in 3 independent experiments. (B). AM7 induces dose-dependent reduction of intracellular NADPH in NPC cells. ) and normalized to total protein as μM/min/mg total protein. Percentage reduction of NADPH was calculated with reference to DMSO. Graph show percentage reduction of NADPH level of AM7-treated cells vs DMSO-treated cells (mean ± SEM, n=3). Similar results were obtained in 3 independent experiments. (C) A model c-Met TKI, SU11274 downregulates TIGAR and NADPH levels in NPC cells. HK1-LMP1 and CNE-2 cells were treated with SU11274 or DMSO in complete medium for 48h. Cellular NADPH production was determined as above. The expression levels of TIGAR and p53 were also shown. (D) Overexpression of TIGAR rescues NPC cells from both AM7- and SU11274-mediated growth inhibition. ). Upon confirmation of TIGAR overexpression (by Western blotting for TIGAR; Upper Panel) in these stable cell lines, puromycin selection was removed periodically. Retrovirus-infected stable cell lines from CNE-2 and HONE-1 origin were treated with AM7 (2μM) or SU11274 (5μM) or DMSO in 3% FBS for 72h. Effects of TIGAR overexpression on AM7- or SU11274-induced growth inhibition (as % growth inhibition vs DMSO control) was assayed by MTT assay and presented in the middle and lower panels, respectively. Similar results were obtained in 3 independent experiments.

    Article Snippet: Using retrovirus infection, we generated stable cell lines expressing TIGAR protein (human TIGAR gene construct was purchased from Origene, USA) ( ).

    Techniques: Expressing, Over Expression, Inhibition, Western Blot, Stable Transfection, Selection, Infection, MTT Assay