template dna Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore dna template
    <t>Dps</t> compacts the nucleoid in stationary-phase E. coli . ( A ) Schematic of the structure of <t>DNA</t> in a wild-type cell during stationary phase. Dps condenses the cellular DNA. ( B ) In Δ dps cells, Dps-mediated DNA compaction cannot occur. ( C, D ) Fluorescence images of the nucleoid from wild-type and Δ dps cells stained with Hoechst 33258 (cyan) were superimposed onto phase-contrast images of the same cells (black on red) grown for (C) 24 hours or (D) 96 hours. ( E ) Ratios of nucleoid length to cell length, extracted from fluorescence images ( n = 133 - 208 .
    Dna Template, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1390 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna template/product/Millipore
    Average 99 stars, based on 1390 article reviews
    Price from $9.99 to $1999.99
    dna template - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    99
    Millipore dna olio templates
    Experimental design and SPR sensorgrams of HuR binding to <t>MYC</t> RNA in the presence or absence of annealed let-7M. ( A ) Schematic showing the arrangement of RNA bound to the surface of the biosensor chip in each flow cell across which HuR was flowed. ( B ) Top panel: sensorgram for HuR binding to MYC RNA immobilized on the chip surface. HuR (0–200 nM) was injected from 0 to 180 s otherwise buffer was flowing. The sensorgrams were referenced using a blank cell with only biotinylated <t>DNA</t> captured. Middle panel: sensorgram for HuR binding to MYC RNA with let-7M annealed prior to immobilization of MYC RNA on the chip surface. HuR (0–200 nM) was injected from 0 to 180 s otherwise buffer was flowing. Labels of low concentrations are omitted for clarity. The sensorgrams were referenced using a blank cell with only biotinylated DNA captured. Bottom panel: sensorgram for HuR binding to MYC RNA with let-7M annealed on the chip after MYC RNA immobilisation. HuR (0–200 nM) was injected from 0 to 180 s otherwise buffer was flowing. Labels of low concentrations are omitted for clarity. The sensorgrams were referenced using a blank cell with only biotinylated DNA captured.
    Dna Olio Templates, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna olio templates/product/Millipore
    Average 99 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    dna olio templates - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    Dps compacts the nucleoid in stationary-phase E. coli . ( A ) Schematic of the structure of DNA in a wild-type cell during stationary phase. Dps condenses the cellular DNA. ( B ) In Δ dps cells, Dps-mediated DNA compaction cannot occur. ( C, D ) Fluorescence images of the nucleoid from wild-type and Δ dps cells stained with Hoechst 33258 (cyan) were superimposed onto phase-contrast images of the same cells (black on red) grown for (C) 24 hours or (D) 96 hours. ( E ) Ratios of nucleoid length to cell length, extracted from fluorescence images ( n = 133 - 208 .

    Journal: Cell

    Article Title: Global DNA compaction in stationary-phase bacteria does not affect transcription

    doi: 10.1016/j.cell.2018.06.049

    Figure Lengend Snippet: Dps compacts the nucleoid in stationary-phase E. coli . ( A ) Schematic of the structure of DNA in a wild-type cell during stationary phase. Dps condenses the cellular DNA. ( B ) In Δ dps cells, Dps-mediated DNA compaction cannot occur. ( C, D ) Fluorescence images of the nucleoid from wild-type and Δ dps cells stained with Hoechst 33258 (cyan) were superimposed onto phase-contrast images of the same cells (black on red) grown for (C) 24 hours or (D) 96 hours. ( E ) Ratios of nucleoid length to cell length, extracted from fluorescence images ( n = 133 - 208 .

    Article Snippet: Dps and/or restriction enzymes were removed from the DNA template by adding a final concentration of 120 μg/mL Heparin (Sigma-Aldrich) to the samples and mixing.

    Techniques: Fluorescence, Staining

    Multiplexed single-molecule transcription-elongation assay and dwell time analysis of RNAP dynamics. ( A ) Schematics of the single-molecule in vitro transcriptional assay in the assisting force (AF) configuration, showing a single RNAP bound to a surface-attached DNA template in the presence of Dps. A magnetic bead was attached to the RNAP and exerted a constant force of 5 pN on the ternary complex. ( B ) The opposing force (OF) experimental configuration ( C ) Individual RNAP trajectories over time measured at 25 Hz via the change of the diffraction pattern of the attached magnetic bead (inset). The dashed rectangle depicts the trace region magnified in ( D ). Dwell times ( τ n .

    Journal: Cell

    Article Title: Global DNA compaction in stationary-phase bacteria does not affect transcription

    doi: 10.1016/j.cell.2018.06.049

    Figure Lengend Snippet: Multiplexed single-molecule transcription-elongation assay and dwell time analysis of RNAP dynamics. ( A ) Schematics of the single-molecule in vitro transcriptional assay in the assisting force (AF) configuration, showing a single RNAP bound to a surface-attached DNA template in the presence of Dps. A magnetic bead was attached to the RNAP and exerted a constant force of 5 pN on the ternary complex. ( B ) The opposing force (OF) experimental configuration ( C ) Individual RNAP trajectories over time measured at 25 Hz via the change of the diffraction pattern of the attached magnetic bead (inset). The dashed rectangle depicts the trace region magnified in ( D ). Dwell times ( τ n .

    Article Snippet: Dps and/or restriction enzymes were removed from the DNA template by adding a final concentration of 120 μg/mL Heparin (Sigma-Aldrich) to the samples and mixing.

    Techniques: Transcription‐elongation Assay, In Vitro, Transcription Factor Assay

    Dependence of transcription elongation dynamics on force and location of DNA:Dps complex. ( A ) Dwell time distributions for assisting force (AF) trajectories in the presence (red) and the absence (black) of 1 μM Dps at 20°C. ( B ) Dwell time distributions resulting from the opposing force (OF) experiments in the presence (blue) and the absence (black) of 1 μM Dps at 20°C. ( C ) Comparison of extracted RNAP elongation rates k for AF and OF experimental distributions shown in (A, B), determined by Galton distribution fits with an upper boundary of 1 s. ( D , E ) Calculated transcription pause probabilities (per 10 nt) for short (SP, D ) and long pauses (LP, E .

    Journal: Cell

    Article Title: Global DNA compaction in stationary-phase bacteria does not affect transcription

    doi: 10.1016/j.cell.2018.06.049

    Figure Lengend Snippet: Dependence of transcription elongation dynamics on force and location of DNA:Dps complex. ( A ) Dwell time distributions for assisting force (AF) trajectories in the presence (red) and the absence (black) of 1 μM Dps at 20°C. ( B ) Dwell time distributions resulting from the opposing force (OF) experiments in the presence (blue) and the absence (black) of 1 μM Dps at 20°C. ( C ) Comparison of extracted RNAP elongation rates k for AF and OF experimental distributions shown in (A, B), determined by Galton distribution fits with an upper boundary of 1 s. ( D , E ) Calculated transcription pause probabilities (per 10 nt) for short (SP, D ) and long pauses (LP, E .

    Article Snippet: Dps and/or restriction enzymes were removed from the DNA template by adding a final concentration of 120 μg/mL Heparin (Sigma-Aldrich) to the samples and mixing.

    Techniques:

    Dps allows RNAP to bind to promoters but excludes KpnI restriction enzyme from its target site. ( A ) Gel-shift analysis of Dps binding to linear promoter DNA fragments. The calculated K D . ( B ) Transcription initiation from the recA promoter. ( C ) Dps-mediated protection from DNA digestion. The vertical dashed lines in (B) and (C) indicate the K D of Dps for the different DNA templates shown in (A). The data in panels A-C are shown as mean ± SD from three biological replicates. ( D ) Wild-type, K8A, or K10A Dps proteins at 4 μM were bound to rec .

    Journal: Cell

    Article Title: Global DNA compaction in stationary-phase bacteria does not affect transcription

    doi: 10.1016/j.cell.2018.06.049

    Figure Lengend Snippet: Dps allows RNAP to bind to promoters but excludes KpnI restriction enzyme from its target site. ( A ) Gel-shift analysis of Dps binding to linear promoter DNA fragments. The calculated K D . ( B ) Transcription initiation from the recA promoter. ( C ) Dps-mediated protection from DNA digestion. The vertical dashed lines in (B) and (C) indicate the K D of Dps for the different DNA templates shown in (A). The data in panels A-C are shown as mean ± SD from three biological replicates. ( D ) Wild-type, K8A, or K10A Dps proteins at 4 μM were bound to rec .

    Article Snippet: Dps and/or restriction enzymes were removed from the DNA template by adding a final concentration of 120 μg/mL Heparin (Sigma-Aldrich) to the samples and mixing.

    Techniques: Electrophoretic Mobility Shift Assay, Binding Assay

    Seasonal fluctuations in DNA quantities or ascospore counts obtained by sampling airborne propagules collected over two autumns ( a , b ; 2002 and c , d ; 2006) periods on Melinex tapes of a Burkard 7-day volumetric air sampler located in Rothamsted Research, Harpenden, UK. Quantitative PCR assays detected avirulence alleles AvrLm1 ( a , c ; black line ), AvrLm6 ( a , c ; grey line ) or with primers based on β -tubulin ( b , d ; black line ) or e rg11 ( b , d ; grey line ) fragments in the propagules of Leptosphaeria maculans . Ascospore release patterns ( b , d ; dotted line ) were determined by light microscopic counts of Leptosphaeria -like ascospores per m 3 of air

    Journal: Journal of Applied Genetics

    Article Title: Molecular screening for avirulence alleles AvrLm1 and AvrLm6 in airborne inoculum of Leptosphaeria maculans and winter oilseed rape (Brassica napus) plants from Poland and the UK

    doi: 10.1007/s13353-014-0235-8

    Figure Lengend Snippet: Seasonal fluctuations in DNA quantities or ascospore counts obtained by sampling airborne propagules collected over two autumns ( a , b ; 2002 and c , d ; 2006) periods on Melinex tapes of a Burkard 7-day volumetric air sampler located in Rothamsted Research, Harpenden, UK. Quantitative PCR assays detected avirulence alleles AvrLm1 ( a , c ; black line ), AvrLm6 ( a , c ; grey line ) or with primers based on β -tubulin ( b , d ; black line ) or e rg11 ( b , d ; grey line ) fragments in the propagules of Leptosphaeria maculans . Ascospore release patterns ( b , d ; dotted line ) were determined by light microscopic counts of Leptosphaeria -like ascospores per m 3 of air

    Article Snippet: Quantitative PCR to assess proportions of DNA of each Leptosphaeria maculans in the spore samples For quantitative PCR, a standard 20-μL reaction contained 5 μL template DNA, 200 nM forward primer, 180 nM reverse primer (Mahuku et al. ; Liu et al. ), 10 μL SYBR Green JumpStart Taq ReadyMix (Sigma, UK), 0.08 μL ROX internal reference dye (Sigma, UK) and 3.78 μL nuclease-free, sterile water.

    Techniques: Sampling, Real-time Polymerase Chain Reaction

    Seasonal fluctuations in DNA quantities or ascospore counts obtained by sampling airborne propagules collected over two autumns ( a , b ; 2006 and c , d ; 2008) periods on Melinex tapes of a Burkard 7-day volumetric air sampler located in Poznan, Poland. Quantitative PCR assays detected avirulence alleles AvrLm1 ( a , c ; black line ), AvrLm6 ( a , c ; grey line ) or with primers based on β -tubulin ( b , d ; black line ) or e rg11 ( b , d ; grey line ) fragments in the propagules of Leptosphaeria maculans . Ascospore release patterns ( b , d ; dotted line ) were determined by light microscopic counts of Leptosphaeria -like ascospores per m 3 of air

    Journal: Journal of Applied Genetics

    Article Title: Molecular screening for avirulence alleles AvrLm1 and AvrLm6 in airborne inoculum of Leptosphaeria maculans and winter oilseed rape (Brassica napus) plants from Poland and the UK

    doi: 10.1007/s13353-014-0235-8

    Figure Lengend Snippet: Seasonal fluctuations in DNA quantities or ascospore counts obtained by sampling airborne propagules collected over two autumns ( a , b ; 2006 and c , d ; 2008) periods on Melinex tapes of a Burkard 7-day volumetric air sampler located in Poznan, Poland. Quantitative PCR assays detected avirulence alleles AvrLm1 ( a , c ; black line ), AvrLm6 ( a , c ; grey line ) or with primers based on β -tubulin ( b , d ; black line ) or e rg11 ( b , d ; grey line ) fragments in the propagules of Leptosphaeria maculans . Ascospore release patterns ( b , d ; dotted line ) were determined by light microscopic counts of Leptosphaeria -like ascospores per m 3 of air

    Article Snippet: Quantitative PCR to assess proportions of DNA of each Leptosphaeria maculans in the spore samples For quantitative PCR, a standard 20-μL reaction contained 5 μL template DNA, 200 nM forward primer, 180 nM reverse primer (Mahuku et al. ; Liu et al. ), 10 μL SYBR Green JumpStart Taq ReadyMix (Sigma, UK), 0.08 μL ROX internal reference dye (Sigma, UK) and 3.78 μL nuclease-free, sterile water.

    Techniques: Sampling, Real-time Polymerase Chain Reaction

    Cancer cells that have high clonogenic and cloning efficiency can undergo SD and ASD divisions (A) serial single cell cloning assay (SSCA) was set up as described in Methods. At each round, 180-wells were scored for monoclonal SD and ASD colony formation. (B) the morphology of single cell derived from LLC-SE in 96-well plate(top), bar=60um. And, the the morphology of stable symmetric division cell lines (LLC-SD) and asymmetric division cell lines (LLC-ASD) after 5 times SSCA of LLC-SE (bottom), bar=120um. (C) analysis of symmetric and asymmetric segregation of BrdU-labeled DNA during mitosis in LLC-SD and LLC-ASD. BrdU retention on day 7 after BrdU withdrawal in LLC-SD and LLC-ASD (top), bar=120um. Symmetric BrdU segregation between two daughter cells and asymmetric BrdU segregation between two daughter cells (bottom), bar=30um. (D) Quantification of SD and ASD cells in 100 dividing anaphase LLC-SD and LLC-ASD cells, respectively. (E) analysis of symmetric and asymmetric segregation of Numb in LLC-SD and LLC-ASD, bar=15um.

    Journal: Oncotarget

    Article Title: Comparison of tumor biology of two distinct cell sub-populations in lung cancer stem cells

    doi: 10.18632/oncotarget.18451

    Figure Lengend Snippet: Cancer cells that have high clonogenic and cloning efficiency can undergo SD and ASD divisions (A) serial single cell cloning assay (SSCA) was set up as described in Methods. At each round, 180-wells were scored for monoclonal SD and ASD colony formation. (B) the morphology of single cell derived from LLC-SE in 96-well plate(top), bar=60um. And, the the morphology of stable symmetric division cell lines (LLC-SD) and asymmetric division cell lines (LLC-ASD) after 5 times SSCA of LLC-SE (bottom), bar=120um. (C) analysis of symmetric and asymmetric segregation of BrdU-labeled DNA during mitosis in LLC-SD and LLC-ASD. BrdU retention on day 7 after BrdU withdrawal in LLC-SD and LLC-ASD (top), bar=120um. Symmetric BrdU segregation between two daughter cells and asymmetric BrdU segregation between two daughter cells (bottom), bar=30um. (D) Quantification of SD and ASD cells in 100 dividing anaphase LLC-SD and LLC-ASD cells, respectively. (E) analysis of symmetric and asymmetric segregation of Numb in LLC-SD and LLC-ASD, bar=15um.

    Article Snippet: BrdU-labeling, analysis of symmetric and asymmetrical chromosome segregation Labeling of DNA templates was achieved by the addition of 10μM BrdU (Sigma) to the culture medium for 7 days followed by BrdU withdrawal.

    Techniques: Clone Assay, Derivative Assay, Labeling

    SD and ASD cell lines could be obtained from human cancer cells MDA-MB-435 (A) the morphology of MDA-MB-435, MDA-MB-435-SE, MDA-MB-435-SD and MDA-MB-435-ASD, bar=120um. (B) the analysis of mRNA expression of embryonic stem cell markers (Oct4, Sox2, Nanog, Klf4 and c-Myc) in MDA-MB-435, MDA-MB-435-SE, MDA-MB-435-SD and MDA-MB-435-ASD, the tata-Box binding protein gene (Tbp) was reference gene. (C) Analysis of symmetric and asymmetric segregation of BrdU-labeled DNA during mitosis in MDA-MB-435-SD and MDA-MB-435-ASD. BrdU retention on day 6 after BrdU withdrawal in MDA-MB-435-SD (i) and MDA-MB-435-ASD (ii). (iii), #1 and #2: symmetric BrdU segregation between two daughter cells. #3: an adjacent BrdU-positive cell. (iv), asymmetric BrdU segregation between two daughter cells. (v) Quantification of SD and ASD cells in 100 dividing anaphase MDA-MB-435-SD and MDA-MB-435-ASD cells, respectively. Scale bars: 10 uM in (i-ii), 5 uM in (iii-iv). (D) asymmetric partitioning of Numb, in a pair of newly formed daughter cells in a dividing anaphase MDA-MB-435-ASD cell. (E) MDA-MB-435-SD exhibited significantly enhanced clonogeneicity and sphere-forming capability compared with corresponding MDA-MB-435, MDA-MB-435-SE and MDA-MB-435-ASD. a, b and c: different letters represent a significant difference, p

    Journal: Oncotarget

    Article Title: Comparison of tumor biology of two distinct cell sub-populations in lung cancer stem cells

    doi: 10.18632/oncotarget.18451

    Figure Lengend Snippet: SD and ASD cell lines could be obtained from human cancer cells MDA-MB-435 (A) the morphology of MDA-MB-435, MDA-MB-435-SE, MDA-MB-435-SD and MDA-MB-435-ASD, bar=120um. (B) the analysis of mRNA expression of embryonic stem cell markers (Oct4, Sox2, Nanog, Klf4 and c-Myc) in MDA-MB-435, MDA-MB-435-SE, MDA-MB-435-SD and MDA-MB-435-ASD, the tata-Box binding protein gene (Tbp) was reference gene. (C) Analysis of symmetric and asymmetric segregation of BrdU-labeled DNA during mitosis in MDA-MB-435-SD and MDA-MB-435-ASD. BrdU retention on day 6 after BrdU withdrawal in MDA-MB-435-SD (i) and MDA-MB-435-ASD (ii). (iii), #1 and #2: symmetric BrdU segregation between two daughter cells. #3: an adjacent BrdU-positive cell. (iv), asymmetric BrdU segregation between two daughter cells. (v) Quantification of SD and ASD cells in 100 dividing anaphase MDA-MB-435-SD and MDA-MB-435-ASD cells, respectively. Scale bars: 10 uM in (i-ii), 5 uM in (iii-iv). (D) asymmetric partitioning of Numb, in a pair of newly formed daughter cells in a dividing anaphase MDA-MB-435-ASD cell. (E) MDA-MB-435-SD exhibited significantly enhanced clonogeneicity and sphere-forming capability compared with corresponding MDA-MB-435, MDA-MB-435-SE and MDA-MB-435-ASD. a, b and c: different letters represent a significant difference, p

    Article Snippet: BrdU-labeling, analysis of symmetric and asymmetrical chromosome segregation Labeling of DNA templates was achieved by the addition of 10μM BrdU (Sigma) to the culture medium for 7 days followed by BrdU withdrawal.

    Techniques: Multiple Displacement Amplification, Expressing, Binding Assay, Labeling

    A) Overall view of RB69 gp43 exo - in complex with Gh containing DNA (Only one of the two complexes per asymmetric unit is shown). The DNA (shown as a stick model) lies in the polymerase active site (pol). The polymerase domains are colored in red for the palm, green for the thumb, blue for the fingers, cyan for the exo domain with the β hairpin in black and orange for the N-terminal domain. The sequence of the DNA oligonucleotide is shown. Close up view of Gh in the polymerase active site in the same orientation as A). Simulated annealing omit maps centered on the Gh lesion and contoured at 4.0 σ (B) and 3.0 σ (C) are shown (green). Although Gh is observed in the R configuration in both cases, the position of the guanidinium group above the hydantoin group differs in molecules A and B.

    Journal: Biochemistry

    Article Title: Crystal structure of a replicative DNA polymerase bound to the oxidized guanine lesion guanidinohydantoin

    doi: 10.1021/bi902195p

    Figure Lengend Snippet: A) Overall view of RB69 gp43 exo - in complex with Gh containing DNA (Only one of the two complexes per asymmetric unit is shown). The DNA (shown as a stick model) lies in the polymerase active site (pol). The polymerase domains are colored in red for the palm, green for the thumb, blue for the fingers, cyan for the exo domain with the β hairpin in black and orange for the N-terminal domain. The sequence of the DNA oligonucleotide is shown. Close up view of Gh in the polymerase active site in the same orientation as A). Simulated annealing omit maps centered on the Gh lesion and contoured at 4.0 σ (B) and 3.0 σ (C) are shown (green). Although Gh is observed in the R configuration in both cases, the position of the guanidinium group above the hydantoin group differs in molecules A and B.

    Article Snippet: The exonuclease deficient DNA polymerase (RB69 exo- ) was mixed in an equimolar ratio (0.1 mM) with annealed primer template DNA and 10 mM dideoxyATP (Sigma-Aldrich).

    Techniques: Sequencing

    Quantitative PCR results on BDA enrichment a , Primer and blocker sequences for enrichment of the non-pathogenic rs3789806 SNP. The reverse primer sequence is highlighted in yellow. The NA18537 genomic DNA (gDNA) sample bears the homozygous WT allele, and the NA18562 gDNA sample bears a homozygous SNP variant. The 4 A sequence at the 3′ end of the blocker serves as a termination sequence to prevent the blocker from being elongated by the Taq polymerase during PCR. b , Triplicate qPCR results for various mixtures of NA18562 and NA18537 with different variant allele fractions (VAFs). Each sample consisted of 400 ng gDNA in total (corresponding to 120,000 haploid copies), with the indicated VAF fraction as NA18562 and the remainder as NA18537 (for example, 1% VAF = 4 ng NA18562 and 396 ng NA18537). Experiments were performed using the Applied Biosystems PowerUP supermix using a 2-step protocol alternating 10 s at 95 °C and 30 s at 60 °C. c , A summary of threshold cycle (Ct) values for the results observed in b . Error bars show 1 standard deviation; 0.01% VAF data points are not included in linear fit. d for raw qPCR traces.

    Journal: Nature biomedical engineering

    Article Title: Multiplexed enrichment of rare DNA variants via sequence-selective and temperature-robust amplification

    doi: 10.1038/s41551-017-0126-5

    Figure Lengend Snippet: Quantitative PCR results on BDA enrichment a , Primer and blocker sequences for enrichment of the non-pathogenic rs3789806 SNP. The reverse primer sequence is highlighted in yellow. The NA18537 genomic DNA (gDNA) sample bears the homozygous WT allele, and the NA18562 gDNA sample bears a homozygous SNP variant. The 4 A sequence at the 3′ end of the blocker serves as a termination sequence to prevent the blocker from being elongated by the Taq polymerase during PCR. b , Triplicate qPCR results for various mixtures of NA18562 and NA18537 with different variant allele fractions (VAFs). Each sample consisted of 400 ng gDNA in total (corresponding to 120,000 haploid copies), with the indicated VAF fraction as NA18562 and the remainder as NA18537 (for example, 1% VAF = 4 ng NA18562 and 396 ng NA18537). Experiments were performed using the Applied Biosystems PowerUP supermix using a 2-step protocol alternating 10 s at 95 °C and 30 s at 60 °C. c , A summary of threshold cycle (Ct) values for the results observed in b . Error bars show 1 standard deviation; 0.01% VAF data points are not included in linear fit. d for raw qPCR traces.

    Article Snippet: Dilution of gDNA samples and synthetic DNA templates were made in 1× TE buffer with 0.1% TWEEN 20 (Sigma Aldrich).

    Techniques: Real-time Polymerase Chain Reaction, Sequencing, Variant Assay, Polymerase Chain Reaction, Standard Deviation

    Hotspot multiplexing a , Sanger sequencing verification that BDA enriches rare mutants. Experimental results on Horizon cell-free DNA (cfDNA) reference samples before and after BDA. Before BDA, the cancer mutation is not visible even at the 1% VAF level; after BDA, the cancer mutation is the dominant peak for both the 0.1% and 1% VAF samples. The 0% VAF samples still show the WT allele as the dominant peak after BDA enrichment, indicating that BDA has not spuriously introduced nonexistent variants. b , A single-plex BDA enriches 0.1% VAF of 5 KRAS mutants from cell-line gDNA; Sanger sequencing results of amplicon products confirm the enrichment of the appropriate mutant alleles. c for qPCR traces; Ct values are the median of triplicates. d , Variant disambiguation in qPCR setting using a blocker specific to the variant of interest. The simultaneous use of a WT blocker and a mutant blocker produces weak amplification (high Ct, red shading) when no incidental SNPs are present, but strong amplification (low Ct) if one or more incidental SNPs are present. Ct values shown are the median of triplicates.

    Journal: Nature biomedical engineering

    Article Title: Multiplexed enrichment of rare DNA variants via sequence-selective and temperature-robust amplification

    doi: 10.1038/s41551-017-0126-5

    Figure Lengend Snippet: Hotspot multiplexing a , Sanger sequencing verification that BDA enriches rare mutants. Experimental results on Horizon cell-free DNA (cfDNA) reference samples before and after BDA. Before BDA, the cancer mutation is not visible even at the 1% VAF level; after BDA, the cancer mutation is the dominant peak for both the 0.1% and 1% VAF samples. The 0% VAF samples still show the WT allele as the dominant peak after BDA enrichment, indicating that BDA has not spuriously introduced nonexistent variants. b , A single-plex BDA enriches 0.1% VAF of 5 KRAS mutants from cell-line gDNA; Sanger sequencing results of amplicon products confirm the enrichment of the appropriate mutant alleles. c for qPCR traces; Ct values are the median of triplicates. d , Variant disambiguation in qPCR setting using a blocker specific to the variant of interest. The simultaneous use of a WT blocker and a mutant blocker produces weak amplification (high Ct, red shading) when no incidental SNPs are present, but strong amplification (low Ct) if one or more incidental SNPs are present. Ct values shown are the median of triplicates.

    Article Snippet: Dilution of gDNA samples and synthetic DNA templates were made in 1× TE buffer with 0.1% TWEEN 20 (Sigma Aldrich).

    Techniques: Multiplexing, Sequencing, Mutagenesis, Amplification, Real-time Polymerase Chain Reaction, Variant Assay

    Experimental design and SPR sensorgrams of HuR binding to MYC RNA in the presence or absence of annealed let-7M. ( A ) Schematic showing the arrangement of RNA bound to the surface of the biosensor chip in each flow cell across which HuR was flowed. ( B ) Top panel: sensorgram for HuR binding to MYC RNA immobilized on the chip surface. HuR (0–200 nM) was injected from 0 to 180 s otherwise buffer was flowing. The sensorgrams were referenced using a blank cell with only biotinylated DNA captured. Middle panel: sensorgram for HuR binding to MYC RNA with let-7M annealed prior to immobilization of MYC RNA on the chip surface. HuR (0–200 nM) was injected from 0 to 180 s otherwise buffer was flowing. Labels of low concentrations are omitted for clarity. The sensorgrams were referenced using a blank cell with only biotinylated DNA captured. Bottom panel: sensorgram for HuR binding to MYC RNA with let-7M annealed on the chip after MYC RNA immobilisation. HuR (0–200 nM) was injected from 0 to 180 s otherwise buffer was flowing. Labels of low concentrations are omitted for clarity. The sensorgrams were referenced using a blank cell with only biotinylated DNA captured.

    Journal: Cell Cycle

    Article Title: Cooperative interplay of let-7 mimic and HuR with MYC RNA

    doi: 10.1080/15384101.2015.1069930

    Figure Lengend Snippet: Experimental design and SPR sensorgrams of HuR binding to MYC RNA in the presence or absence of annealed let-7M. ( A ) Schematic showing the arrangement of RNA bound to the surface of the biosensor chip in each flow cell across which HuR was flowed. ( B ) Top panel: sensorgram for HuR binding to MYC RNA immobilized on the chip surface. HuR (0–200 nM) was injected from 0 to 180 s otherwise buffer was flowing. The sensorgrams were referenced using a blank cell with only biotinylated DNA captured. Middle panel: sensorgram for HuR binding to MYC RNA with let-7M annealed prior to immobilization of MYC RNA on the chip surface. HuR (0–200 nM) was injected from 0 to 180 s otherwise buffer was flowing. Labels of low concentrations are omitted for clarity. The sensorgrams were referenced using a blank cell with only biotinylated DNA captured. Bottom panel: sensorgram for HuR binding to MYC RNA with let-7M annealed on the chip after MYC RNA immobilisation. HuR (0–200 nM) was injected from 0 to 180 s otherwise buffer was flowing. Labels of low concentrations are omitted for clarity. The sensorgrams were referenced using a blank cell with only biotinylated DNA captured.

    Article Snippet: Linearized DNA MYC template with T7 promoter site was generated using plasmid psiCHECK2 with MYC (1891–2146) insert (accession number ) (10 pg/μL) with primers 5′TAATACGACTCACTATAGGGTTTAGCCATAATGTAAACTG3′and 5′TTAAAAACAATTCTTAAATACAAATCTG3′ (80 nM each) with the addition of 0.2 mM dNTP, 4 mM MgCl2 , KOD DNA polymerase (Novagen) (0.016 mg/μL) in KOD reaction buffer 1 (Novagen) in a reaction volume of 25 μL.

    Techniques: SPR Assay, Binding Assay, Chromatin Immunoprecipitation, Flow Cytometry, Injection

    Co-IP of p12 with the viral genomic DNA and CA proteins. Lysates were prepared from NIH3T3 cells, infected with wt or 1xMycR viruses. To detect the viral genomic DNA (A and B) the lysates were incubated with anti-Myc (labeled ‘αMyc’), or control anti-Flag antibodies (labeled ‘αFlag’); both conjugated to protein G magnetic beads. Viral genomic DNA was PCR amplified from cell lysates (labeled ‘Input’) and from the magnetic beads (labeled ‘IP’) with MLV specific primers. After 25 and 30 cycles of amplification, the PCR products (875 bp long) were electrophoresed in 1% agarose gels containing ethidium bromide (A). ‘Mock’ indicates mock-infected NIH3T3 cells. Water and plasmid encoding the MLV genome (‘pNCS’) were used as negative and positive PCR controls, respectively. (B) The ‘Relative IP efficiency’ of the viral genomic DNA was quantified by qPCR ( Materials and Methods ) and is presented as the means ± the standard error of the means, obtained from three independent experiments. The qPCR values are presented in Fig. S7A . To test for CA immunoprecipitation (C), NIH3T3 were infected as in (A) and 15% of the indicated cell lysate was used to determine total CA levels (labeled ‘Cell Lysates’). The remaining lysates (labeled as in A) were used for IP with anti-Myc, or control anti-Flag monoclonal antibodies, bound to agarose beads. Cells exposed to medium with no virus served as a mock control. Pellets (labeled ‘IP’) and cell lysates were analyzed by Western Blot, using anti-CA polyclonal antibodies.

    Journal: PLoS Pathogens

    Article Title: The Gag Cleavage Product, p12, is a Functional Constituent of the Murine Leukemia Virus Pre-Integration Complex

    doi: 10.1371/journal.ppat.1001183

    Figure Lengend Snippet: Co-IP of p12 with the viral genomic DNA and CA proteins. Lysates were prepared from NIH3T3 cells, infected with wt or 1xMycR viruses. To detect the viral genomic DNA (A and B) the lysates were incubated with anti-Myc (labeled ‘αMyc’), or control anti-Flag antibodies (labeled ‘αFlag’); both conjugated to protein G magnetic beads. Viral genomic DNA was PCR amplified from cell lysates (labeled ‘Input’) and from the magnetic beads (labeled ‘IP’) with MLV specific primers. After 25 and 30 cycles of amplification, the PCR products (875 bp long) were electrophoresed in 1% agarose gels containing ethidium bromide (A). ‘Mock’ indicates mock-infected NIH3T3 cells. Water and plasmid encoding the MLV genome (‘pNCS’) were used as negative and positive PCR controls, respectively. (B) The ‘Relative IP efficiency’ of the viral genomic DNA was quantified by qPCR ( Materials and Methods ) and is presented as the means ± the standard error of the means, obtained from three independent experiments. The qPCR values are presented in Fig. S7A . To test for CA immunoprecipitation (C), NIH3T3 were infected as in (A) and 15% of the indicated cell lysate was used to determine total CA levels (labeled ‘Cell Lysates’). The remaining lysates (labeled as in A) were used for IP with anti-Myc, or control anti-Flag monoclonal antibodies, bound to agarose beads. Cells exposed to medium with no virus served as a mock control. Pellets (labeled ‘IP’) and cell lysates were analyzed by Western Blot, using anti-CA polyclonal antibodies.

    Article Snippet: The biotin-labeled probe was prepared in a nick-translation reaction (100 µl, 2 h at 16°C), containing nick-translation buffer (50 mM Tris-HCl pH 7.8, 5 mM MgCl2 ,50 ng/ml BSA), plasmid DNA template (pNCS, 2 µg), dATP, dGTP, dCTP (50 nM of each nucleotide, Sigma), and biotin-11-dUTP (50 nM, Roche), β-mercaptoethanol (10 mM), DNaseI (30 ng/ml, freshly diluted), Klenow polymerase (20 U, New England Biolabs).

    Techniques: Co-Immunoprecipitation Assay, Infection, Incubation, Labeling, Magnetic Beads, Polymerase Chain Reaction, Amplification, Plasmid Preparation, Real-time Polymerase Chain Reaction, Immunoprecipitation, Western Blot