taqman fast advanced master mix Thermo Fisher Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher taqman fast advanced master mix
    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for <t>Taqman</t> PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman <t>qPCR</t> assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.
    Taqman Fast Advanced Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 4941 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman fast advanced master mix/product/Thermo Fisher
    Average 90 stars, based on 4941 article reviews
    Price from $9.99 to $1999.99
    taqman fast advanced master mix - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher master mix
    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for <t>Taqman</t> PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman <t>qPCR</t> assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.
    Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 531 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/master mix/product/Thermo Fisher
    Average 99 stars, based on 531 article reviews
    Price from $9.99 to $1999.99
    master mix - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher taqman fast advanced master mix kit
    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for <t>Taqman</t> PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman <t>qPCR</t> assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.
    Taqman Fast Advanced Master Mix Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 63 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman fast advanced master mix kit/product/Thermo Fisher
    Average 99 stars, based on 63 article reviews
    Price from $9.99 to $1999.99
    taqman fast advanced master mix kit - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher taqman fast advanced master mix protocol
    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for <t>Taqman</t> PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman <t>qPCR</t> assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.
    Taqman Fast Advanced Master Mix Protocol, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 61 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman fast advanced master mix protocol/product/Thermo Fisher
    Average 99 stars, based on 61 article reviews
    Price from $9.99 to $1999.99
    taqman fast advanced master mix protocol - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    90
    Thermo Fisher taqman
    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for <t>Taqman</t> PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman <t>qPCR</t> assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.
    Taqman, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 14860 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman/product/Thermo Fisher
    Average 90 stars, based on 14860 article reviews
    Price from $9.99 to $1999.99
    taqman - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    87
    Thermo Fisher taqman fast advanced master mix virus
    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for <t>Taqman</t> PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman <t>qPCR</t> assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.
    Taqman Fast Advanced Master Mix Virus, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman fast advanced master mix virus/product/Thermo Fisher
    Average 87 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    taqman fast advanced master mix virus - by Bioz Stars, 2020-02
    87/100 stars
      Buy from Supplier

    90
    Thermo Fisher taqman gene expression master mix taqman fast advanced master mix
    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for <t>Taqman</t> PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman <t>qPCR</t> assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.
    Taqman Gene Expression Master Mix Taqman Fast Advanced Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman gene expression master mix taqman fast advanced master mix/product/Thermo Fisher
    Average 90 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    taqman gene expression master mix taqman fast advanced master mix - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher taqman gene expression assays
    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for <t>Taqman</t> PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman <t>qPCR</t> assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.
    Taqman Gene Expression Assays, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 37463 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman gene expression assays/product/Thermo Fisher
    Average 90 stars, based on 37463 article reviews
    Price from $9.99 to $1999.99
    taqman gene expression assays - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher pcr master mix
    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for <t>Taqman</t> PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman <t>qPCR</t> assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.
    Pcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 6635 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr master mix/product/Thermo Fisher
    Average 90 stars, based on 6635 article reviews
    Price from $9.99 to $1999.99
    pcr master mix - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher taqman fast advance pcr master mix
    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for <t>Taqman</t> PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman <t>qPCR</t> assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.
    Taqman Fast Advance Pcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman fast advance pcr master mix/product/Thermo Fisher
    Average 90 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    taqman fast advance pcr master mix - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher taqman primer probe
    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for <t>Taqman</t> PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman <t>qPCR</t> assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.
    Taqman Primer Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1846 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman primer probe/product/Thermo Fisher
    Average 99 stars, based on 1846 article reviews
    Price from $9.99 to $1999.99
    taqman primer probe - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    90
    Thermo Fisher taqman microrna reverse transcription kit
    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for <t>Taqman</t> PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman <t>qPCR</t> assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.
    Taqman Microrna Reverse Transcription Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 19256 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman microrna reverse transcription kit/product/Thermo Fisher
    Average 90 stars, based on 19256 article reviews
    Price from $9.99 to $1999.99
    taqman microrna reverse transcription kit - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    81
    Thermo Fisher gene exp nfkbia hs00355671 g1
    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for <t>Taqman</t> PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman <t>qPCR</t> assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.
    Gene Exp Nfkbia Hs00355671 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 81/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp nfkbia hs00355671 g1/product/Thermo Fisher
    Average 81 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    gene exp nfkbia hs00355671 g1 - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    99
    Thermo Fisher taqman primers
    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for <t>Taqman</t> PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman <t>qPCR</t> assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.
    Taqman Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 7479 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman primers/product/Thermo Fisher
    Average 99 stars, based on 7479 article reviews
    Price from $9.99 to $1999.99
    taqman primers - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    92
    Thermo Fisher gene exp lcn2 mm01324470 m1
    <t>LCN2</t> protects against UTI and causes loss of fitness in mutants of UPEC unable to use salmochelin, aerobactin, or yersiniabactin. Infection of C57BL/6 wild-type and Lcn2- deficient mice with nonpathogenic and LCN2-sensitive E. coli H9049 and competition
    Gene Exp Lcn2 Mm01324470 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 104 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp lcn2 mm01324470 m1/product/Thermo Fisher
    Average 92 stars, based on 104 article reviews
    Price from $9.99 to $1999.99
    gene exp lcn2 mm01324470 m1 - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    83
    Thermo Fisher gene exp apaf1 hs00559441 m1
    Relative luciferase activity following co-transfection of <t>Luc-APAF1-ctl,</t> Luc-APAF1-wt or Luc-APAF1-mt with miR-23a mimic or miR-23a inhibitor into SW480 cells. Luminescence values obtained from the transfected cells were background-subtracted with the non-transfected cells. Firefly/ Renilla luciferase activity was expressed as relative value against the respective negative control. Functional interaction between Luc-APAF1-wt and miR-23a mimic was depicted via the down-regulation of luciferase activity with respect to Luc-APAF1-ctl. Restoration of luciferase activity was observed in the co-transfection of Luc-APAF1-mt and miR-23a mimic with respect to Luc-APAF1-wt. Fold change below 1 indicates down-regulation. Data are presented as mean ± SEM ( n = 3). ** p
    Gene Exp Apaf1 Hs00559441 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 83/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp apaf1 hs00559441 m1/product/Thermo Fisher
    Average 83 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    gene exp apaf1 hs00559441 m1 - by Bioz Stars, 2020-02
    83/100 stars
      Buy from Supplier

    90
    Thermo Fisher steponeplus real time pcr system
    Relative luciferase activity following co-transfection of <t>Luc-APAF1-ctl,</t> Luc-APAF1-wt or Luc-APAF1-mt with miR-23a mimic or miR-23a inhibitor into SW480 cells. Luminescence values obtained from the transfected cells were background-subtracted with the non-transfected cells. Firefly/ Renilla luciferase activity was expressed as relative value against the respective negative control. Functional interaction between Luc-APAF1-wt and miR-23a mimic was depicted via the down-regulation of luciferase activity with respect to Luc-APAF1-ctl. Restoration of luciferase activity was observed in the co-transfection of Luc-APAF1-mt and miR-23a mimic with respect to Luc-APAF1-wt. Fold change below 1 indicates down-regulation. Data are presented as mean ± SEM ( n = 3). ** p
    Steponeplus Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 39878 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/steponeplus real time pcr system/product/Thermo Fisher
    Average 90 stars, based on 39878 article reviews
    Price from $9.99 to $1999.99
    steponeplus real time pcr system - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher quant studio 7 flex real time pcr system
    Relative luciferase activity following co-transfection of <t>Luc-APAF1-ctl,</t> Luc-APAF1-wt or Luc-APAF1-mt with miR-23a mimic or miR-23a inhibitor into SW480 cells. Luminescence values obtained from the transfected cells were background-subtracted with the non-transfected cells. Firefly/ Renilla luciferase activity was expressed as relative value against the respective negative control. Functional interaction between Luc-APAF1-wt and miR-23a mimic was depicted via the down-regulation of luciferase activity with respect to Luc-APAF1-ctl. Restoration of luciferase activity was observed in the co-transfection of Luc-APAF1-mt and miR-23a mimic with respect to Luc-APAF1-wt. Fold change below 1 indicates down-regulation. Data are presented as mean ± SEM ( n = 3). ** p
    Quant Studio 7 Flex Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 106 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quant studio 7 flex real time pcr system/product/Thermo Fisher
    Average 90 stars, based on 106 article reviews
    Price from $9.99 to $1999.99
    quant studio 7 flex real time pcr system - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for Taqman PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman qPCR assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.

    Journal: Scientific Reports

    Article Title: Exposure to galactic cosmic radiation compromises DNA repair and increases the potential for oncogenic chromosomal rearrangement in bronchial epithelial cells

    doi: 10.1038/s41598-018-29350-5

    Figure Lengend Snippet: Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for Taqman PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman qPCR assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.

    Article Snippet: For Taqman qPCR, reactions (20 μl) contained Taqman Fast Advanced Master Mix (Applied Biosystems), primers P1, d(CAGTTGTGTTGTTCAATTTTTAAGGT) and P2, d(CTGTGTTGCAAGTATAACCCC), and Taqman probe, d(CTTCCCTCCCTCCCTCGTTC).

    Techniques: Polymerase Chain Reaction, Hybridization, Amplification, Real-time Polymerase Chain Reaction, Irradiation, Fluorescence, Software

    Effect of irradiation on the frequency of Cas9/sgRNA-induced EML4-ALK rearrangement. ( A ) Effect of 108 keV/μm or 200 keV/μm 48 Ti on response to Cas9/sgRNA challenge. Triplicate cultures were irradiated as indicated, challenged by transduction with lentiviral Cas9/sgRNA vectors, and DNA was analysed by Taqman qPCR using RNase P as an internal standard. Significance was evaluated by ANOVA followed by 2-sided Dunnett t-tests *P

    Journal: Scientific Reports

    Article Title: Exposure to galactic cosmic radiation compromises DNA repair and increases the potential for oncogenic chromosomal rearrangement in bronchial epithelial cells

    doi: 10.1038/s41598-018-29350-5

    Figure Lengend Snippet: Effect of irradiation on the frequency of Cas9/sgRNA-induced EML4-ALK rearrangement. ( A ) Effect of 108 keV/μm or 200 keV/μm 48 Ti on response to Cas9/sgRNA challenge. Triplicate cultures were irradiated as indicated, challenged by transduction with lentiviral Cas9/sgRNA vectors, and DNA was analysed by Taqman qPCR using RNase P as an internal standard. Significance was evaluated by ANOVA followed by 2-sided Dunnett t-tests *P

    Article Snippet: For Taqman qPCR, reactions (20 μl) contained Taqman Fast Advanced Master Mix (Applied Biosystems), primers P1, d(CAGTTGTGTTGTTCAATTTTTAAGGT) and P2, d(CTGTGTTGCAAGTATAACCCC), and Taqman probe, d(CTTCCCTCCCTCCCTCGTTC).

    Techniques: Irradiation, Transduction, Real-time Polymerase Chain Reaction

    LCN2 protects against UTI and causes loss of fitness in mutants of UPEC unable to use salmochelin, aerobactin, or yersiniabactin. Infection of C57BL/6 wild-type and Lcn2- deficient mice with nonpathogenic and LCN2-sensitive E. coli H9049 and competition

    Journal: The Journal of Immunology Author Choice

    Article Title: Lipocalin 2 Imparts Selective Pressure on Bacterial Growth in the Bladder and Is Elevated in Women with Urinary Tract Infection

    doi: 10.4049/jimmunol.1401528

    Figure Lengend Snippet: LCN2 protects against UTI and causes loss of fitness in mutants of UPEC unable to use salmochelin, aerobactin, or yersiniabactin. Infection of C57BL/6 wild-type and Lcn2- deficient mice with nonpathogenic and LCN2-sensitive E. coli H9049 and competition

    Article Snippet: After cDNA synthesis (high-capacity reverse transcription kit, Applied Biosystems), quantitative real-time PCR was performed on a StepOnePlus PCR system using TaqMan fast advanced master mix and TaqMan gene expression assays (Applied Biosystems: LCN2 [Mm01324470_m1], LF [Mm00434787_m1], CXCL1 [Mm00433859_m1], CCL2 [Mm00441242_m1], IL-1β [Mm01336189_m1], IL-6 [Mm00446190_m1], TNF [Mm00443258_m1], IL-10 [Mm00439614_m1], IL-17a [Mm00439618_m1], and IL-22 (Mm01226722_g1]).

    Techniques: Infection, Mouse Assay

    LCN2 is expressed in epithelial cells and granulocytes of infected bladders. C57BL/6 wild-type mice were inoculated transurethrally with UPEC strain CFT073 for 1 d before bladders, ureters, and kidneys were analyzed. ( A ) H E and LCN2 immunohistological

    Journal: The Journal of Immunology Author Choice

    Article Title: Lipocalin 2 Imparts Selective Pressure on Bacterial Growth in the Bladder and Is Elevated in Women with Urinary Tract Infection

    doi: 10.4049/jimmunol.1401528

    Figure Lengend Snippet: LCN2 is expressed in epithelial cells and granulocytes of infected bladders. C57BL/6 wild-type mice were inoculated transurethrally with UPEC strain CFT073 for 1 d before bladders, ureters, and kidneys were analyzed. ( A ) H E and LCN2 immunohistological

    Article Snippet: After cDNA synthesis (high-capacity reverse transcription kit, Applied Biosystems), quantitative real-time PCR was performed on a StepOnePlus PCR system using TaqMan fast advanced master mix and TaqMan gene expression assays (Applied Biosystems: LCN2 [Mm01324470_m1], LF [Mm00434787_m1], CXCL1 [Mm00433859_m1], CCL2 [Mm00441242_m1], IL-1β [Mm01336189_m1], IL-6 [Mm00446190_m1], TNF [Mm00443258_m1], IL-10 [Mm00439614_m1], IL-17a [Mm00439618_m1], and IL-22 (Mm01226722_g1]).

    Techniques: Infection, Mouse Assay

    Expression of LCN2 evasive siderophores is associated with higher E. coli CFUs during cystitis episodes

    Journal: The Journal of Immunology Author Choice

    Article Title: Lipocalin 2 Imparts Selective Pressure on Bacterial Growth in the Bladder and Is Elevated in Women with Urinary Tract Infection

    doi: 10.4049/jimmunol.1401528

    Figure Lengend Snippet: Expression of LCN2 evasive siderophores is associated with higher E. coli CFUs during cystitis episodes

    Article Snippet: After cDNA synthesis (high-capacity reverse transcription kit, Applied Biosystems), quantitative real-time PCR was performed on a StepOnePlus PCR system using TaqMan fast advanced master mix and TaqMan gene expression assays (Applied Biosystems: LCN2 [Mm01324470_m1], LF [Mm00434787_m1], CXCL1 [Mm00433859_m1], CCL2 [Mm00441242_m1], IL-1β [Mm01336189_m1], IL-6 [Mm00446190_m1], TNF [Mm00443258_m1], IL-10 [Mm00439614_m1], IL-17a [Mm00439618_m1], and IL-22 (Mm01226722_g1]).

    Techniques: Expressing

    Onset of UTI is preceded by a rapid increase in urine LCN2 levels . Pairwise comparison is shown of LCN2 protein levels in urine samples from 14 patients taken 3 d prior to onset of UTI and at cystitis episodes (enrollment UTI or recurrent UTI during

    Journal: The Journal of Immunology Author Choice

    Article Title: Lipocalin 2 Imparts Selective Pressure on Bacterial Growth in the Bladder and Is Elevated in Women with Urinary Tract Infection

    doi: 10.4049/jimmunol.1401528

    Figure Lengend Snippet: Onset of UTI is preceded by a rapid increase in urine LCN2 levels . Pairwise comparison is shown of LCN2 protein levels in urine samples from 14 patients taken 3 d prior to onset of UTI and at cystitis episodes (enrollment UTI or recurrent UTI during

    Article Snippet: After cDNA synthesis (high-capacity reverse transcription kit, Applied Biosystems), quantitative real-time PCR was performed on a StepOnePlus PCR system using TaqMan fast advanced master mix and TaqMan gene expression assays (Applied Biosystems: LCN2 [Mm01324470_m1], LF [Mm00434787_m1], CXCL1 [Mm00433859_m1], CCL2 [Mm00441242_m1], IL-1β [Mm01336189_m1], IL-6 [Mm00446190_m1], TNF [Mm00443258_m1], IL-10 [Mm00439614_m1], IL-17a [Mm00439618_m1], and IL-22 (Mm01226722_g1]).

    Techniques:

    LCN2 is expressed in the urinary tract during UTI. C57BL/6 wild-type and Lcn2- deficient mice were transurethrally inoculated with UPEC strain CFT073 for the indicated period of time before bladders and kidneys were harvested and analyzed for transcript

    Journal: The Journal of Immunology Author Choice

    Article Title: Lipocalin 2 Imparts Selective Pressure on Bacterial Growth in the Bladder and Is Elevated in Women with Urinary Tract Infection

    doi: 10.4049/jimmunol.1401528

    Figure Lengend Snippet: LCN2 is expressed in the urinary tract during UTI. C57BL/6 wild-type and Lcn2- deficient mice were transurethrally inoculated with UPEC strain CFT073 for the indicated period of time before bladders and kidneys were harvested and analyzed for transcript

    Article Snippet: After cDNA synthesis (high-capacity reverse transcription kit, Applied Biosystems), quantitative real-time PCR was performed on a StepOnePlus PCR system using TaqMan fast advanced master mix and TaqMan gene expression assays (Applied Biosystems: LCN2 [Mm01324470_m1], LF [Mm00434787_m1], CXCL1 [Mm00433859_m1], CCL2 [Mm00441242_m1], IL-1β [Mm01336189_m1], IL-6 [Mm00446190_m1], TNF [Mm00443258_m1], IL-10 [Mm00439614_m1], IL-17a [Mm00439618_m1], and IL-22 (Mm01226722_g1]).

    Techniques: Mouse Assay

    LCN2 levels rise during cystitis episodes

    Journal: The Journal of Immunology Author Choice

    Article Title: Lipocalin 2 Imparts Selective Pressure on Bacterial Growth in the Bladder and Is Elevated in Women with Urinary Tract Infection

    doi: 10.4049/jimmunol.1401528

    Figure Lengend Snippet: LCN2 levels rise during cystitis episodes

    Article Snippet: After cDNA synthesis (high-capacity reverse transcription kit, Applied Biosystems), quantitative real-time PCR was performed on a StepOnePlus PCR system using TaqMan fast advanced master mix and TaqMan gene expression assays (Applied Biosystems: LCN2 [Mm01324470_m1], LF [Mm00434787_m1], CXCL1 [Mm00433859_m1], CCL2 [Mm00441242_m1], IL-1β [Mm01336189_m1], IL-6 [Mm00446190_m1], TNF [Mm00443258_m1], IL-10 [Mm00439614_m1], IL-17a [Mm00439618_m1], and IL-22 (Mm01226722_g1]).

    Techniques:

    Relative luciferase activity following co-transfection of Luc-APAF1-ctl, Luc-APAF1-wt or Luc-APAF1-mt with miR-23a mimic or miR-23a inhibitor into SW480 cells. Luminescence values obtained from the transfected cells were background-subtracted with the non-transfected cells. Firefly/ Renilla luciferase activity was expressed as relative value against the respective negative control. Functional interaction between Luc-APAF1-wt and miR-23a mimic was depicted via the down-regulation of luciferase activity with respect to Luc-APAF1-ctl. Restoration of luciferase activity was observed in the co-transfection of Luc-APAF1-mt and miR-23a mimic with respect to Luc-APAF1-wt. Fold change below 1 indicates down-regulation. Data are presented as mean ± SEM ( n = 3). ** p

    Journal: International Journal of Molecular Sciences

    Article Title: The Involvement of miR-23a/APAF1 Regulation Axis in Colorectal Cancer

    doi: 10.3390/ijms150711713

    Figure Lengend Snippet: Relative luciferase activity following co-transfection of Luc-APAF1-ctl, Luc-APAF1-wt or Luc-APAF1-mt with miR-23a mimic or miR-23a inhibitor into SW480 cells. Luminescence values obtained from the transfected cells were background-subtracted with the non-transfected cells. Firefly/ Renilla luciferase activity was expressed as relative value against the respective negative control. Functional interaction between Luc-APAF1-wt and miR-23a mimic was depicted via the down-regulation of luciferase activity with respect to Luc-APAF1-ctl. Restoration of luciferase activity was observed in the co-transfection of Luc-APAF1-mt and miR-23a mimic with respect to Luc-APAF1-wt. Fold change below 1 indicates down-regulation. Data are presented as mean ± SEM ( n = 3). ** p

    Article Snippet: Reverse transcription for APAF1 mRNA was performed using TaqMan reverse transcription reagents (Applied Biosystems, Carlsbad, CA, USA). qPCR was conducted on StepOnePlus real time PCR system using TaqMan fast advanced master mix and TaqMan APAF1 gene expression assay (Assay ID: Hs00559441_m1) (Applied Biosystems, Carlsbad, CA, USA). β-actin (Assay ID: Hs99999903_m1) was chosen as the endogenous control.

    Techniques: Luciferase, Activity Assay, Cotransfection, CTL Assay, Transfection, Negative Control, Functional Assay

    Relative APAF1 mRNA and protein expressions in SW480 and SW620 cell lines following miR-23a mimic, miR-23a inhibitor or negative controls transfections. The expression levels of APAF1 ( A ) mRNA and ( B ) protein were down-regulated in miR-23a mimic transfected cells and up-regulated in miR-23a inhibitor transfected cells. Fold change above 1 indicates up-regulation; and ( C ) the representative blots of APAF1 protein expression in SW480 and SW620 cells. β-actin was used as the loading control. Data are presented as mean ± SEM ( n = 3). * p

    Journal: International Journal of Molecular Sciences

    Article Title: The Involvement of miR-23a/APAF1 Regulation Axis in Colorectal Cancer

    doi: 10.3390/ijms150711713

    Figure Lengend Snippet: Relative APAF1 mRNA and protein expressions in SW480 and SW620 cell lines following miR-23a mimic, miR-23a inhibitor or negative controls transfections. The expression levels of APAF1 ( A ) mRNA and ( B ) protein were down-regulated in miR-23a mimic transfected cells and up-regulated in miR-23a inhibitor transfected cells. Fold change above 1 indicates up-regulation; and ( C ) the representative blots of APAF1 protein expression in SW480 and SW620 cells. β-actin was used as the loading control. Data are presented as mean ± SEM ( n = 3). * p

    Article Snippet: Reverse transcription for APAF1 mRNA was performed using TaqMan reverse transcription reagents (Applied Biosystems, Carlsbad, CA, USA). qPCR was conducted on StepOnePlus real time PCR system using TaqMan fast advanced master mix and TaqMan APAF1 gene expression assay (Assay ID: Hs00559441_m1) (Applied Biosystems, Carlsbad, CA, USA). β-actin (Assay ID: Hs99999903_m1) was chosen as the endogenous control.

    Techniques: Transfection, Expressing

    The involvement of p53 and miR-23a in the regulation of APAF1 in CRC. The up-regulation of miR-23a and the increased synthesis of mutated p53 protein lead to a decreased synthesis of APAF1 that interrupts the normal regulation of cell apoptosis.

    Journal: International Journal of Molecular Sciences

    Article Title: The Involvement of miR-23a/APAF1 Regulation Axis in Colorectal Cancer

    doi: 10.3390/ijms150711713

    Figure Lengend Snippet: The involvement of p53 and miR-23a in the regulation of APAF1 in CRC. The up-regulation of miR-23a and the increased synthesis of mutated p53 protein lead to a decreased synthesis of APAF1 that interrupts the normal regulation of cell apoptosis.

    Article Snippet: Reverse transcription for APAF1 mRNA was performed using TaqMan reverse transcription reagents (Applied Biosystems, Carlsbad, CA, USA). qPCR was conducted on StepOnePlus real time PCR system using TaqMan fast advanced master mix and TaqMan APAF1 gene expression assay (Assay ID: Hs00559441_m1) (Applied Biosystems, Carlsbad, CA, USA). β-actin (Assay ID: Hs99999903_m1) was chosen as the endogenous control.

    Techniques:

    ( A ) APAF1 expression was detected in the blood samples from healthy controls and CRC patients. A decreasing trend of expression was observed as the cancer progressed from stage I–II to stage III–IV tumors; ( B ) APAF1 mRNA and ( C ) protein expressions were detected in the paired cancer tissues. Relative expression is expressed as fold change of cancer tissue versus the adjacent normal mucosa. Fold change below 1 indicates down-regulation; ( D ) the representative blots of APAF1 protein expression in the normal mucosa N and cancer tissue C . β-actin was used as the loading control; ( E ) correlation graph for blood miR-23a and APAF1 mRNA; ( F ) correlation graph for tissue miR-23a and APAF1 mRNA; and ( G ) correlation graph for tissue miR-23a and APAF1 protein. Data are presented as mean ± SEM. * p

    Journal: International Journal of Molecular Sciences

    Article Title: The Involvement of miR-23a/APAF1 Regulation Axis in Colorectal Cancer

    doi: 10.3390/ijms150711713

    Figure Lengend Snippet: ( A ) APAF1 expression was detected in the blood samples from healthy controls and CRC patients. A decreasing trend of expression was observed as the cancer progressed from stage I–II to stage III–IV tumors; ( B ) APAF1 mRNA and ( C ) protein expressions were detected in the paired cancer tissues. Relative expression is expressed as fold change of cancer tissue versus the adjacent normal mucosa. Fold change below 1 indicates down-regulation; ( D ) the representative blots of APAF1 protein expression in the normal mucosa N and cancer tissue C . β-actin was used as the loading control; ( E ) correlation graph for blood miR-23a and APAF1 mRNA; ( F ) correlation graph for tissue miR-23a and APAF1 mRNA; and ( G ) correlation graph for tissue miR-23a and APAF1 protein. Data are presented as mean ± SEM. * p

    Article Snippet: Reverse transcription for APAF1 mRNA was performed using TaqMan reverse transcription reagents (Applied Biosystems, Carlsbad, CA, USA). qPCR was conducted on StepOnePlus real time PCR system using TaqMan fast advanced master mix and TaqMan APAF1 gene expression assay (Assay ID: Hs00559441_m1) (Applied Biosystems, Carlsbad, CA, USA). β-actin (Assay ID: Hs99999903_m1) was chosen as the endogenous control.

    Techniques: Expressing