t7 rna polymerase Roche Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    New England Biolabs t7 rna polymerase
    T7 Rna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 2850 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 rna polymerase/product/New England Biolabs
    Average 96 stars, based on 2850 article reviews
    Price from $9.99 to $1999.99
    t7 rna polymerase - by Bioz Stars, 2020-01
    96/100 stars
      Buy from Supplier

    92
    Millipore biotin rna labeling mixture
    Biotin Rna Labeling Mixture, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/biotin rna labeling mixture/product/Millipore
    Average 92 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    biotin rna labeling mixture - by Bioz Stars, 2020-01
    92/100 stars
      Buy from Supplier

    98
    Roche t7 rna polymerase
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    T7 Rna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 98/100, based on 6060 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 rna polymerase/product/Roche
    Average 98 stars, based on 6060 article reviews
    Price from $9.99 to $1999.99
    t7 rna polymerase - by Bioz Stars, 2020-01
    98/100 stars
      Buy from Supplier

    92
    Boehringer Mannheim t7 rna polymerase
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    T7 Rna Polymerase, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 92/100, based on 549 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 rna polymerase/product/Boehringer Mannheim
    Average 92 stars, based on 549 article reviews
    Price from $9.99 to $1999.99
    t7 rna polymerase - by Bioz Stars, 2020-01
    92/100 stars
      Buy from Supplier

    99
    Promega t7 rna polymerase
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    T7 Rna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 7983 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 rna polymerase/product/Promega
    Average 99 stars, based on 7983 article reviews
    Price from $9.99 to $1999.99
    t7 rna polymerase - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    98
    Roche t3 t7 rna polymerase
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    T3 T7 Rna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 98/100, based on 64 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t3 t7 rna polymerase/product/Roche
    Average 98 stars, based on 64 article reviews
    Price from $9.99 to $1999.99
    t3 t7 rna polymerase - by Bioz Stars, 2020-01
    98/100 stars
      Buy from Supplier

    79
    Roche simple • t7 rna polymerase
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    Simple • T7 Rna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 79/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/simple • t7 rna polymerase/product/Roche
    Average 79 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    simple • t7 rna polymerase - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    86
    Roche t7 rna polymerase kit
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    T7 Rna Polymerase Kit, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 rna polymerase kit/product/Roche
    Average 86 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    t7 rna polymerase kit - by Bioz Stars, 2020-01
    86/100 stars
      Buy from Supplier

    80
    Roche t7 rna polymerase transcription kit
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    T7 Rna Polymerase Transcription Kit, supplied by Roche, used in various techniques. Bioz Stars score: 80/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 rna polymerase transcription kit/product/Roche
    Average 80 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    t7 rna polymerase transcription kit - by Bioz Stars, 2020-01
    80/100 stars
      Buy from Supplier

    96
    Roche sp6 t7 rna polymerase
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    Sp6 T7 Rna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 49 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sp6 t7 rna polymerase/product/Roche
    Average 96 stars, based on 49 article reviews
    Price from $9.99 to $1999.99
    sp6 t7 rna polymerase - by Bioz Stars, 2020-01
    96/100 stars
      Buy from Supplier

    77
    Roche chimeric constructions employing t7 rna polymerase
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    Chimeric Constructions Employing T7 Rna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 77/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/chimeric constructions employing t7 rna polymerase/product/Roche
    Average 77 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    chimeric constructions employing t7 rna polymerase - by Bioz Stars, 2020-01
    77/100 stars
      Buy from Supplier

    80
    Roche t7 rna polymerase in vitro transcription reagents
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    T7 Rna Polymerase In Vitro Transcription Reagents, supplied by Roche, used in various techniques. Bioz Stars score: 80/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 rna polymerase in vitro transcription reagents/product/Roche
    Average 80 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    t7 rna polymerase in vitro transcription reagents - by Bioz Stars, 2020-01
    80/100 stars
      Buy from Supplier

    80
    Roche t7 antisense rna polymerases
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    T7 Antisense Rna Polymerases, supplied by Roche, used in various techniques. Bioz Stars score: 80/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 antisense rna polymerases/product/Roche
    Average 80 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    t7 antisense rna polymerases - by Bioz Stars, 2020-01
    80/100 stars
      Buy from Supplier

    80
    Roche t7 sp6 rna polymerases
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    T7 Sp6 Rna Polymerases, supplied by Roche, used in various techniques. Bioz Stars score: 80/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 sp6 rna polymerases/product/Roche
    Average 80 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    t7 sp6 rna polymerases - by Bioz Stars, 2020-01
    80/100 stars
      Buy from Supplier

    78
    Roche t7 pbluescriptsk rna polymerases
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    T7 Pbluescriptsk Rna Polymerases, supplied by Roche, used in various techniques. Bioz Stars score: 78/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 pbluescriptsk rna polymerases/product/Roche
    Average 78 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    t7 pbluescriptsk rna polymerases - by Bioz Stars, 2020-01
    78/100 stars
      Buy from Supplier

    99
    Roche dig rna labeling kit
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    Dig Rna Labeling Kit, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 4375 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dig rna labeling kit/product/Roche
    Average 99 stars, based on 4375 article reviews
    Price from $9.99 to $1999.99
    dig rna labeling kit - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    99
    Roche antisense probes
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    Antisense Probes, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 1925 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense probes/product/Roche
    Average 99 stars, based on 1925 article reviews
    Price from $9.99 to $1999.99
    antisense probes - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    99
    Roche dig northern starter kit
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    Dig Northern Starter Kit, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 1771 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dig northern starter kit/product/Roche
    Average 99 stars, based on 1771 article reviews
    Price from $9.99 to $1999.99
    dig northern starter kit - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    96
    Roche sp6 rna polymerase
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    Sp6 Rna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 2243 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sp6 rna polymerase/product/Roche
    Average 96 stars, based on 2243 article reviews
    Price from $9.99 to $1999.99
    sp6 rna polymerase - by Bioz Stars, 2020-01
    96/100 stars
      Buy from Supplier

    95
    Roche t3 rna polymerases
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    T3 Rna Polymerases, supplied by Roche, used in various techniques. Bioz Stars score: 95/100, based on 294 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t3 rna polymerases/product/Roche
    Average 95 stars, based on 294 article reviews
    Price from $9.99 to $1999.99
    t3 rna polymerases - by Bioz Stars, 2020-01
    95/100 stars
      Buy from Supplier

    99
    Roche sp6 t7 transcription kit
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    Sp6 T7 Transcription Kit, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 363 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sp6 t7 transcription kit/product/Roche
    Average 99 stars, based on 363 article reviews
    Price from $9.99 to $1999.99
    sp6 t7 transcription kit - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    77
    Roche sp6 rna polymerase kit
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    Sp6 Rna Polymerase Kit, supplied by Roche, used in various techniques. Bioz Stars score: 77/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sp6 rna polymerase kit/product/Roche
    Average 77 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    sp6 rna polymerase kit - by Bioz Stars, 2020-01
    77/100 stars
      Buy from Supplier

    76
    Roche t3 rna taq polymerase
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    T3 Rna Taq Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 76/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t3 rna taq polymerase/product/Roche
    Average 76 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    t3 rna taq polymerase - by Bioz Stars, 2020-01
    76/100 stars
      Buy from Supplier

    84
    Roche t7 dig rna labeling kit
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    T7 Dig Rna Labeling Kit, supplied by Roche, used in various techniques. Bioz Stars score: 84/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 dig rna labeling kit/product/Roche
    Average 84 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    t7 dig rna labeling kit - by Bioz Stars, 2020-01
    84/100 stars
      Buy from Supplier

    99
    Roche dig rna labeling kit sp6 t7
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    Dig Rna Labeling Kit Sp6 T7, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 1148 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dig rna labeling kit sp6 t7/product/Roche
    Average 99 stars, based on 1148 article reviews
    Price from $9.99 to $1999.99
    dig rna labeling kit sp6 t7 - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    85
    Roche t7 polymerase in vitro transcription
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    T7 Polymerase In Vitro Transcription, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 polymerase in vitro transcription/product/Roche
    Average 85 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    t7 polymerase in vitro transcription - by Bioz Stars, 2020-01
    85/100 stars
      Buy from Supplier

    80
    Roche dig rna labeling mix t7
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    Dig Rna Labeling Mix T7, supplied by Roche, used in various techniques. Bioz Stars score: 80/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dig rna labeling mix t7/product/Roche
    Average 80 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    dig rna labeling mix t7 - by Bioz Stars, 2020-01
    80/100 stars
      Buy from Supplier

    88
    Boehringer Mannheim dig rna labeling kit
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    Dig Rna Labeling Kit, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 88/100, based on 112 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dig rna labeling kit/product/Boehringer Mannheim
    Average 88 stars, based on 112 article reviews
    Price from $9.99 to $1999.99
    dig rna labeling kit - by Bioz Stars, 2020-01
    88/100 stars
      Buy from Supplier

    97
    Roche rnase free dnase i
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    Rnase Free Dnase I, supplied by Roche, used in various techniques. Bioz Stars score: 97/100, based on 3539 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase free dnase i/product/Roche
    Average 97 stars, based on 3539 article reviews
    Price from $9.99 to $1999.99
    rnase free dnase i - by Bioz Stars, 2020-01
    97/100 stars
      Buy from Supplier

    98
    Roche rnase free recombinant dnase i
    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by <t>RNA</t> structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay <t>(REMSA).</t> The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.
    Rnase Free Recombinant Dnase I, supplied by Roche, used in various techniques. Bioz Stars score: 98/100, based on 163 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase free recombinant dnase i/product/Roche
    Average 98 stars, based on 163 article reviews
    Price from $9.99 to $1999.99
    rnase free recombinant dnase i - by Bioz Stars, 2020-01
    98/100 stars
      Buy from Supplier

    99
    Roche dnase i
    Eleanors  are associated with the site of  ESR1  transcription in the nucleus. ( a ) Expression of  Eleanor  transcripts from various sites ( a – e ) within intron 2 of the  ESR1  gene.  ESR1  exon 1 and  ERBB2  intron 11 were used as controls. For qRT–PCR, total RNA was pre-treated with DNase I. The value for  ESR1  exon 1 in MCF7 cells was set to 1. Values are the means±s.d.;  n =3. Corresponding ΔC t  values are listed in  Supplementary Table 6 . ( b )  Eleanor  FISH signals were enlarged in LTED cells and diminished by resveratrol treatment (LTED-RES). The BAC probes covered the  ESR1  locus ( ESR1 -BAC), a centromeric region of human chromosome 6 ( CEN6 -BAC), exons only ( ESR1 -cDNA) and the intron only ( ESR1- intron 2, see  Fig. 1e , bottom). Cellular DNA was heat-denatured in the top panels, but not in others.  Eleanor  foci were enlarged in LTED cells, which were detected with  ESR1 -BAC and intron probes, but not the  ESR1 -cDNA probe. Box plots on the bottom right show quantification of FISH signals in the top panels ( n > 170 nuclei for each sample).  P -values were calculated using Student's  t -test (*** P
    Dnase I, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 25262 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dnase i/product/Roche
    Average 99 stars, based on 25262 article reviews
    Price from $9.99 to $1999.99
    dnase i - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results


    Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by RNA structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay (REMSA). The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.

    Journal: EMBO Molecular Medicine

    Article Title: A normal genetic variation modulates synaptic MMP‐9 protein levels and the severity of schizophrenia symptoms

    doi: 10.15252/emmm.201707723

    Figure Lengend Snippet: Structure of MMP ‐9 mRNA molecule fragment with either MMP ‐9_C or MMP ‐9_T rs20544 polymorphism Secondary structure models of 469 nt at the 3′ end of MMP‐9 mRNA obtained by RNA structure probing in solution (SHAPE analysis). Blue circles and red arrows, rs20544 polymorphism; blue boxes, G‐rich region, predicted FMRP binding site. Sequence of RNA probes that were used in the RNA electrophoretic mobility shift assay (REMSA). The location of the G‐rich sequence is indicated. REMSA showing FMRP binding to probes described in (B). The arrowhead indicates the FMRP/MMP‐9 RNA complex band that is clearly visible for the human wild‐type probe but is hardly detectable for the probe that harbored a mutation or deletion. 100× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction. The figure shows a representative image from three independent experiments.

    Article Snippet: Wild‐type human: 5′‐GTTCTGGAGGAAAGGGAGGAGTGGAGGTGGGCTGGGCCCTCTCTTCTCACCTTTGTTTTTTGTTGGAGTGTTTCTAAT‐3′ Mutant human: 5′‐GTTCTGGAGGAAAGGGACCAGTGGAGGTGGGCTGGGCCCTCTCTTCTCACCTTTGTTTTTTGTTGGAGTGTTTCTAAT‐3′ Delta human: 5′‐GTTCTGGAGGAAAGAGTGGAGGTGGGCTGGGCCCTCTCTTCTCACCTTTGTTTTTTGTTGGAGTGTTTCTAAT‐3′ Human MMP‐9_C and MMP‐9_T probes (˜470 nt) for REMSA were obtained by the digestion of pDrive REMSA_C and pDrive REMSA_T with NotI and in vitro transcription with RNA polymerase T7 (Roche).

    Techniques: Binding Assay, Sequencing, Electrophoretic Mobility Shift Assay, Mutagenesis

    rs20544 C/T polymorphism affects FMRP binding to MMP ‐9 RNA molecule Representative RNA electrophoretic mobility shift assay (REMSA) results. Labeled MMP‐9 RNA probe was incubated in the absence (lanes 1 and 8) or presence of increasing amounts of purified FMRP (lanes 2–6 and 9–13). 20× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction (lanes 7 and 14). Scheme of MMP‐9 mRNA indicating the location of the rs20544 polymorphism and part of the sequence that was used as a probe in the REMSA (A, C) and filter binding assay (D). Quantification of REMSA experiments. The relative mobility change of the protein–RNA complexes from the corresponding free probe band was plotted against increasing FMRP concentrations. For each FMRP concentration, the average distance of the shifted complex/free probe band was calculated from at least three independent experiments. Quantification of filter binding assay. The fraction of bound RNA was plotted against increasing FMRP concentrations. The data are from five independent experiments. Each column represents the mean counted from range of concentrations (indicated in Materials and Methods ), with the final concentration shown on the abscissa. Data information: Error bars indicate the SEM. * P

    Journal: EMBO Molecular Medicine

    Article Title: A normal genetic variation modulates synaptic MMP‐9 protein levels and the severity of schizophrenia symptoms

    doi: 10.15252/emmm.201707723

    Figure Lengend Snippet: rs20544 C/T polymorphism affects FMRP binding to MMP ‐9 RNA molecule Representative RNA electrophoretic mobility shift assay (REMSA) results. Labeled MMP‐9 RNA probe was incubated in the absence (lanes 1 and 8) or presence of increasing amounts of purified FMRP (lanes 2–6 and 9–13). 20× molar excess of unlabeled probe was added as a competitor to confirm the specificity of the interaction (lanes 7 and 14). Scheme of MMP‐9 mRNA indicating the location of the rs20544 polymorphism and part of the sequence that was used as a probe in the REMSA (A, C) and filter binding assay (D). Quantification of REMSA experiments. The relative mobility change of the protein–RNA complexes from the corresponding free probe band was plotted against increasing FMRP concentrations. For each FMRP concentration, the average distance of the shifted complex/free probe band was calculated from at least three independent experiments. Quantification of filter binding assay. The fraction of bound RNA was plotted against increasing FMRP concentrations. The data are from five independent experiments. Each column represents the mean counted from range of concentrations (indicated in Materials and Methods ), with the final concentration shown on the abscissa. Data information: Error bars indicate the SEM. * P

    Article Snippet: Wild‐type human: 5′‐GTTCTGGAGGAAAGGGAGGAGTGGAGGTGGGCTGGGCCCTCTCTTCTCACCTTTGTTTTTTGTTGGAGTGTTTCTAAT‐3′ Mutant human: 5′‐GTTCTGGAGGAAAGGGACCAGTGGAGGTGGGCTGGGCCCTCTCTTCTCACCTTTGTTTTTTGTTGGAGTGTTTCTAAT‐3′ Delta human: 5′‐GTTCTGGAGGAAAGAGTGGAGGTGGGCTGGGCCCTCTCTTCTCACCTTTGTTTTTTGTTGGAGTGTTTCTAAT‐3′ Human MMP‐9_C and MMP‐9_T probes (˜470 nt) for REMSA were obtained by the digestion of pDrive REMSA_C and pDrive REMSA_T with NotI and in vitro transcription with RNA polymerase T7 (Roche).

    Techniques: Binding Assay, Electrophoretic Mobility Shift Assay, Labeling, Incubation, Purification, Sequencing, Filter-binding Assay, Concentration Assay

    Eleanors  are associated with the site of  ESR1  transcription in the nucleus. ( a ) Expression of  Eleanor  transcripts from various sites ( a – e ) within intron 2 of the  ESR1  gene.  ESR1  exon 1 and  ERBB2  intron 11 were used as controls. For qRT–PCR, total RNA was pre-treated with DNase I. The value for  ESR1  exon 1 in MCF7 cells was set to 1. Values are the means±s.d.;  n =3. Corresponding ΔC t  values are listed in  Supplementary Table 6 . ( b )  Eleanor  FISH signals were enlarged in LTED cells and diminished by resveratrol treatment (LTED-RES). The BAC probes covered the  ESR1  locus ( ESR1 -BAC), a centromeric region of human chromosome 6 ( CEN6 -BAC), exons only ( ESR1 -cDNA) and the intron only ( ESR1- intron 2, see  Fig. 1e , bottom). Cellular DNA was heat-denatured in the top panels, but not in others.  Eleanor  foci were enlarged in LTED cells, which were detected with  ESR1 -BAC and intron probes, but not the  ESR1 -cDNA probe. Box plots on the bottom right show quantification of FISH signals in the top panels ( n > 170 nuclei for each sample).  P -values were calculated using Student's  t -test (*** P

    Journal: Nature Communications

    Article Title: A cluster of noncoding RNAs activates the ESR1 locus during breast cancer adaptation

    doi: 10.1038/ncomms7966

    Figure Lengend Snippet: Eleanors are associated with the site of ESR1 transcription in the nucleus. ( a ) Expression of Eleanor transcripts from various sites ( a – e ) within intron 2 of the ESR1 gene. ESR1 exon 1 and ERBB2 intron 11 were used as controls. For qRT–PCR, total RNA was pre-treated with DNase I. The value for ESR1 exon 1 in MCF7 cells was set to 1. Values are the means±s.d.; n =3. Corresponding ΔC t values are listed in Supplementary Table 6 . ( b ) Eleanor FISH signals were enlarged in LTED cells and diminished by resveratrol treatment (LTED-RES). The BAC probes covered the ESR1 locus ( ESR1 -BAC), a centromeric region of human chromosome 6 ( CEN6 -BAC), exons only ( ESR1 -cDNA) and the intron only ( ESR1- intron 2, see Fig. 1e , bottom). Cellular DNA was heat-denatured in the top panels, but not in others. Eleanor foci were enlarged in LTED cells, which were detected with ESR1 -BAC and intron probes, but not the ESR1 -cDNA probe. Box plots on the bottom right show quantification of FISH signals in the top panels ( n > 170 nuclei for each sample). P -values were calculated using Student's t -test (*** P

    Article Snippet: PCR with reverse transcription Total RNA was isolated from cultured cells with TRIzol (Invitrogen) and then treated with DNase I (Roche) before cDNA synthesis.

    Techniques: Expressing, Quantitative RT-PCR, Fluorescence In Situ Hybridization, BAC Assay

    u-Eleanor  plays a role in coordinated up-regulation of intragenic  Eleanor  and  ESR1  mRNA to promote the proliferative activity of LTED cells. ( a ) Overview of a region upstream of the  ESR1  locus. The RNA-Seq tracks were aligned with the ChIP-Seq data available in the UCSC genome browser 39  (University of California, Santa Cruz, CA, and  Supplementary Table 1 ). Sites amplified by qPCR are shown ( a – f ). ( b ) Local expression of  u-Eleanor .  u-Eleanor  was induced at site c in LTED cells, repressed in LTED-RES cells, and de-repressed by ICI 182,780 treatment (ER antagonist, related to  Fig. 5e–g ). For qRT–PCR, total RNA was pre-treated with DNase I, and the amplification efficiency for each primer set was normalized. The value for site b in MCF7 was set to 1. Values are the means±s.d.;  n =3. Corresponding ΔC t  values are listed in  Supplementary Table 6 . ( c ) RNA Pol II binding to the  u-Eleanor  region ( c ) and  ESR1  promoter A (f). For ChIP-qPCR, values are the means±s.d.;  n =3.  P -values were calculated using Student's  t -test (** P

    Journal: Nature Communications

    Article Title: A cluster of noncoding RNAs activates the ESR1 locus during breast cancer adaptation

    doi: 10.1038/ncomms7966

    Figure Lengend Snippet: u-Eleanor plays a role in coordinated up-regulation of intragenic Eleanor and ESR1 mRNA to promote the proliferative activity of LTED cells. ( a ) Overview of a region upstream of the ESR1 locus. The RNA-Seq tracks were aligned with the ChIP-Seq data available in the UCSC genome browser 39 (University of California, Santa Cruz, CA, and Supplementary Table 1 ). Sites amplified by qPCR are shown ( a – f ). ( b ) Local expression of u-Eleanor . u-Eleanor was induced at site c in LTED cells, repressed in LTED-RES cells, and de-repressed by ICI 182,780 treatment (ER antagonist, related to Fig. 5e–g ). For qRT–PCR, total RNA was pre-treated with DNase I, and the amplification efficiency for each primer set was normalized. The value for site b in MCF7 was set to 1. Values are the means±s.d.; n =3. Corresponding ΔC t values are listed in Supplementary Table 6 . ( c ) RNA Pol II binding to the u-Eleanor region ( c ) and ESR1 promoter A (f). For ChIP-qPCR, values are the means±s.d.; n =3. P -values were calculated using Student's t -test (** P

    Article Snippet: PCR with reverse transcription Total RNA was isolated from cultured cells with TRIzol (Invitrogen) and then treated with DNase I (Roche) before cDNA synthesis.

    Techniques: Activity Assay, RNA Sequencing Assay, Chromatin Immunoprecipitation, Amplification, Real-time Polymerase Chain Reaction, Expressing, Quantitative RT-PCR, Binding Assay